Starting /dee2/code/volunteer_pipeline.sh SRR8635308 current disk space = 1525920563200 free memory = 1561041336 SRR8635308 SRAfilesize 985c606d2fe62cf85c8fea0f8198398a SRR8635308.sra SRR8635308.sra file validated SRR8635308 is single end SRR8635308 is conventional basespace SRR8635308 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635308_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.76875 32.0 32.0 32.0 27.0 32.0 2 31.22625 32.0 32.0 32.0 32.0 32.0 3 33.24125 32.0 32.0 37.0 32.0 37.0 4 34.24375 37.0 32.0 37.0 27.0 37.0 5 34.81625 37.0 37.0 37.0 27.0 37.0 6 37.32175 41.0 37.0 41.0 27.0 41.0 7 37.86825 41.0 37.0 41.0 32.0 41.0 8 38.607 41.0 37.0 41.0 32.0 41.0 9 38.7395 41.0 37.0 41.0 32.0 41.0 10-14 39.082449999999994 41.0 41.0 41.0 36.0 41.0 15-19 39.27145 41.0 41.0 41.0 37.0 41.0 20-24 39.1656 41.0 41.0 41.0 36.0 41.0 25-29 38.3887 41.0 37.8 41.0 32.0 41.0 30-34 38.367399999999996 41.0 38.6 41.0 32.0 41.0 35-39 38.766949999999994 41.0 40.2 41.0 34.0 41.0 40-44 38.2239 41.0 37.8 41.0 30.0 41.0 45-49 38.623549999999994 41.0 39.4 41.0 33.0 41.0 50-54 38.7202 41.0 40.2 41.0 32.0 41.0 55-59 38.416549999999994 41.0 38.6 41.0 32.0 41.0 60-64 37.8394 41.0 37.0 41.0 30.0 41.0 65-69 37.89555 41.0 37.0 41.0 31.0 41.0 70-74 36.49725 41.0 36.0 41.0 24.0 41.0 75-79 35.05245 39.4 33.0 41.0 21.0 41.0 80-84 34.95235 38.6 32.0 41.0 20.0 41.0 85-89 35.722500000000004 40.2 35.0 41.0 20.0 41.0 90-94 36.48835 41.0 36.0 41.0 26.0 41.0 95-99 36.1062 41.0 37.0 41.0 23.0 41.0 100-104 35.49295000000001 40.2 34.0 41.0 22.0 41.0 105-109 32.3653 37.0 28.0 41.0 12.0 41.0 110-114 32.6832 37.0 29.0 41.0 12.0 41.0 115-119 30.9997 36.0 24.0 41.0 12.0 41.0 120-124 31.14565 36.0 25.0 41.0 12.0 41.0 125-129 29.07745 31.0 20.0 39.4 12.0 41.0 130-134 27.9169 30.0 18.0 37.0 12.0 41.0 135-139 26.576249999999998 28.0 14.0 37.0 12.0 41.0 140-144 25.341949999999997 24.0 12.0 35.0 11.2 40.2 145-149 24.60895 26.0 12.0 35.0 12.0 39.4 150 23.9335 27.0 12.0 32.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 2.0 20 12.0 21 13.0 22 16.0 23 27.0 24 50.0 25 62.0 26 76.0 27 87.0 28 123.0 29 123.0 30 155.0 31 173.0 32 210.0 33 273.0 34 284.0 35 349.0 36 433.0 37 536.0 38 572.0 39 378.0 40 44.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.1 15.9 27.275 13.725000000000001 2 44.0 16.05 25.575 14.374999999999998 3 44.5 17.125 24.925 13.450000000000001 4 42.975 17.1 25.650000000000002 14.274999999999999 5 41.475 16.925 24.275 17.325 6 42.55 15.15 26.075 16.225 7 44.05 13.900000000000002 25.124999999999996 16.925 8 40.525 15.625 26.1 17.75 9 35.725 17.825 28.349999999999998 18.099999999999998 10-14 31.35 20.085 29.959999999999997 18.605 15-19 27.255000000000003 22.48 28.134999999999998 22.13 20-24 26.765 22.93 26.919999999999998 23.385 25-29 26.58 23.685000000000002 27.72 22.015 30-34 26.775 23.445 28.155 21.625 35-39 26.905 22.875 28.9 21.32 40-44 26.775 23.799999999999997 28.389999999999997 21.035 45-49 25.36 24.05 29.23 21.36 50-54 25.330000000000002 25.185000000000002 28.23 21.255 55-59 24.68 26.979999999999997 28.050000000000004 20.29 60-64 25.174999999999997 25.740000000000002 27.6 21.485000000000003 65-69 25.629999999999995 26.674999999999997 27.66 20.035 70-74 25.53 27.54 27.455000000000002 19.475 75-79 23.615 29.475 27.29 19.62 80-84 23.015 30.814999999999998 26.39 19.78 85-89 22.615 32.12 25.935000000000002 19.33 90-94 23.54 32.32 25.435000000000002 18.705 95-99 22.62 35.08 24.46 17.84 100-104 21.89 35.315000000000005 23.849999999999998 18.945 105-109 21.41 36.985 22.835 18.77 110-114 21.07 37.36 23.395 18.175 115-119 20.82 37.805 22.345000000000002 19.03 120-124 21.725 38.435 21.26 18.58 125-129 21.665 37.87 20.995 19.470000000000002 130-134 21.485000000000003 37.12 21.645 19.75 135-139 20.244999999999997 38.46 20.93 20.365 140-144 20.49 37.085 21.34 21.085 145-149 19.29 37.09 21.21 22.41 150 19.400000000000002 36.625 21.425 22.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.5 20 1.0 21 1.0 22 4.0 23 4.5 24 4.5 25 7.0 26 7.0 27 10.5 28 17.0 29 23.5 30 30.0 31 41.0 32 47.5 33 59.0 34 75.5 35 72.5 36 98.5 37 130.5 38 126.5 39 141.5 40 169.0 41 175.0 42 171.5 43 179.5 44 177.5 45 164.5 46 176.5 47 168.0 48 136.0 49 117.5 50 90.5 51 79.0 52 87.5 53 91.5 54 100.0 55 100.5 56 93.0 57 72.0 58 57.0 59 51.0 60 49.5 61 76.5 62 75.0 63 58.5 64 48.5 65 27.5 66 20.5 67 19.5 68 36.5 69 58.0 70 51.5 71 37.0 72 22.0 73 11.5 74 11.5 75 12.5 76 9.0 77 3.5 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.6265998887034 83.22500000000001 2 5.843071786310518 10.5 3 0.862548692264886 2.325 4 0.3060656649972176 1.0999999999999999 5 0.13912075681691707 0.625 6 0.08347245409015025 0.44999999999999996 7 0.02782415136338342 0.17500000000000002 8 0.0 0.0 9 0.05564830272676684 0.44999999999999996 >10 0.05564830272676684 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 30 0.75 No Hit GTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCC 16 0.4 No Hit CGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGG 9 0.22499999999999998 No Hit CGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGCG 9 0.22499999999999998 No Hit GTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAA 7 0.17500000000000002 No Hit CACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCG 6 0.15 No Hit CCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGC 6 0.15 No Hit GCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTG 6 0.15 No Hit GGGTTTAGGTTGGGCTTCGGGCCATAGGGGTCCGTCTGTGTCATCCGTCT 5 0.125 No Hit CTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAG 5 0.125 No Hit AGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGT 5 0.125 No Hit TGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCG 5 0.125 No Hit GGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.2125 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.275 0.0 0.0 0.0 0.0 52-53 0.275 0.0 0.0 0.0 0.0 54-55 0.2875 0.0 0.0 0.0 0.0 56-57 0.325 0.0 0.0 0.0 0.0 58-59 0.35 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.42500000000000004 0.0 0.0 0.0 0.0 64-65 0.45 0.0 0.0 0.0 0.0 66-67 0.45 0.0 0.0 0.0 0.0 68-69 0.4625 0.0 0.0 0.0 0.0 70-71 0.525 0.0 0.0 0.0 0.0 72-73 0.625 0.0 0.0 0.0 0.0 74-75 0.7 0.0 0.0 0.0 0.0 76-77 0.7875 0.0 0.0 0.0 0.0 78-79 0.925 0.0 0.0 0.0 0.0 80-81 1.1124999999999998 0.0 0.0 0.0 0.0 82-83 1.3 0.0 0.0 0.0 0.0 84-85 1.725 0.0 0.0 0.0 0.0 86-87 1.9 0.0 0.0 0.0 0.0 88-89 2.1125 0.0 0.0 0.0 0.0 90-91 2.45 0.0 0.0 0.0 0.0 92-93 2.925 0.0 0.0 0.0 0.0 94-95 3.225 0.0 0.0 0.0 0.0 96-97 3.575 0.0 0.0 0.0 0.0 98-99 3.9000000000000004 0.0 0.0 0.0 0.0 100-101 4.3125 0.0 0.0 0.0 0.0 102-103 4.8375 0.0 0.0 0.0 0.0 104-105 5.375 0.0 0.0 0.0 0.0 106-107 5.85 0.0 0.0 0.0 0.0 108-109 6.2875 0.0 0.0 0.0 0.0 110-111 6.8375 0.0 0.0 0.0 0.0 112-113 7.725 0.0 0.0 0.0 0.0 114-115 8.4875 0.0 0.0 0.0 0.0 116-117 9.274999999999999 0.0 0.0 0.0 0.0 118-119 10.024999999999999 0.0 0.0 0.0 0.0 120-121 10.8875 0.0 0.0 0.0 0.0 122-123 11.625 0.0 0.0 0.0 0.0 124-125 12.225000000000001 0.0 0.0 0.0 0.0 126-127 12.8 0.0 0.0 0.0 0.0 128-129 13.5125 0.0 0.0 0.0 0.0 130-131 14.25 0.0 0.0 0.0 0.0 132-133 14.825 0.0 0.0 0.0 0.0 134-135 15.35 0.0 0.0 0.0 0.0 136-137 15.95 0.0 0.0 0.0 0.0 138 16.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTG 10 0.006973645 144.0 8 AAGGTAA 10 0.006973645 144.0 9 GGTGGGT 10 0.006973645 144.0 1 GAAGGTA 10 0.006973645 144.0 8 >>END_MODULE Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra Rejected 271929 READS because READLEN < 1 Read 271929 spots for SRR8635308.sra Written 271929 spots for SRR8635308.sra SRR ids: ['SRR8635308.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kr8tojy3 SRR8635308.sra spots: 5438580 blocks: [[1, 271929], [271930, 543858], [543859, 815787], [815788, 1087716], [1087717, 1359645], [1359646, 1631574], [1631575, 1903503], [1903504, 2175432], [2175433, 2447361], [2447362, 2719290], [2719291, 2991219], [2991220, 3263148], [3263149, 3535077], [3535078, 3807006], [3807007, 4078935], [4078936, 4350864], [4350865, 4622793], [4622794, 4894722], [4894723, 5166651], [5166652, 5438580]] SRR8635308 file size 1819542 SRR8635308 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635308 SRR8635308_1.fastq Input file: SRR8635308_1.fastq trimmed: SRR8635308-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:28:36 2024 >> started Mon Dec 9 12:28:41 2024 >> done (4.399s) 5438580 reads processed; of these: 151 ( 0.00%) short reads filtered out after trimming by size control 71 ( 0.00%) empty reads filtered out after trimming by size control 5438358 (100.00%) reads available; of these: 1028008 (18.90%) trimmed reads available after processing 4410350 (81.10%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 30 0.00% 19 77 0.00% 20 124 0.00% 21 237 0.00% 22 365 0.01% 23 466 0.01% 24 454 0.01% 25 437 0.01% 26 412 0.01% 27 425 0.01% 28 480 0.01% 29 475 0.01% 30 485 0.01% 31 436 0.01% 32 448 0.01% 33 421 0.01% 34 376 0.01% 35 377 0.01% 36 396 0.01% 37 371 0.01% 38 385 0.01% 39 350 0.01% 40 353 0.01% 41 386 0.01% 42 393 0.01% 43 405 0.01% 44 442 0.01% 45 487 0.01% 46 491 0.01% 47 617 0.01% 48 692 0.01% 49 739 0.01% 50 839 0.02% 51 904 0.02% 52 988 0.02% 53 1193 0.02% 54 1655 0.03% 55 1715 0.03% 56 1513 0.03% 57 1683 0.03% 58 1795 0.03% 59 1779 0.03% 60 1747 0.03% 61 1948 0.04% 62 1875 0.03% 63 1907 0.04% 64 1893 0.03% 65 2108 0.04% 66 2189 0.04% 67 2358 0.04% 68 2329 0.04% 69 2389 0.04% 70 2671 0.05% 71 3062 0.06% 72 3119 0.06% 73 3137 0.06% 74 3354 0.06% 75 3438 0.06% 76 3746 0.07% 77 3921 0.07% 78 4632 0.09% 79 5655 0.10% 80 7006 0.13% 81 7455 0.14% 82 7784 0.14% 83 8821 0.16% 84 10167 0.19% 85 10262 0.19% 86 9242 0.17% 87 9261 0.17% 88 9519 0.18% 89 10198 0.19% 90 11112 0.20% 91 11925 0.22% 92 12592 0.23% 93 12810 0.24% 94 13562 0.25% 95 15303 0.28% 96 15353 0.28% 97 14449 0.27% 98 13537 0.25% 99 13521 0.25% 100 14436 0.27% 101 15058 0.28% 102 15767 0.29% 103 16323 0.30% 104 17240 0.32% 105 18674 0.34% 106 20075 0.37% 107 21382 0.39% 108 23289 0.43% 109 24391 0.45% 110 25123 0.46% 111 28229 0.52% 112 29171 0.54% 113 26887 0.49% 114 26356 0.48% 115 26869 0.49% 116 27996 0.51% 117 28353 0.52% 118 21107 0.39% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 1 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 3 0.00% 130 0 0.00% 131 2 0.00% 132 1 0.00% 133 9 0.00% 134 18 0.00% 135 15 0.00% 136 30 0.00% 137 53 0.00% 138 108 0.00% 139 177 0.00% 140 303 0.01% 141 473 0.01% 142 910 0.02% 143 1681 0.03% 144 3353 0.06% 145 6649 0.12% 146 12893 0.24% 147 27144 0.50% 148 58717 1.08% 149 180289 3.32% 150 4410350 81.10% 5438358 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=41.77 fanout-score-rank=9 prefix-density=19.91 prefix-fanout=1.1 sequence=AGGCTAAATACTCCTGGGTGACCGATAGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=675.47 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=9.9 sequence=TTTTTTTCTTATCGATTCTTGCTGTAGTGCGCACGTACGATGCCATTGGTTGTCCGTCCCGTTTCTGATTTCATGATCCGCGGGCGGTGGTTGTCGTCGGTTTAGCGCGTGCACTGTGCTGTGCTGAACGTTGATGATCGCTGCTCCATTTTGGGTTCAATAGAGAGAGGATTTGTACATGTATATTTCCGGTGTATCATTTCAGTAGCCATTTTCAATAAAGTCTTGAGTCTCCATATCCATGC Started job on | Dec 09 12:29:04 Started mapping on | Dec 09 12:29:04 Finished on | Dec 09 12:29:47 Mapping speed, Million of reads per hour | 455.30 Number of input reads | 5438358 Average input read length | 142 UNIQUE READS: Uniquely mapped reads number | 3307218 Uniquely mapped reads % | 60.81% Average mapped length | 134.10 Number of splices: Total | 284033 Number of splices: Annotated (sjdb) | 216901 Number of splices: GT/AG | 243211 Number of splices: GC/AG | 4753 Number of splices: AT/AC | 273 Number of splices: Non-canonical | 35796 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.00% Deletion average length | 1.61 Insertion rate per base | 0.01% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 387929 % of reads mapped to multiple loci | 7.13% Number of reads mapped to too many loci | 1209572 % of reads mapped to too many loci | 22.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.14% % of reads unmapped: other | 1.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1743211 1743211 1743211 N_multimapping 387929 387929 387929 N_noFeature 300796 332706 3202463 N_ambiguous 87678 16554 473 UnstrandedReadsAssigned:2918744 PositiveStrandReadsAssigned:2957958 NegativeStrandReadsAssigned:104282 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8635308 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635308-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,438,358 reads, 3,248,263 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52973 SRR8635308.ke.tsv 35125 SRR8635308.se.tsv 88098 total ==> SRR8635308.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 67 20.9017 PNS24243 293 194 0 0 KQK14069 1603 1504 26 7.39924 KQK14071 474 375 0 0 ==> SRR8635308.se.tsv <== BRADI_1g14170v3 20 BRADI_1g53295v3 4 BRADI_1g59795v3 64 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 454 BRADI_1g74790v3 1 BRADI_1g09890v3 2 BRADI_1g77505v3 62 BRADI_1g48960v3 0 SRR8635308 completed mapping pipeline successfully