Starting /dee2/code/volunteer_pipeline.sh SRR8635311 current disk space = 1525887746048 free memory = 1576501668 SRR8635311 SRAfilesize 8cabd116fa5d283a3a8c16657423b1f1 SRR8635311.sra SRR8635311.sra file validated SRR8635311 is single end SRR8635311 is conventional basespace SRR8635311 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635311_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.29625 32.0 32.0 32.0 27.0 32.0 2 31.26125 32.0 32.0 32.0 32.0 32.0 3 34.0125 37.0 32.0 37.0 32.0 37.0 4 34.74875 37.0 37.0 37.0 27.0 37.0 5 35.19475 37.0 37.0 37.0 32.0 37.0 6 37.8275 41.0 37.0 41.0 32.0 41.0 7 38.678 41.0 37.0 41.0 32.0 41.0 8 39.02075 41.0 37.0 41.0 37.0 41.0 9 39.24925 41.0 41.0 41.0 37.0 41.0 10-14 39.587849999999996 41.0 41.0 41.0 37.0 41.0 15-19 39.67995 41.0 41.0 41.0 37.0 41.0 20-24 39.4711 41.0 41.0 41.0 37.0 41.0 25-29 38.908249999999995 41.0 40.2 41.0 34.0 41.0 30-34 38.9394 41.0 40.2 41.0 35.0 41.0 35-39 39.01805 41.0 40.2 41.0 35.0 41.0 40-44 38.3592 41.0 37.8 41.0 32.0 41.0 45-49 38.64545 41.0 39.4 41.0 33.0 41.0 50-54 38.7522 41.0 40.2 41.0 32.0 41.0 55-59 38.4063 41.0 38.6 41.0 32.0 41.0 60-64 38.114549999999994 41.0 37.0 41.0 32.0 41.0 65-69 38.1589 41.0 37.0 41.0 31.0 41.0 70-74 37.0591 41.0 37.0 41.0 27.0 41.0 75-79 35.66035 39.4 34.0 41.0 21.0 41.0 80-84 35.881299999999996 40.2 34.0 41.0 24.0 41.0 85-89 36.57385000000001 41.0 36.0 41.0 26.0 41.0 90-94 37.0642 41.0 37.0 41.0 27.0 41.0 95-99 36.38475 41.0 37.0 41.0 26.0 41.0 100-104 35.7829 40.2 36.0 41.0 22.0 41.0 105-109 32.9165 37.0 30.0 41.0 12.0 41.0 110-114 32.97285 37.0 29.0 41.0 12.0 41.0 115-119 31.3924 37.0 26.0 41.0 12.0 41.0 120-124 31.322299999999995 36.0 26.0 41.0 12.0 41.0 125-129 29.3755 31.0 20.0 40.2 12.0 41.0 130-134 28.095350000000003 31.0 18.0 37.0 12.0 41.0 135-139 26.86915 28.0 14.0 37.0 12.0 41.0 140-144 25.4555 25.0 12.0 35.0 11.2 40.2 145-149 24.717399999999998 26.0 12.0 36.0 11.2 40.2 150 24.222 27.0 12.0 37.0 8.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 4.0 20 7.0 21 6.0 22 13.0 23 21.0 24 39.0 25 43.0 26 77.0 27 95.0 28 86.0 29 106.0 30 159.0 31 170.0 32 210.0 33 238.0 34 284.0 35 351.0 36 454.0 37 483.0 38 599.0 39 489.0 40 65.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.275 15.950000000000001 25.3 14.475 2 45.775 17.325 22.825 14.075 3 43.925 17.5 23.849999999999998 14.725 4 42.199999999999996 17.9 24.275 15.625 5 41.3 16.375 24.575 17.75 6 44.025 14.549999999999999 24.65 16.775000000000002 7 43.675000000000004 14.399999999999999 26.200000000000003 15.725 8 40.300000000000004 14.549999999999999 27.200000000000003 17.95 9 36.175000000000004 16.2 28.125 19.5 10-14 31.514999999999997 20.43 29.145 18.91 15-19 27.755000000000003 22.37 26.76 23.115 20-24 27.325 23.044999999999998 25.115 24.515 25-29 27.55 22.93 26.224999999999998 23.294999999999998 30-34 28.07 22.485 27.49 21.955 35-39 27.865000000000002 22.56 27.805000000000003 21.77 40-44 26.57 23.535 27.284999999999997 22.61 45-49 25.865 23.76 28.134999999999998 22.24 50-54 25.6 25.665 27.16 21.575 55-59 25.115 27.305 26.955000000000002 20.625 60-64 26.16 25.305 26.810000000000002 21.725 65-69 26.445 26.31 27.345000000000002 19.900000000000002 70-74 25.740000000000002 27.1 27.605 19.555 75-79 23.935000000000002 29.765000000000004 26.415 19.885 80-84 23.419999999999998 30.904999999999998 25.174999999999997 20.5 85-89 22.24 31.945 25.674999999999997 20.14 90-94 24.115000000000002 31.455 24.935 19.495 95-99 23.26 34.294999999999995 23.93 18.515 100-104 22.435 34.315 23.78 19.470000000000002 105-109 21.46 36.085 22.650000000000002 19.805 110-114 20.715 37.505 22.645 19.134999999999998 115-119 21.04 37.14 22.435 19.384999999999998 120-124 21.34 37.114999999999995 21.575 19.97 125-129 22.215 36.13 21.115000000000002 20.54 130-134 21.790000000000003 36.795 21.285 20.13 135-139 20.325 37.015 21.66 21.0 140-144 20.16 35.93 21.975 21.935 145-149 19.675 36.135 20.925 23.265 150 19.125 36.025 21.349999999999998 23.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.5 19 1.5 20 1.5 21 2.5 22 2.0 23 2.0 24 3.5 25 3.0 26 5.5 27 10.5 28 7.5 29 14.5 30 29.5 31 32.0 32 38.0 33 53.5 34 78.0 35 101.0 36 105.5 37 101.5 38 114.0 39 131.5 40 142.5 41 164.5 42 174.5 43 175.5 44 184.5 45 171.5 46 153.0 47 135.5 48 122.0 49 102.5 50 86.0 51 92.0 52 97.0 53 91.5 54 87.5 55 98.5 56 102.5 57 97.5 58 83.5 59 65.5 60 51.0 61 57.0 62 75.0 63 74.0 64 50.0 65 29.5 66 20.5 67 22.0 68 52.5 69 84.5 70 71.5 71 48.0 72 29.0 73 11.0 74 12.0 75 17.5 76 17.0 77 7.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.025 #Duplication Level Percentage of deduplicated Percentage of total 1 93.03566413928672 82.825 2 5.223251895534962 9.3 3 0.8705419825891604 2.325 4 0.33698399326032014 1.2 5 0.14040999719180006 0.625 6 0.14040999719180006 0.75 7 0.05616399887672002 0.35000000000000003 8 0.02808199943836001 0.2 9 0.02808199943836001 0.22499999999999998 >10 0.14040999719180006 2.1999999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 39 0.975 No Hit GTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCC 16 0.4 No Hit GGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGC 12 0.3 No Hit CGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGG 11 0.27499999999999997 No Hit GAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCC 10 0.25 No Hit GGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTT 9 0.22499999999999998 No Hit GTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAA 8 0.2 No Hit GGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCC 7 0.17500000000000002 No Hit TCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAG 7 0.17500000000000002 No Hit GGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAA 6 0.15 No Hit GAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCG 6 0.15 No Hit GGGGGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 6 0.15 No Hit TTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAA 6 0.15 No Hit CGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGCG 6 0.15 No Hit GAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGC 5 0.125 No Hit CCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGC 5 0.125 No Hit GCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTG 5 0.125 No Hit GCATATGTACTTTTTGCTTGGCTTTTCCTCTGTTTTTCTTTCGTTTTCTC 5 0.125 No Hit CGCCTGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.07500000000000001 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.16249999999999998 0.0 0.0 0.0 0.0 46-47 0.1875 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.3125 0.0 0.0 0.0 0.0 56-57 0.4375 0.0 0.0 0.0 0.0 58-59 0.5 0.0 0.0 0.0 0.0 60-61 0.5625 0.0 0.0 0.0 0.0 62-63 0.6625000000000001 0.0 0.0 0.0 0.0 64-65 0.7 0.0 0.0 0.0 0.0 66-67 0.7749999999999999 0.0 0.0 0.0 0.0 68-69 0.9125000000000001 0.0 0.0 0.0 0.0 70-71 1.0 0.0 0.0 0.0 0.0 72-73 1.125 0.0 0.0 0.0 0.0 74-75 1.2000000000000002 0.0 0.0 0.0 0.0 76-77 1.35 0.0 0.0 0.0 0.0 78-79 1.475 0.0 0.0 0.0 0.0 80-81 1.7125 0.0 0.0 0.0 0.0 82-83 2.05 0.0 0.0 0.0 0.0 84-85 2.2125 0.0 0.0 0.0 0.0 86-87 2.4875 0.0 0.0 0.0 0.0 88-89 2.7249999999999996 0.0 0.0 0.0 0.0 90-91 2.95 0.0 0.0 0.0 0.0 92-93 3.3125 0.0 0.0 0.0 0.0 94-95 4.0 0.0 0.0 0.025 0.0 96-97 4.5 0.0 0.0 0.025 0.0 98-99 4.9875 0.0 0.0 0.025 0.0 100-101 5.275 0.0 0.0 0.025 0.0 102-103 5.6625 0.0 0.0 0.025 0.0 104-105 6.05 0.0 0.0 0.025 0.0 106-107 6.449999999999999 0.0 0.0 0.025 0.0 108-109 7.1625 0.0 0.0 0.025 0.0 110-111 8.0 0.0 0.0 0.025 0.0 112-113 8.8875 0.0 0.0 0.025 0.0 114-115 9.8875 0.0 0.0 0.025 0.0 116-117 10.7 0.0 0.0 0.025 0.0 118-119 11.5125 0.0 0.0 0.025 0.0 120-121 12.2625 0.0 0.0 0.025 0.0 122-123 13.2625 0.0 0.0 0.025 0.0 124-125 14.3375 0.0 0.0 0.025 0.0 126-127 15.275 0.0 0.0 0.025 0.0 128-129 15.825 0.0 0.0 0.025 0.0 130-131 16.3125 0.0 0.0 0.025 0.0 132-133 16.95 0.0 0.0 0.025 0.0 134-135 17.4 0.0 0.0 0.025 0.0 136-137 17.987499999999997 0.0 0.0 0.025 0.0 138 18.525 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGTGG 10 0.006973645 144.0 3 >>END_MODULE Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252429 READS because READLEN < 1 Read 252429 spots for SRR8635311.sra Written 252429 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra Rejected 252415 READS because READLEN < 1 Read 252415 spots for SRR8635311.sra Written 252415 spots for SRR8635311.sra SRR ids: ['SRR8635311.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__fjm3f1o SRR8635311.sra spots: 5048314 blocks: [[1, 252415], [252416, 504830], [504831, 757245], [757246, 1009660], [1009661, 1262075], [1262076, 1514490], [1514491, 1766905], [1766906, 2019320], [2019321, 2271735], [2271736, 2524150], [2524151, 2776565], [2776566, 3028980], [3028981, 3281395], [3281396, 3533810], [3533811, 3786225], [3786226, 4038640], [4038641, 4291055], [4291056, 4543470], [4543471, 4795885], [4795886, 5048314]] SRR8635311 file size 1688818 SRR8635311 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635311 SRR8635311_1.fastq Input file: SRR8635311_1.fastq trimmed: SRR8635311-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:33:36 2024 >> started Mon Dec 9 12:33:40 2024 >> done (4.197s) 5048314 reads processed; of these: 159 ( 0.00%) short reads filtered out after trimming by size control 58 ( 0.00%) empty reads filtered out after trimming by size control 5048097 (100.00%) reads available; of these: 1045038 (20.70%) trimmed reads available after processing 4003059 (79.30%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 62 0.00% 19 101 0.00% 20 196 0.00% 21 340 0.01% 22 477 0.01% 23 600 0.01% 24 574 0.01% 25 525 0.01% 26 479 0.01% 27 470 0.01% 28 528 0.01% 29 521 0.01% 30 546 0.01% 31 467 0.01% 32 436 0.01% 33 395 0.01% 34 456 0.01% 35 432 0.01% 36 453 0.01% 37 430 0.01% 38 443 0.01% 39 455 0.01% 40 419 0.01% 41 430 0.01% 42 432 0.01% 43 438 0.01% 44 508 0.01% 45 587 0.01% 46 635 0.01% 47 713 0.01% 48 822 0.02% 49 801 0.02% 50 1014 0.02% 51 1079 0.02% 52 1235 0.02% 53 1571 0.03% 54 2248 0.04% 55 2146 0.04% 56 1849 0.04% 57 2124 0.04% 58 2244 0.04% 59 2213 0.04% 60 2101 0.04% 61 2283 0.05% 62 2213 0.04% 63 2146 0.04% 64 2091 0.04% 65 2280 0.05% 66 2470 0.05% 67 2591 0.05% 68 2457 0.05% 69 2638 0.05% 70 2898 0.06% 71 3386 0.07% 72 3309 0.07% 73 3324 0.07% 74 3496 0.07% 75 3483 0.07% 76 3702 0.07% 77 4222 0.08% 78 4745 0.09% 79 5668 0.11% 80 7262 0.14% 81 7826 0.16% 82 7888 0.16% 83 9065 0.18% 84 10705 0.21% 85 10521 0.21% 86 9385 0.19% 87 9382 0.19% 88 9642 0.19% 89 10490 0.21% 90 11348 0.22% 91 12482 0.25% 92 12875 0.26% 93 12965 0.26% 94 13683 0.27% 95 15240 0.30% 96 15427 0.31% 97 14398 0.29% 98 13571 0.27% 99 13293 0.26% 100 14164 0.28% 101 15031 0.30% 102 15348 0.30% 103 15957 0.32% 104 16858 0.33% 105 18867 0.37% 106 20454 0.41% 107 22064 0.44% 108 23828 0.47% 109 24994 0.50% 110 26022 0.52% 111 29331 0.58% 112 30068 0.60% 113 27964 0.55% 114 26796 0.53% 115 27170 0.54% 116 28585 0.57% 117 28694 0.57% 118 21536 0.43% 119 0 0.00% 120 1 0.00% 121 0 0.00% 122 0 0.00% 123 1 0.00% 124 0 0.00% 125 0 0.00% 126 1 0.00% 127 0 0.00% 128 2 0.00% 129 3 0.00% 130 1 0.00% 131 3 0.00% 132 7 0.00% 133 13 0.00% 134 23 0.00% 135 37 0.00% 136 52 0.00% 137 113 0.00% 138 161 0.00% 139 254 0.01% 140 421 0.01% 141 725 0.01% 142 1155 0.02% 143 2215 0.04% 144 4013 0.08% 145 7672 0.15% 146 14280 0.28% 147 28437 0.56% 148 57277 1.13% 149 172595 3.42% 150 4003059 79.30% 5048097 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=51.57 fanout-score-rank=8 prefix-density=24.21 prefix-fanout=1.1 sequence=AGGCTAAATACTCCTGGGTGACCGATAGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=757.13 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=12.0 sequence=TTTTTTTCTTATCGATTCTTGCTGTAGTGCGCACGTACGATGCCATTGGTTGTCCGTCCCGTTTCTGATTTCATGATCCGCGGGCGGTGGTTGTCGTCGGTTTAGCGCGTGCACTGTGCTGTGCTGAACGTTGATGATCGCTGCTCCATTTTGGGTTCAATAGAGAGAGGATTTGTACATGTATATTTCCGGTGTATCATTTCAGTAGCCATTTTCAATAAAGTCTTGAGTCTCCATATCCA Started job on | Dec 09 12:35:05 Started mapping on | Dec 09 12:35:05 Finished on | Dec 09 12:35:43 Mapping speed, Million of reads per hour | 478.24 Number of input reads | 5048097 Average input read length | 142 UNIQUE READS: Uniquely mapped reads number | 2869126 Uniquely mapped reads % | 56.84% Average mapped length | 133.39 Number of splices: Total | 236819 Number of splices: Annotated (sjdb) | 177003 Number of splices: GT/AG | 199948 Number of splices: GC/AG | 4204 Number of splices: AT/AC | 223 Number of splices: Non-canonical | 32444 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.00% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339486 % of reads mapped to multiple loci | 6.73% Number of reads mapped to too many loci | 1390484 % of reads mapped to too many loci | 27.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.02% % of reads unmapped: other | 1.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1839485 1839485 1839485 N_multimapping 339486 339486 339486 N_noFeature 250701 278063 2775082 N_ambiguous 78445 13325 375 UnstrandedReadsAssigned:2539980 PositiveStrandReadsAssigned:2577738 NegativeStrandReadsAssigned:93669 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8635311 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635311-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,048,097 reads, 2,796,203 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52973 SRR8635311.ke.tsv 35125 SRR8635311.se.tsv 88098 total ==> SRR8635311.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 71 25.9885 PNS24243 293 194 0 0 KQK14069 1603 1504 112.315 37.5031 KQK14071 474 375 0 0 ==> SRR8635311.se.tsv <== BRADI_1g14170v3 122 BRADI_1g53295v3 4 BRADI_1g59795v3 34 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 245 BRADI_1g74790v3 1 BRADI_1g09890v3 0 BRADI_1g77505v3 78 BRADI_1g48960v3 0 SRR8635311 completed mapping pipeline successfully