Starting /dee2/code/volunteer_pipeline.sh SRR8635310 current disk space = 1525900238848 free memory = 1574895632 SRR8635310 SRAfilesize 0bcdce75628cfabe872937b2f7a191c3 SRR8635310.sra SRR8635310.sra file validated SRR8635310 is single end SRR8635310 is conventional basespace SRR8635310 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635310_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0325 32.0 32.0 32.0 27.0 32.0 2 31.05 32.0 32.0 32.0 32.0 32.0 3 32.92875 32.0 32.0 37.0 32.0 37.0 4 33.96875 37.0 32.0 37.0 27.0 37.0 5 35.2325 37.0 37.0 37.0 32.0 37.0 6 37.7875 41.0 37.0 41.0 32.0 41.0 7 38.02525 41.0 37.0 41.0 32.0 41.0 8 38.437 41.0 37.0 41.0 32.0 41.0 9 38.7555 41.0 37.0 41.0 32.0 41.0 10-14 39.302200000000006 41.0 41.0 41.0 37.0 41.0 15-19 39.5488 41.0 41.0 41.0 37.0 41.0 20-24 39.4673 41.0 41.0 41.0 37.0 41.0 25-29 38.95784999999999 41.0 41.0 41.0 34.0 41.0 30-34 38.96535 41.0 40.2 41.0 35.0 41.0 35-39 39.10295 41.0 40.2 41.0 36.0 41.0 40-44 38.6589 41.0 38.6 41.0 34.0 41.0 45-49 38.885949999999994 41.0 40.2 41.0 34.0 41.0 50-54 38.94805 41.0 41.0 41.0 34.0 41.0 55-59 38.7162 41.0 39.4 41.0 34.0 41.0 60-64 38.2972 41.0 37.0 41.0 32.0 41.0 65-69 38.33305 41.0 37.0 41.0 32.0 41.0 70-74 37.0741 41.0 37.0 41.0 28.0 41.0 75-79 35.67775 39.4 34.0 41.0 23.0 41.0 80-84 35.7247 40.2 34.0 41.0 22.0 41.0 85-89 36.419399999999996 40.2 36.0 41.0 26.0 41.0 90-94 37.18795 41.0 37.0 41.0 27.0 41.0 95-99 36.584999999999994 41.0 37.0 41.0 26.0 41.0 100-104 35.99745 41.0 36.0 41.0 24.0 41.0 105-109 32.97664999999999 37.0 30.0 41.0 12.0 41.0 110-114 33.33819999999999 37.0 29.0 41.0 14.0 41.0 115-119 31.8077 37.0 27.0 41.0 12.0 41.0 120-124 31.60915 37.0 26.0 41.0 12.0 41.0 125-129 29.793799999999997 34.0 20.0 40.2 12.0 41.0 130-134 28.72165 32.0 22.0 37.8 12.0 41.0 135-139 27.29405 29.0 14.0 37.0 12.0 41.0 140-144 25.92745 26.0 14.0 35.0 11.2 40.2 145-149 25.084349999999997 26.0 12.0 36.0 12.0 39.4 150 24.496 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 4.0 21 6.0 22 20.0 23 28.0 24 36.0 25 50.0 26 47.0 27 72.0 28 101.0 29 118.0 30 133.0 31 164.0 32 172.0 33 275.0 34 278.0 35 355.0 36 439.0 37 545.0 38 626.0 39 454.0 40 76.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.375 15.55 27.275 13.8 2 43.8 17.224999999999998 24.8 14.174999999999999 3 41.875 17.474999999999998 26.174999999999997 14.475 4 42.675000000000004 17.125 25.174999999999997 15.024999999999999 5 41.275 17.474999999999998 24.925 16.325 6 44.175 13.925 25.0 16.900000000000002 7 45.025 14.625 25.575 14.774999999999999 8 40.45 14.924999999999999 27.075 17.549999999999997 9 34.8 16.150000000000002 29.725 19.325 10-14 31.97 19.965 29.95 18.115000000000002 15-19 27.150000000000002 22.93 27.794999999999998 22.125 20-24 27.345000000000002 22.3 27.43 22.925 25-29 26.665 22.495 28.084999999999997 22.755 30-34 26.765 22.53 29.03 21.675 35-39 27.084999999999997 21.83 29.475 21.61 40-44 26.400000000000002 23.425 28.845 21.33 45-49 26.035000000000004 23.59 29.03 21.345 50-54 25.490000000000002 24.41 29.26 20.84 55-59 24.645 27.04 28.76 19.555 60-64 26.02 24.525 28.4 21.055 65-69 26.314999999999998 25.665 28.18 19.84 70-74 24.945 26.765 28.62 19.67 75-79 23.84 28.634999999999998 27.744999999999997 19.78 80-84 23.175 29.95 26.765 20.11 85-89 22.59 31.1 27.105 19.205 90-94 23.905 30.685000000000002 25.775 19.634999999999998 95-99 23.52 33.43 24.610000000000003 18.44 100-104 21.805 33.665 25.47 19.06 105-109 20.75 35.095 24.27 19.885 110-114 21.58 36.405 23.810000000000002 18.205 115-119 21.17 36.22 24.035 18.575 120-124 22.215 36.515 22.919999999999998 18.35 125-129 22.11 35.775 23.085 19.03 130-134 21.529999999999998 36.735 22.195 19.54 135-139 20.599999999999998 36.71 23.02 19.67 140-144 21.2 36.004999999999995 22.56 20.235 145-149 20.805 35.72 22.325 21.15 150 20.925 34.35 23.65 21.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 2.5 25 1.0 26 2.0 27 9.0 28 15.0 29 21.0 30 26.5 31 30.5 32 38.0 33 58.5 34 86.0 35 87.0 36 95.0 37 111.5 38 126.0 39 156.5 40 182.5 41 190.0 42 186.0 43 188.5 44 193.0 45 180.0 46 165.5 47 150.0 48 119.0 49 103.0 50 95.5 51 85.5 52 81.5 53 89.0 54 93.5 55 96.0 56 95.5 57 87.0 58 77.0 59 61.5 60 55.5 61 62.0 62 67.0 63 57.0 64 34.5 65 19.0 66 18.5 67 19.5 68 38.0 69 61.0 70 54.5 71 38.0 72 21.5 73 10.0 74 11.5 75 15.0 76 15.0 77 8.5 78 1.5 79 1.5 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.88357122865939 82.075 2 6.437167646235656 11.5 3 1.0075566750629723 2.7 4 0.33585222502099077 1.2 5 0.11195074167366359 0.5 6 0.11195074167366359 0.6 7 0.027987685418415897 0.17500000000000002 8 0.0 0.0 9 0.027987685418415897 0.22499999999999998 >10 0.055975370836831795 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 28 0.7000000000000001 No Hit GTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCC 13 0.325 No Hit TCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAG 9 0.22499999999999998 No Hit GCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTG 7 0.17500000000000002 No Hit GATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCGGCGGA 6 0.15 No Hit TCGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGC 6 0.15 No Hit GGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAA 6 0.15 No Hit GGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGC 6 0.15 No Hit CACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCG 5 0.125 No Hit GAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGC 5 0.125 No Hit GGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTT 5 0.125 No Hit GAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.037500000000000006 0.0 0.0 0.0 0.0 24-25 0.07500000000000001 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.2625 0.0 0.0 0.0 0.0 54-55 0.30000000000000004 0.0 0.0 0.0 0.0 56-57 0.3375 0.0 0.0 0.0 0.0 58-59 0.375 0.0 0.0 0.0 0.0 60-61 0.4 0.0 0.0 0.0 0.0 62-63 0.4625 0.0 0.0 0.0 0.0 64-65 0.55 0.0 0.0 0.0 0.0 66-67 0.6375 0.0 0.0 0.0 0.0 68-69 0.725 0.0 0.0 0.0 0.0 70-71 0.7625 0.0 0.0 0.0 0.0 72-73 0.8374999999999999 0.0 0.0 0.0 0.0 74-75 0.925 0.0 0.0 0.0 0.0 76-77 0.975 0.0 0.0 0.0 0.0 78-79 1.025 0.0 0.0 0.0 0.0 80-81 1.15 0.0 0.0 0.0 0.0 82-83 1.275 0.0 0.0 0.0 0.0 84-85 1.6375 0.0 0.0 0.0 0.0 86-87 1.8875 0.0 0.0 0.0 0.0 88-89 2.0999999999999996 0.0 0.0 0.0 0.0 90-91 2.35 0.0 0.0 0.0 0.0 92-93 2.7125000000000004 0.0 0.0 0.0 0.0 94-95 3.05 0.0 0.0 0.0 0.0 96-97 3.5125 0.0 0.0 0.0 0.0 98-99 3.875 0.0 0.0 0.0 0.0 100-101 4.2125 0.0 0.0 0.0 0.0 102-103 4.6375 0.0 0.0 0.0 0.0 104-105 5.125 0.0 0.0 0.0 0.0 106-107 5.612500000000001 0.0 0.0 0.0 0.0 108-109 6.0375 0.0 0.0 0.0 0.0 110-111 6.675000000000001 0.0 0.0 0.0 0.0 112-113 7.3125 0.0 0.0 0.0 0.0 114-115 7.987500000000001 0.0 0.0 0.0 0.0 116-117 8.6125 0.0 0.0 0.0 0.0 118-119 9.3375 0.0 0.0 0.0 0.0 120-121 10.337499999999999 0.0 0.0 0.0 0.0 122-123 11.025 0.0 0.0 0.0 0.0 124-125 11.8 0.0 0.0 0.0 0.0 126-127 12.425 0.0 0.0 0.0 0.0 128-129 13.0 0.0 0.0 0.0 0.0 130-131 13.75 0.0 0.0 0.0 0.0 132-133 14.3875 0.0 0.0 0.0 0.0 134-135 14.8875 0.0 0.0 0.0 0.0 136-137 15.399999999999999 0.0 0.0 0.0 0.0 138 15.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGGGG 10 0.006973645 144.0 1 >>END_MODULE Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253563 READS because READLEN < 1 Read 253563 spots for SRR8635310.sra Written 253563 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra Rejected 253556 READS because READLEN < 1 Read 253556 spots for SRR8635310.sra Written 253556 spots for SRR8635310.sra SRR ids: ['SRR8635310.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7psyaga7 SRR8635310.sra spots: 5071127 blocks: [[1, 253556], [253557, 507112], [507113, 760668], [760669, 1014224], [1014225, 1267780], [1267781, 1521336], [1521337, 1774892], [1774893, 2028448], [2028449, 2282004], [2282005, 2535560], [2535561, 2789116], [2789117, 3042672], [3042673, 3296228], [3296229, 3549784], [3549785, 3803340], [3803341, 4056896], [4056897, 4310452], [4310453, 4564008], [4564009, 4817564], [4817565, 5071127]] SRR8635310 file size 1696460 SRR8635310 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635310 SRR8635310_1.fastq Input file: SRR8635310_1.fastq trimmed: SRR8635310-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:33:18 2024 >> started Mon Dec 9 12:33:23 2024 >> done (4.888s) 5071127 reads processed; of these: 139 ( 0.00%) short reads filtered out after trimming by size control 54 ( 0.00%) empty reads filtered out after trimming by size control 5070934 (100.00%) reads available; of these: 929966 (18.34%) trimmed reads available after processing 4140968 (81.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 43 0.00% 19 81 0.00% 20 140 0.00% 21 290 0.01% 22 396 0.01% 23 448 0.01% 24 482 0.01% 25 455 0.01% 26 392 0.01% 27 372 0.01% 28 469 0.01% 29 478 0.01% 30 479 0.01% 31 464 0.01% 32 397 0.01% 33 365 0.01% 34 388 0.01% 35 385 0.01% 36 347 0.01% 37 397 0.01% 38 364 0.01% 39 328 0.01% 40 362 0.01% 41 376 0.01% 42 364 0.01% 43 405 0.01% 44 470 0.01% 45 448 0.01% 46 491 0.01% 47 604 0.01% 48 630 0.01% 49 688 0.01% 50 820 0.02% 51 875 0.02% 52 891 0.02% 53 1172 0.02% 54 1639 0.03% 55 1506 0.03% 56 1444 0.03% 57 1500 0.03% 58 1604 0.03% 59 1630 0.03% 60 1657 0.03% 61 1697 0.03% 62 1733 0.03% 63 1796 0.04% 64 1726 0.03% 65 1936 0.04% 66 2127 0.04% 67 2244 0.04% 68 2118 0.04% 69 2185 0.04% 70 2464 0.05% 71 2760 0.05% 72 2819 0.06% 73 2851 0.06% 74 2961 0.06% 75 3278 0.06% 76 3337 0.07% 77 3696 0.07% 78 4116 0.08% 79 5072 0.10% 80 6134 0.12% 81 6686 0.13% 82 6976 0.14% 83 7800 0.15% 84 8997 0.18% 85 8967 0.18% 86 8122 0.16% 87 8152 0.16% 88 8389 0.17% 89 9075 0.18% 90 9754 0.19% 91 10686 0.21% 92 11171 0.22% 93 11440 0.23% 94 11894 0.23% 95 13622 0.27% 96 13647 0.27% 97 12640 0.25% 98 11944 0.24% 99 11962 0.24% 100 12712 0.25% 101 13628 0.27% 102 13688 0.27% 103 14429 0.28% 104 15261 0.30% 105 16940 0.33% 106 18164 0.36% 107 19589 0.39% 108 20579 0.41% 109 21421 0.42% 110 22914 0.45% 111 25510 0.50% 112 26380 0.52% 113 24472 0.48% 114 23910 0.47% 115 24486 0.48% 116 25635 0.51% 117 26055 0.51% 118 19580 0.39% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 1 0.00% 125 2 0.00% 126 0 0.00% 127 0 0.00% 128 1 0.00% 129 2 0.00% 130 2 0.00% 131 2 0.00% 132 4 0.00% 133 9 0.00% 134 18 0.00% 135 40 0.00% 136 41 0.00% 137 82 0.00% 138 120 0.00% 139 184 0.00% 140 325 0.01% 141 573 0.01% 142 994 0.02% 143 1834 0.04% 144 3446 0.07% 145 6427 0.13% 146 12516 0.25% 147 25519 0.50% 148 53089 1.05% 149 162872 3.21% 150 4140968 81.66% 5070934 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=41.83 fanout-score-rank=13 prefix-density=20.23 prefix-fanout=1.1 sequence=AGGCTAAATACTCCTGGGTGACCGATAGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=699.49 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=11.6 sequence=TTTTTTTCTTATCGATTCTTGCTGTAGTGCGCACGTACGATGCCATTGGTTGTCCGTCCCGTTTCTGATTTCATGATCCGCGGGCGGTGGTTGTCGTCGGTTTAGCGCGTGCACTGTGCTGTGCTGAACGTTGATGATCGCTGCTCCATTTTGGGTTCAATAGAGAGAGGATTTGTACATGTATATTTCCGGTGTATCATTTCAGTAGCCATTTTCAATAAAGTCTTGAGTCTCCATATCCATGC Started job on | Dec 09 12:33:53 Started mapping on | Dec 09 12:33:54 Finished on | Dec 09 12:35:32 Mapping speed, Million of reads per hour | 186.28 Number of input reads | 5070934 Average input read length | 143 UNIQUE READS: Uniquely mapped reads number | 3126264 Uniquely mapped reads % | 61.65% Average mapped length | 134.44 Number of splices: Total | 249703 Number of splices: Annotated (sjdb) | 188425 Number of splices: GT/AG | 212024 Number of splices: GC/AG | 4304 Number of splices: AT/AC | 239 Number of splices: Non-canonical | 33136 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.01% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361316 % of reads mapped to multiple loci | 7.13% Number of reads mapped to too many loci | 1179553 % of reads mapped to too many loci | 23.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.40% % of reads unmapped: other | 1.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1583354 1583354 1583354 N_multimapping 361316 361316 361316 N_noFeature 281494 312375 3025275 N_ambiguous 83134 14671 444 UnstrandedReadsAssigned:2761636 PositiveStrandReadsAssigned:2799218 NegativeStrandReadsAssigned:100545 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8635310 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635310-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,070,934 reads, 3,028,319 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52973 SRR8635310.ke.tsv 35125 SRR8635310.se.tsv 88098 total ==> SRR8635310.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 74 24.8351 PNS24243 293 194 0 0 KQK14069 1603 1504 63 19.2877 KQK14071 474 375 0 0 ==> SRR8635310.se.tsv <== BRADI_1g14170v3 53 BRADI_1g53295v3 2 BRADI_1g59795v3 53 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 365 BRADI_1g74790v3 1 BRADI_1g09890v3 3 BRADI_1g77505v3 65 BRADI_1g48960v3 1 SRR8635310 completed mapping pipeline successfully