Starting /dee2/code/volunteer_pipeline.sh SRR8635309 current disk space = 1525892259840 free memory = 1571147528 SRR8635309 SRAfilesize 27ad1e37c26c5efc6df50d2cbe3ec02d SRR8635309.sra SRR8635309.sra file validated SRR8635309 is single end SRR8635309 is conventional basespace SRR8635309 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635309_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.74125 32.0 32.0 32.0 27.0 32.0 2 31.10625 32.0 32.0 32.0 32.0 32.0 3 32.89875 32.0 32.0 37.0 32.0 37.0 4 33.95 37.0 32.0 37.0 27.0 37.0 5 34.83375 37.0 37.0 37.0 27.0 37.0 6 37.515 41.0 37.0 41.0 32.0 41.0 7 38.11 41.0 37.0 41.0 32.0 41.0 8 38.48425 41.0 37.0 41.0 32.0 41.0 9 38.72075 41.0 37.0 41.0 32.0 41.0 10-14 39.121449999999996 41.0 41.0 41.0 37.0 41.0 15-19 39.323 41.0 41.0 41.0 37.0 41.0 20-24 39.3057 41.0 41.0 41.0 37.0 41.0 25-29 38.54645 41.0 38.6 41.0 33.0 41.0 30-34 38.41180000000001 41.0 39.4 41.0 31.0 41.0 35-39 38.715999999999994 41.0 40.2 41.0 33.0 41.0 40-44 38.2051 41.0 37.8 41.0 31.0 41.0 45-49 38.634100000000004 41.0 39.4 41.0 33.0 41.0 50-54 38.6414 41.0 39.4 41.0 32.0 41.0 55-59 38.37485 41.0 38.6 41.0 32.0 41.0 60-64 37.83284999999999 41.0 37.0 41.0 29.0 41.0 65-69 37.8143 41.0 37.0 41.0 31.0 41.0 70-74 36.322 41.0 35.0 41.0 24.0 41.0 75-79 34.549 38.6 32.0 41.0 20.0 41.0 80-84 34.411550000000005 38.6 31.0 41.0 16.0 41.0 85-89 35.4867 40.2 33.0 41.0 20.0 41.0 90-94 36.359249999999996 40.2 36.0 41.0 25.0 41.0 95-99 35.960800000000006 40.2 36.0 41.0 22.0 41.0 100-104 35.18085 37.8 34.0 41.0 20.0 41.0 105-109 31.803250000000002 36.0 27.0 41.0 12.0 41.0 110-114 32.2753 36.0 28.0 41.0 12.0 41.0 115-119 30.457749999999997 34.0 23.0 40.2 12.0 41.0 120-124 30.82645 35.0 25.0 41.0 12.0 41.0 125-129 28.8162 31.0 20.0 39.4 12.0 41.0 130-134 27.276249999999997 30.0 16.0 37.0 12.0 41.0 135-139 25.94615 27.0 12.0 37.0 12.0 41.0 140-144 24.88995 24.0 12.0 35.0 11.2 40.2 145-149 24.0502 25.0 12.0 33.0 12.0 37.8 150 23.475 22.0 12.0 32.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 3.0 20 11.0 21 13.0 22 29.0 23 29.0 24 34.0 25 70.0 26 80.0 27 87.0 28 139.0 29 145.0 30 142.0 31 184.0 32 213.0 33 259.0 34 340.0 35 381.0 36 425.0 37 535.0 38 534.0 39 322.0 40 24.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.45 14.799999999999999 26.575 15.174999999999999 2 44.45 17.25 23.974999999999998 14.325 3 42.699999999999996 17.549999999999997 24.55 15.2 4 42.675000000000004 17.724999999999998 24.75 14.85 5 39.025 16.400000000000002 26.25 18.325 6 42.325 14.274999999999999 25.275 18.125 7 40.699999999999996 14.799999999999999 27.125 17.375 8 38.95 15.299999999999999 28.849999999999998 16.900000000000002 9 37.0 16.125 28.15 18.725 10-14 31.105 20.76 29.470000000000002 18.665000000000003 15-19 27.275 23.0 27.665 22.06 20-24 26.950000000000003 23.22 26.57 23.26 25-29 26.565 23.125 27.134999999999998 23.175 30-34 27.134999999999998 22.55 28.76 21.555 35-39 27.750000000000004 22.275 28.76 21.215 40-44 25.435000000000002 24.77 28.01 21.785 45-49 25.869999999999997 24.63 28.105000000000004 21.395 50-54 25.34 26.025 27.12 21.515 55-59 23.895 27.42 27.82 20.865000000000002 60-64 26.115 25.465 27.445000000000004 20.974999999999998 65-69 26.55 26.135 27.605 19.71 70-74 25.629999999999995 27.435 27.98 18.955 75-79 23.66 29.725 26.815 19.8 80-84 23.01 30.880000000000003 26.040000000000003 20.07 85-89 22.49 31.979999999999997 26.105 19.425 90-94 24.07 31.55 25.285000000000004 19.095000000000002 95-99 23.41 34.385 24.104999999999997 18.099999999999998 100-104 21.355 34.855000000000004 24.474999999999998 19.314999999999998 105-109 21.0 35.93 23.805 19.265 110-114 21.34 36.315 23.52 18.825 115-119 20.61 37.685 22.915 18.790000000000003 120-124 21.759999999999998 37.43 22.134999999999998 18.675 125-129 21.805 37.135 21.795 19.265 130-134 21.310000000000002 37.045 21.615000000000002 20.03 135-139 20.565 37.82 21.47 20.145 140-144 20.61 36.38 22.134999999999998 20.875 145-149 19.955000000000002 36.08 21.525 22.439999999999998 150 19.875 35.725 21.6 22.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 1.0 10 1.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 1.0 20 2.0 21 2.5 22 3.5 23 3.0 24 2.5 25 5.5 26 8.0 27 10.5 28 15.0 29 18.5 30 28.0 31 40.5 32 46.0 33 65.5 34 82.5 35 83.0 36 98.5 37 130.5 38 137.5 39 150.5 40 175.0 41 170.5 42 163.5 43 166.0 44 170.0 45 158.5 46 149.5 47 143.5 48 120.0 49 106.0 50 95.0 51 90.5 52 84.0 53 82.5 54 91.0 55 100.0 56 110.0 57 91.5 58 76.0 59 60.0 60 47.0 61 73.0 62 90.0 63 67.0 64 36.0 65 21.0 66 17.5 67 20.0 68 38.0 69 69.0 70 64.5 71 36.5 72 21.5 73 10.5 74 9.5 75 14.0 76 12.5 77 5.5 78 2.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.125 #Duplication Level Percentage of deduplicated Percentage of total 1 92.25806451612904 82.22500000000001 2 6.143057503506311 10.95 3 0.7573632538569425 2.025 4 0.33660589060308554 1.2 5 0.2805049088359046 1.25 6 0.08415147265077139 0.44999999999999996 7 0.028050490883590466 0.17500000000000002 8 0.028050490883590466 0.2 9 0.0 0.0 >10 0.08415147265077139 1.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 35 0.8750000000000001 No Hit GTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCC 16 0.4 No Hit GAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCC 10 0.25 No Hit GGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGC 8 0.2 No Hit CGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGG 7 0.17500000000000002 No Hit GTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAA 6 0.15 No Hit GGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTC 6 0.15 No Hit CGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGCG 6 0.15 No Hit GATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCGGCGGA 5 0.125 No Hit GAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGC 5 0.125 No Hit GGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAA 5 0.125 No Hit GGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTT 5 0.125 No Hit CTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAG 5 0.125 No Hit GAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCG 5 0.125 No Hit CGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGA 5 0.125 No Hit ACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATG 5 0.125 No Hit GGAGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCC 5 0.125 No Hit GGGGGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.037500000000000006 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.0875 0.0 0.0 0.0 0.0 28-29 0.1625 0.0 0.0 0.0 0.0 30-31 0.2 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.2 0.0 0.0 0.0 0.0 38-39 0.21250000000000002 0.0 0.0 0.0 0.0 40-41 0.2625 0.0 0.0 0.0 0.0 42-43 0.2875 0.0 0.0 0.0 0.0 44-45 0.3375 0.0 0.0 0.0 0.0 46-47 0.35 0.0 0.0 0.0 0.0 48-49 0.4375 0.0 0.0 0.0 0.0 50-51 0.475 0.0 0.0 0.0 0.0 52-53 0.5125 0.0 0.0 0.0 0.0 54-55 0.575 0.0 0.0 0.0 0.0 56-57 0.675 0.0 0.0 0.0 0.0 58-59 0.75 0.0 0.0 0.0 0.0 60-61 0.8 0.0 0.0 0.0 0.0 62-63 0.825 0.0 0.0 0.0 0.0 64-65 0.8875 0.0 0.0 0.0 0.0 66-67 1.0125 0.0 0.0 0.0 0.0 68-69 1.1375000000000002 0.0 0.0 0.0 0.0 70-71 1.2 0.0 0.0 0.0 0.0 72-73 1.225 0.0 0.0 0.0 0.0 74-75 1.2999999999999998 0.0 0.0 0.0 0.0 76-77 1.3875 0.0 0.0 0.0 0.0 78-79 1.475 0.0 0.0 0.0 0.0 80-81 1.625 0.0 0.0 0.0 0.0 82-83 1.8250000000000002 0.0 0.0 0.0 0.0 84-85 1.975 0.0 0.0 0.0 0.0 86-87 2.2125 0.0 0.0 0.0 0.0 88-89 2.4875 0.0 0.0 0.0 0.0 90-91 2.8 0.0 0.0 0.0 0.0 92-93 3.0875 0.0 0.0 0.0 0.0 94-95 3.4124999999999996 0.0 0.0 0.0 0.0 96-97 3.8625 0.0 0.0 0.0 0.0 98-99 4.1625 0.0 0.0 0.0 0.0 100-101 4.45 0.0 0.0 0.0 0.0 102-103 4.75 0.0 0.0 0.0 0.0 104-105 5.225 0.0 0.0 0.0 0.0 106-107 5.775 0.0 0.0 0.0 0.0 108-109 6.425000000000001 0.0 0.0 0.0 0.0 110-111 7.025 0.0 0.0 0.0 0.0 112-113 7.6625 0.0 0.0 0.0 0.0 114-115 8.65 0.0 0.0 0.0 0.0 116-117 9.425 0.0 0.0 0.0 0.0 118-119 9.962499999999999 0.0 0.0 0.0 0.0 120-121 10.7 0.0 0.0 0.0 0.0 122-123 11.6 0.0 0.0 0.0 0.0 124-125 12.3 0.0 0.0 0.0 0.0 126-127 12.7125 0.0 0.0 0.0 0.0 128-129 13.1375 0.0 0.0 0.0 0.0 130-131 13.6625 0.0 0.0 0.0 0.0 132-133 14.287500000000001 0.0 0.0 0.0 0.0 134-135 14.8125 0.0 0.0 0.0 0.0 136-137 15.225 0.0 0.0 0.0 0.0 138 15.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGGT 10 0.006973645 144.0 1 >>END_MODULE Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra Rejected 462965 READS because READLEN < 1 Read 462965 spots for SRR8635309.sra Written 462965 spots for SRR8635309.sra SRR ids: ['SRR8635309.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bqremk_p SRR8635309.sra spots: 9259300 blocks: [[1, 462965], [462966, 925930], [925931, 1388895], [1388896, 1851860], [1851861, 2314825], [2314826, 2777790], [2777791, 3240755], [3240756, 3703720], [3703721, 4166685], [4166686, 4629650], [4629651, 5092615], [5092616, 5555580], [5555581, 6018545], [6018546, 6481510], [6481511, 6944475], [6944476, 7407440], [7407441, 7870405], [7870406, 8333370], [8333371, 8796335], [8796336, 9259300]] SRR8635309 file size 3099334 SRR8635309 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635309 SRR8635309_1.fastq Input file: SRR8635309_1.fastq trimmed: SRR8635309-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:31:06 2024 >> started Mon Dec 9 12:31:12 2024 >> done (6.229s) 9259300 reads processed; of these: 289 ( 0.00%) short reads filtered out after trimming by size control 111 ( 0.00%) empty reads filtered out after trimming by size control 9258900 (100.00%) reads available; of these: 1817608 (19.63%) trimmed reads available after processing 7441292 (80.37%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 89 0.00% 19 196 0.00% 20 333 0.00% 21 557 0.01% 22 857 0.01% 23 1036 0.01% 24 965 0.01% 25 1026 0.01% 26 873 0.01% 27 911 0.01% 28 1000 0.01% 29 1000 0.01% 30 1028 0.01% 31 941 0.01% 32 916 0.01% 33 857 0.01% 34 786 0.01% 35 853 0.01% 36 797 0.01% 37 877 0.01% 38 748 0.01% 39 852 0.01% 40 829 0.01% 41 728 0.01% 42 842 0.01% 43 896 0.01% 44 897 0.01% 45 951 0.01% 46 1121 0.01% 47 1272 0.01% 48 1463 0.02% 49 1475 0.02% 50 1726 0.02% 51 1943 0.02% 52 2056 0.02% 53 2564 0.03% 54 3356 0.04% 55 3248 0.04% 56 2931 0.03% 57 3279 0.04% 58 3540 0.04% 59 3530 0.04% 60 3528 0.04% 61 3638 0.04% 62 3762 0.04% 63 3718 0.04% 64 3573 0.04% 65 3940 0.04% 66 4141 0.04% 67 4456 0.05% 68 4411 0.05% 69 4393 0.05% 70 4934 0.05% 71 5561 0.06% 72 5674 0.06% 73 5682 0.06% 74 5898 0.06% 75 6173 0.07% 76 6566 0.07% 77 7227 0.08% 78 8163 0.09% 79 10305 0.11% 80 12647 0.14% 81 13551 0.15% 82 13975 0.15% 83 15736 0.17% 84 18629 0.20% 85 18068 0.20% 86 16454 0.18% 87 16188 0.17% 88 16848 0.18% 89 18039 0.19% 90 19293 0.21% 91 21044 0.23% 92 22260 0.24% 93 22591 0.24% 94 23633 0.26% 95 26817 0.29% 96 26539 0.29% 97 24842 0.27% 98 23512 0.25% 99 23646 0.26% 100 24475 0.26% 101 25970 0.28% 102 26977 0.29% 103 28321 0.31% 104 29586 0.32% 105 32586 0.35% 106 35172 0.38% 107 37586 0.41% 108 40465 0.44% 109 41827 0.45% 110 44166 0.48% 111 48842 0.53% 112 50379 0.54% 113 47422 0.51% 114 46112 0.50% 115 46746 0.50% 116 48714 0.53% 117 50284 0.54% 118 36764 0.40% 119 1 0.00% 120 1 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 1 0.00% 129 0 0.00% 130 1 0.00% 131 6 0.00% 132 11 0.00% 133 16 0.00% 134 26 0.00% 135 33 0.00% 136 56 0.00% 137 114 0.00% 138 186 0.00% 139 313 0.00% 140 567 0.01% 141 988 0.01% 142 1821 0.02% 143 3417 0.04% 144 6509 0.07% 145 12521 0.14% 146 24540 0.27% 147 50285 0.54% 148 104394 1.13% 149 313207 3.38% 150 7441292 80.37% 9258900 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=42.56 fanout-score-rank=9 prefix-density=20.96 prefix-fanout=1.1 sequence=AGGCTAAATACTCCTGGGTGACCGATAGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=553.51 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=10.0 sequence=TTTTTTTCTTATCGATTCTTGCTGTAGTGCGCACGTACGATGCCATTGGTTGTCCGTCCCGTTTCTGATTTCATGATCCGCGGGCGGTGGTTGTCGTCGGTTTAGCGCGTGCACTGTGCTGTGCTGAACGTTGATGATCGCTGCTCCATTTTGGGTTCAATAGAGAGAGGATTTGTACATGTATATTTCCGGTGTATCATTTCAGTAGCCATTTTCAATAAAGTCTTGAGTCTCCATATCCATGC Started job on | Dec 09 12:31:56 Started mapping on | Dec 09 12:31:57 Finished on | Dec 09 12:33:04 Mapping speed, Million of reads per hour | 497.49 Number of input reads | 9258900 Average input read length | 142 UNIQUE READS: Uniquely mapped reads number | 5557871 Uniquely mapped reads % | 60.03% Average mapped length | 133.62 Number of splices: Total | 461211 Number of splices: Annotated (sjdb) | 347654 Number of splices: GT/AG | 391595 Number of splices: GC/AG | 7778 Number of splices: AT/AC | 475 Number of splices: Non-canonical | 61363 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.00% Deletion average length | 1.57 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 660158 % of reads mapped to multiple loci | 7.13% Number of reads mapped to too many loci | 2135227 % of reads mapped to too many loci | 23.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.13% % of reads unmapped: other | 1.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3040871 3040871 3040871 N_multimapping 660158 660158 660158 N_noFeature 510667 565602 5379529 N_ambiguous 148757 28723 780 UnstrandedReadsAssigned:4898447 PositiveStrandReadsAssigned:4963546 NegativeStrandReadsAssigned:177562 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8635309 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635309-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,258,900 reads, 5,455,504 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52973 SRR8635309.ke.tsv 35125 SRR8635309.se.tsv 88098 total ==> SRR8635309.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 4.00219 0.563041 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 100.998 18.9415 PNS24243 293 194 0 0 KQK14069 1603 1504 97.0787 16.6086 KQK14071 474 375 0 0 ==> SRR8635309.se.tsv <== BRADI_1g14170v3 88 BRADI_1g53295v3 10 BRADI_1g59795v3 77 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 630 BRADI_1g74790v3 1 BRADI_1g09890v3 4 BRADI_1g77505v3 107 BRADI_1g48960v3 1 SRR8635309 completed mapping pipeline successfully