Starting /dee2/code/volunteer_pipeline.sh SRR8635307 current disk space = 1525908750336 free memory = 1553945308 SRR8635307 SRAfilesize 92d95b1b681ac8426c9419802f2cd4d6 SRR8635307.sra SRR8635307.sra file validated SRR8635307 is single end SRR8635307 is conventional basespace SRR8635307 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635307_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.38375 32.0 32.0 32.0 12.0 32.0 2 30.99375 32.0 32.0 32.0 32.0 32.0 3 32.9025 32.0 32.0 37.0 32.0 37.0 4 33.93 37.0 32.0 37.0 27.0 37.0 5 34.83125 37.0 37.0 37.0 27.0 37.0 6 37.257 41.0 37.0 41.0 32.0 41.0 7 37.70175 41.0 37.0 41.0 32.0 41.0 8 38.08325 41.0 37.0 41.0 32.0 41.0 9 38.3995 41.0 37.0 41.0 32.0 41.0 10-14 39.02385 41.0 39.4 41.0 36.0 41.0 15-19 39.279399999999995 41.0 41.0 41.0 37.0 41.0 20-24 39.3638 41.0 41.0 41.0 37.0 41.0 25-29 38.584500000000006 41.0 38.6 41.0 33.0 41.0 30-34 38.57470000000001 41.0 38.6 41.0 33.0 41.0 35-39 38.79395 41.0 40.2 41.0 33.0 41.0 40-44 38.2532 41.0 37.8 41.0 31.0 41.0 45-49 38.617549999999994 41.0 38.6 41.0 32.0 41.0 50-54 38.73865 41.0 40.2 41.0 32.0 41.0 55-59 38.624849999999995 41.0 39.4 41.0 33.0 41.0 60-64 38.069100000000006 41.0 37.0 41.0 31.0 41.0 65-69 38.02935 41.0 37.0 41.0 31.0 41.0 70-74 36.4396 41.0 36.0 41.0 24.0 41.0 75-79 34.8076 39.4 32.0 41.0 21.0 41.0 80-84 34.813849999999995 38.6 33.0 41.0 20.0 41.0 85-89 35.79090000000001 40.2 35.0 41.0 21.0 41.0 90-94 36.519549999999995 40.2 36.0 41.0 26.0 41.0 95-99 36.089 41.0 37.0 41.0 23.0 41.0 100-104 35.356350000000006 38.6 34.0 41.0 22.0 41.0 105-109 32.12825 36.0 28.0 41.0 12.0 41.0 110-114 32.525549999999996 37.0 29.0 41.0 12.0 41.0 115-119 30.612499999999994 34.0 24.0 41.0 12.0 41.0 120-124 31.110950000000003 36.0 25.0 41.0 12.0 41.0 125-129 28.896799999999995 31.0 20.0 39.4 12.0 41.0 130-134 27.6201 29.0 18.0 37.0 12.0 41.0 135-139 26.176499999999997 27.0 14.0 37.0 12.0 41.0 140-144 25.207549999999998 24.0 14.0 35.0 11.2 40.2 145-149 24.3134 25.0 12.0 34.0 12.0 38.6 150 23.81275 22.0 12.0 32.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 3.0 19 1.0 20 4.0 21 9.0 22 10.0 23 24.0 24 43.0 25 50.0 26 61.0 27 91.0 28 114.0 29 136.0 30 162.0 31 213.0 32 229.0 33 273.0 34 346.0 35 383.0 36 454.0 37 522.0 38 517.0 39 334.0 40 20.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.1 16.625 26.650000000000002 13.625000000000002 2 44.7 16.650000000000002 23.400000000000002 15.25 3 44.425 17.275 23.3 15.0 4 45.074999999999996 17.05 23.150000000000002 14.725 5 39.675 16.075 24.6 19.650000000000002 6 44.6 13.850000000000001 24.725 16.825000000000003 7 43.125 14.299999999999999 25.6 16.975 8 41.475 14.274999999999999 27.55 16.7 9 35.025 16.6 28.299999999999997 20.075000000000003 10-14 32.545 18.735 29.39 19.33 15-19 27.82 21.88 26.950000000000003 23.35 20-24 28.18 21.845 25.735000000000003 24.240000000000002 25-29 27.33 22.485 26.615 23.57 30-34 27.96 21.82 27.735 22.485 35-39 27.955000000000002 22.095000000000002 28.005000000000003 21.945 40-44 26.314999999999998 23.935000000000002 27.32 22.43 45-49 26.735 23.1 28.389999999999997 21.775 50-54 26.965 24.085 26.905 22.045 55-59 25.165 27.27 27.1 20.465 60-64 27.02 24.54 26.619999999999997 21.82 65-69 26.86 25.0 27.689999999999998 20.45 70-74 26.58 26.47 27.055 19.895 75-79 24.265 28.860000000000003 27.389999999999997 19.485 80-84 23.630000000000003 30.495 24.785 21.09 85-89 22.985 31.8 25.629999999999995 19.585 90-94 24.709999999999997 30.769999999999996 24.349999999999998 20.169999999999998 95-99 24.07 34.085 23.835 18.01 100-104 21.98 35.13 23.305 19.585 105-109 21.68 37.14 22.16 19.02 110-114 21.255 37.925 21.44 19.38 115-119 20.674999999999997 38.205 22.115000000000002 19.005 120-124 22.62 38.07 20.215 19.095000000000002 125-129 22.49 37.895 20.21 19.405 130-134 22.08 38.455 20.03 19.435 135-139 21.095 38.895 19.81 20.200000000000003 140-144 20.57 38.66 20.03 20.74 145-149 20.015 38.025 20.46 21.5 150 19.275000000000002 39.2 19.85 21.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.5 24 2.5 25 3.0 26 3.5 27 9.0 28 14.0 29 16.0 30 20.0 31 30.0 32 43.5 33 58.5 34 71.0 35 86.0 36 98.0 37 109.5 38 123.5 39 153.0 40 166.0 41 159.0 42 168.0 43 170.5 44 168.0 45 154.5 46 137.5 47 130.5 48 111.0 49 82.5 50 89.5 51 95.0 52 82.0 53 90.5 54 93.0 55 91.0 56 97.5 57 85.0 58 70.0 59 66.5 60 60.0 61 75.0 62 82.5 63 70.5 64 52.0 65 32.5 66 28.0 67 25.5 68 62.5 69 99.5 70 82.0 71 57.5 72 34.5 73 16.0 74 20.5 75 22.5 76 13.5 77 7.0 78 3.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.19818285065304 80.30000000000001 2 7.0698466780238505 12.45 3 0.9653605905735378 2.55 4 0.2839295854628052 1.0 5 0.08517887563884156 0.375 6 0.1419647927314026 0.75 7 0.05678591709256105 0.35000000000000003 8 0.08517887563884156 0.6 9 0.028392958546280524 0.22499999999999998 >10 0.08517887563884156 1.4000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 33 0.8250000000000001 No Hit GGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTT 13 0.325 No Hit GTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCC 10 0.25 No Hit GGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCC 9 0.22499999999999998 No Hit GACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAAT 8 0.2 No Hit GAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCC 8 0.2 No Hit GGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGC 8 0.2 No Hit CCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGC 7 0.17500000000000002 No Hit CGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGCG 7 0.17500000000000002 No Hit CACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCG 6 0.15 No Hit GAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCG 6 0.15 No Hit CCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGT 6 0.15 No Hit CCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGG 6 0.15 No Hit TTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAA 6 0.15 No Hit GAGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAG 5 0.125 No Hit CGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTT 5 0.125 No Hit AGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.0625 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.2625 0.0 0.0 0.0 0.0 56-57 0.3625 0.0 0.0 0.0 0.0 58-59 0.4 0.0 0.0 0.0 0.0 60-61 0.425 0.0 0.0 0.0 0.0 62-63 0.4625 0.0 0.0 0.0 0.0 64-65 0.5 0.0 0.0 0.0 0.0 66-67 0.6 0.0 0.0 0.0 0.0 68-69 0.6375 0.0 0.0 0.0 0.0 70-71 0.7 0.0 0.0 0.0 0.0 72-73 0.7375 0.0 0.0 0.0 0.0 74-75 0.8125 0.0 0.0 0.0 0.0 76-77 0.8875 0.0 0.0 0.0 0.0 78-79 0.925 0.0 0.0 0.0 0.0 80-81 1.0375 0.0 0.0 0.0 0.0 82-83 1.1749999999999998 0.0 0.0 0.0 0.0 84-85 1.4875 0.0 0.0 0.0 0.0 86-87 1.775 0.0 0.0 0.0 0.0 88-89 1.9625 0.0 0.0 0.0 0.0 90-91 2.3625 0.0 0.0 0.0 0.0 92-93 2.8 0.0 0.0 0.0 0.0 94-95 3.2125 0.0 0.0 0.0 0.0 96-97 3.475 0.0 0.0 0.0 0.0 98-99 3.7249999999999996 0.0 0.0 0.0 0.0 100-101 4.075 0.0 0.0 0.0 0.0 102-103 4.45 0.0 0.0 0.0 0.0 104-105 4.8625 0.0 0.0 0.0 0.0 106-107 5.6125 0.0 0.0 0.0 0.0 108-109 6.275 0.0 0.0 0.0 0.0 110-111 7.0875 0.0 0.0 0.0 0.0 112-113 7.775 0.0 0.0 0.0 0.0 114-115 8.587499999999999 0.0 0.0 0.0 0.0 116-117 9.524999999999999 0.0 0.0 0.0 0.0 118-119 10.274999999999999 0.0 0.0 0.0 0.0 120-121 10.962499999999999 0.0 0.0 0.0 0.0 122-123 11.6125 0.0 0.0 0.0 0.0 124-125 12.5625 0.0 0.0 0.0 0.0 126-127 13.375 0.0 0.0 0.0 0.0 128-129 13.9625 0.0 0.0 0.0 0.0 130-131 14.575 0.0 0.0 0.0 0.0 132-133 15.2875 0.0 0.0 0.0 0.0 134-135 15.950000000000001 0.0 0.0 0.0 0.0 136-137 16.5125 0.0 0.0 0.0 0.0 138 16.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGTT 10 0.006973645 144.0 8 >>END_MODULE Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338619 READS because READLEN < 1 Read 338619 spots for SRR8635307.sra Written 338619 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra Rejected 338611 READS because READLEN < 1 Read 338611 spots for SRR8635307.sra Written 338611 spots for SRR8635307.sra SRR ids: ['SRR8635307.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fr3k15jm SRR8635307.sra spots: 6772228 blocks: [[1, 338611], [338612, 677222], [677223, 1015833], [1015834, 1354444], [1354445, 1693055], [1693056, 2031666], [2031667, 2370277], [2370278, 2708888], [2708889, 3047499], [3047500, 3386110], [3386111, 3724721], [3724722, 4063332], [4063333, 4401943], [4401944, 4740554], [4740555, 5079165], [5079166, 5417776], [5417777, 5756387], [5756388, 6094998], [6094999, 6433609], [6433610, 6772228]] SRR8635307 file size 2266262 SRR8635307 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635307 SRR8635307_1.fastq Input file: SRR8635307_1.fastq trimmed: SRR8635307-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:25:29 2024 >> started Mon Dec 9 12:25:34 2024 >> done (5.140s) 6772228 reads processed; of these: 220 ( 0.00%) short reads filtered out after trimming by size control 80 ( 0.00%) empty reads filtered out after trimming by size control 6771928 (100.00%) reads available; of these: 1335177 (19.72%) trimmed reads available after processing 5436751 (80.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 46 0.00% 19 138 0.00% 20 243 0.00% 21 397 0.01% 22 542 0.01% 23 628 0.01% 24 730 0.01% 25 696 0.01% 26 558 0.01% 27 543 0.01% 28 602 0.01% 29 589 0.01% 30 608 0.01% 31 526 0.01% 32 496 0.01% 33 486 0.01% 34 480 0.01% 35 454 0.01% 36 476 0.01% 37 465 0.01% 38 427 0.01% 39 432 0.01% 40 445 0.01% 41 449 0.01% 42 424 0.01% 43 483 0.01% 44 523 0.01% 45 574 0.01% 46 610 0.01% 47 724 0.01% 48 760 0.01% 49 838 0.01% 50 1034 0.02% 51 1110 0.02% 52 1275 0.02% 53 1710 0.03% 54 2263 0.03% 55 2154 0.03% 56 1944 0.03% 57 2164 0.03% 58 2421 0.04% 59 2419 0.04% 60 2360 0.03% 61 2454 0.04% 62 2470 0.04% 63 2361 0.03% 64 2432 0.04% 65 2464 0.04% 66 2781 0.04% 67 2881 0.04% 68 2799 0.04% 69 2983 0.04% 70 3436 0.05% 71 3861 0.06% 72 4019 0.06% 73 3962 0.06% 74 4199 0.06% 75 4283 0.06% 76 4608 0.07% 77 5008 0.07% 78 5822 0.09% 79 7070 0.10% 80 8793 0.13% 81 9616 0.14% 82 9688 0.14% 83 11072 0.16% 84 12789 0.19% 85 12731 0.19% 86 11651 0.17% 87 12057 0.18% 88 12335 0.18% 89 13313 0.20% 90 14515 0.21% 91 16667 0.25% 92 17303 0.26% 93 16929 0.25% 94 18308 0.27% 95 20842 0.31% 96 20246 0.30% 97 19279 0.28% 98 18049 0.27% 99 17689 0.26% 100 18809 0.28% 101 19990 0.30% 102 21013 0.31% 103 21950 0.32% 104 23356 0.34% 105 25295 0.37% 106 27362 0.40% 107 29610 0.44% 108 31135 0.46% 109 32858 0.49% 110 34224 0.51% 111 37784 0.56% 112 37900 0.56% 113 36022 0.53% 114 35279 0.52% 115 35838 0.53% 116 37748 0.56% 117 39057 0.58% 118 29452 0.43% 119 0 0.00% 120 1 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 1 0.00% 130 1 0.00% 131 1 0.00% 132 6 0.00% 133 2 0.00% 134 5 0.00% 135 12 0.00% 136 26 0.00% 137 49 0.00% 138 96 0.00% 139 144 0.00% 140 268 0.00% 141 563 0.01% 142 908 0.01% 143 1861 0.03% 144 3918 0.06% 145 7621 0.11% 146 15142 0.22% 147 32582 0.48% 148 70616 1.04% 149 225661 3.33% 150 5436751 80.28% 6771928 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=48.39 fanout-score-rank=6 prefix-density=24.30 prefix-fanout=1.1 sequence=AGGCTAAATACTCCTGGGTGACCGATAGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=207.85 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=13.9 sequence=TTTTTTTTCTTATCGATTCTTGCTGTAGTGCGCACGTACGATGCCATTGGTTGTCCGTCCCGTTTCTGATTTCATGATCCGCGGGCGGTGGTTGTCGTCGGTTTAGCGCGTGCACTGTGCTGTGCTGAACGTTGATGATCGCTGCTCCATTTTGGGTTCAATAGAGAGAGGATTTGTACATGTATATTTCCGGTGTATCATTTCAGTAGCCATTTTCAATAAAGTCTTGAGTCTCCATATCCATGC Started job on | Dec 09 12:26:42 Started mapping on | Dec 09 12:26:42 Finished on | Dec 09 12:27:45 Mapping speed, Million of reads per hour | 386.97 Number of input reads | 6771928 Average input read length | 138 UNIQUE READS: Uniquely mapped reads number | 3813712 Uniquely mapped reads % | 56.32% Average mapped length | 129.03 Number of splices: Total | 259582 Number of splices: Annotated (sjdb) | 186724 Number of splices: GT/AG | 209210 Number of splices: GC/AG | 4292 Number of splices: AT/AC | 674 Number of splices: Non-canonical | 45406 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.00% Deletion average length | 1.52 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422899 % of reads mapped to multiple loci | 6.24% Number of reads mapped to too many loci | 1987837 % of reads mapped to too many loci | 29.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.33% % of reads unmapped: other | 1.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2535317 2535317 2535317 N_multimapping 422899 422899 422899 N_noFeature 320747 355659 3699172 N_ambiguous 91457 13423 418 UnstrandedReadsAssigned:3401508 PositiveStrandReadsAssigned:3444630 NegativeStrandReadsAssigned:114122 Dataset is classified positive stranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR8635307 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635307-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,771,928 reads, 3,684,910 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52973 SRR8635307.ke.tsv 35125 SRR8635307.se.tsv 88098 total ==> SRR8635307.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 62 17.003 PNS24243 293 194 0 0 KQK14069 1603 1504 78.0787 19.5332 KQK14071 474 375 0 0 ==> SRR8635307.se.tsv <== BRADI_1g14170v3 74 BRADI_1g53295v3 16 BRADI_1g59795v3 47 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 425 BRADI_1g74790v3 3 BRADI_1g09890v3 10 BRADI_1g77505v3 71 BRADI_1g48960v3 0 SRR8635307 completed mapping pipeline successfully