Starting /dee2/code/volunteer_pipeline.sh SRR8635312 current disk space = 1525880025088 free memory = 1573232324 SRR8635312 SRAfilesize e249d3fe2ea26f757e21f7467d019230 SRR8635312.sra SRR8635312.sra file validated SRR8635312 is single end SRR8635312 is conventional basespace SRR8635312 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635312_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.88875 32.0 32.0 32.0 27.0 32.0 2 31.12875 32.0 32.0 32.0 32.0 32.0 3 32.86 32.0 32.0 37.0 32.0 37.0 4 33.43875 37.0 32.0 37.0 27.0 37.0 5 34.645 37.0 37.0 37.0 27.0 37.0 6 37.463 41.0 37.0 41.0 32.0 41.0 7 37.8825 41.0 37.0 41.0 32.0 41.0 8 38.2405 41.0 37.0 41.0 32.0 41.0 9 38.62275 41.0 37.0 41.0 32.0 41.0 10-14 39.048500000000004 41.0 39.4 41.0 35.0 41.0 15-19 39.38445 41.0 41.0 41.0 37.0 41.0 20-24 39.4067 41.0 41.0 41.0 37.0 41.0 25-29 38.92745000000001 41.0 40.2 41.0 34.0 41.0 30-34 38.8235 41.0 39.4 41.0 35.0 41.0 35-39 39.122550000000004 41.0 40.2 41.0 36.0 41.0 40-44 38.708000000000006 41.0 39.4 41.0 33.0 41.0 45-49 38.91330000000001 41.0 41.0 41.0 35.0 41.0 50-54 38.98895 41.0 41.0 41.0 34.0 41.0 55-59 38.71445 41.0 39.4 41.0 34.0 41.0 60-64 38.3708 41.0 38.6 41.0 32.0 41.0 65-69 38.323949999999996 41.0 37.0 41.0 32.0 41.0 70-74 37.13755 41.0 37.0 41.0 29.0 41.0 75-79 35.6552 39.4 34.0 41.0 23.0 41.0 80-84 35.823150000000005 40.2 34.0 41.0 24.0 41.0 85-89 36.62495 41.0 36.0 41.0 26.0 41.0 90-94 37.16275 41.0 37.0 41.0 26.0 41.0 95-99 36.61855 41.0 37.0 41.0 26.0 41.0 100-104 35.9014 41.0 36.0 41.0 23.0 41.0 105-109 33.15595 37.0 30.0 41.0 12.0 41.0 110-114 33.37305 37.0 30.0 41.0 12.0 41.0 115-119 31.64965 37.0 27.0 41.0 12.0 41.0 120-124 31.62885 37.0 26.0 41.0 12.0 41.0 125-129 29.65145 34.0 20.0 40.2 12.0 41.0 130-134 28.2828 31.0 20.0 37.0 12.0 41.0 135-139 27.03005 28.0 14.0 37.0 12.0 41.0 140-144 25.7031 26.0 12.0 35.0 11.2 40.2 145-149 24.752950000000002 26.0 12.0 36.0 12.0 39.4 150 24.2915 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 3.0 20 4.0 21 10.0 22 13.0 23 22.0 24 38.0 25 31.0 26 67.0 27 63.0 28 100.0 29 122.0 30 157.0 31 172.0 32 202.0 33 232.0 34 316.0 35 347.0 36 478.0 37 496.0 38 606.0 39 450.0 40 70.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.25 16.025 26.950000000000003 13.775 2 46.2 17.175 23.45 13.175 3 43.05 16.0 24.825 16.125 4 44.525 16.525000000000002 24.375 14.575 5 40.425 16.650000000000002 25.924999999999997 17.0 6 44.725 14.174999999999999 24.55 16.55 7 44.95 14.224999999999998 24.4 16.425 8 40.0 15.1 27.325 17.575 9 36.199999999999996 16.75 28.725 18.325 10-14 31.735000000000003 20.19 29.565 18.509999999999998 15-19 27.765 22.225 27.295 22.715 20-24 27.625 22.55 26.07 23.755000000000003 25-29 26.875 23.465 26.525 23.135 30-34 27.595 22.36 27.54 22.505 35-39 28.005000000000003 22.939999999999998 27.73 21.325 40-44 26.6 24.19 26.97 22.24 45-49 26.3 24.25 27.939999999999998 21.51 50-54 26.05 25.430000000000003 26.950000000000003 21.57 55-59 24.19 28.435 26.700000000000003 20.674999999999997 60-64 25.715 25.935000000000002 26.38 21.97 65-69 26.395000000000003 26.009999999999998 27.565 20.03 70-74 26.479999999999997 26.979999999999997 27.084999999999997 19.455 75-79 24.21 30.345 26.119999999999997 19.325 80-84 22.564999999999998 31.59 25.34 20.505000000000003 85-89 22.585 32.96 25.025 19.43 90-94 24.555 32.16 24.065 19.220000000000002 95-99 23.29 34.595 23.955000000000002 18.16 100-104 21.59 35.695 23.87 18.845 105-109 21.375 36.76 22.585 19.28 110-114 20.96 38.14 23.095 17.805 115-119 20.04 38.62 22.6 18.740000000000002 120-124 22.225 37.585 21.645 18.545 125-129 21.634999999999998 37.45 21.555 19.36 130-134 21.265 37.925 21.154999999999998 19.655 135-139 20.225 38.205 21.89 19.68 140-144 20.34 37.585 21.13 20.945 145-149 20.01 36.714999999999996 21.425 21.85 150 20.75 35.675000000000004 21.75 21.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.0 22 3.0 23 3.0 24 2.0 25 1.5 26 5.0 27 12.5 28 16.0 29 18.5 30 22.0 31 26.0 32 33.5 33 55.5 34 74.0 35 77.5 36 99.0 37 113.0 38 116.0 39 136.0 40 157.0 41 169.0 42 177.5 43 174.0 44 161.0 45 156.0 46 146.5 47 154.5 48 141.5 49 99.0 50 90.0 51 93.5 52 106.5 53 112.0 54 116.0 55 119.5 56 113.0 57 97.0 58 73.5 59 58.5 60 56.5 61 72.5 62 77.0 63 73.0 64 46.5 65 21.0 66 18.5 67 18.0 68 41.5 69 78.0 70 66.5 71 29.5 72 16.0 73 7.5 74 8.5 75 12.5 76 8.5 77 7.5 78 4.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.15 #Duplication Level Percentage of deduplicated Percentage of total 1 91.10728628800918 79.4 2 7.056798623063683 12.3 3 0.9179575444635685 2.4 4 0.3729202524383247 1.3 5 0.17211703958691912 0.75 6 0.05737234652897303 0.3 7 0.028686173264486515 0.17500000000000002 8 0.08605851979345956 0.6 9 0.028686173264486515 0.22499999999999998 >10 0.17211703958691912 2.55 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 37 0.9249999999999999 No Hit GTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCC 18 0.44999999999999996 No Hit GGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGC 14 0.35000000000000003 No Hit GGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTT 13 0.325 No Hit GAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCC 10 0.25 No Hit CGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTT 10 0.25 No Hit CGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGG 9 0.22499999999999998 No Hit GTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAA 8 0.2 No Hit TGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCG 8 0.2 No Hit GGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTC 8 0.2 No Hit CGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGCG 7 0.17500000000000002 No Hit CGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTC 6 0.15 No Hit TTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAATA 6 0.15 No Hit GATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCGGCGGA 5 0.125 No Hit TCGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGC 5 0.125 No Hit GGGCGGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGT 5 0.125 No Hit GGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCG 5 0.125 No Hit AGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGT 5 0.125 No Hit GGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0375 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.1375 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.21250000000000002 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.2375 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.2625 0.0 0.0 0.0 0.0 50-51 0.3 0.0 0.0 0.0 0.0 52-53 0.3 0.0 0.0 0.0 0.0 54-55 0.35 0.0 0.0 0.0 0.0 56-57 0.4125 0.0 0.0 0.0 0.0 58-59 0.45 0.0 0.0 0.0 0.0 60-61 0.4625 0.0 0.0 0.0 0.0 62-63 0.55 0.0 0.0 0.0 0.0 64-65 0.5874999999999999 0.0 0.0 0.0 0.0 66-67 0.6375 0.0 0.0 0.0 0.0 68-69 0.7125 0.0 0.0 0.0 0.0 70-71 0.8125 0.0 0.0 0.0 0.0 72-73 0.875 0.0 0.0 0.0 0.0 74-75 0.9375 0.0 0.0 0.0 0.0 76-77 1.0375 0.0 0.0 0.0 0.0 78-79 1.1375000000000002 0.0 0.0 0.0 0.0 80-81 1.3 0.0 0.0 0.0 0.0 82-83 1.4375 0.0 0.0 0.0 0.0 84-85 1.7625000000000002 0.0 0.0 0.0 0.0 86-87 2.075 0.0 0.0 0.0 0.0 88-89 2.2249999999999996 0.0 0.0 0.0 0.0 90-91 2.55 0.0 0.0 0.0 0.0 92-93 3.0 0.0 0.0 0.0 0.0 94-95 3.4375 0.0 0.0 0.0 0.0 96-97 3.9000000000000004 0.0 0.0 0.0 0.0 98-99 4.325 0.0 0.0 0.0 0.0 100-101 4.7 0.0 0.0 0.0 0.0 102-103 5.2 0.0 0.0 0.0 0.0 104-105 5.6625 0.0 0.0 0.0 0.0 106-107 6.237500000000001 0.0 0.0 0.0 0.0 108-109 6.8375 0.0 0.0 0.0 0.0 110-111 7.75 0.0 0.0 0.0 0.0 112-113 8.625 0.0 0.0 0.0 0.0 114-115 9.475 0.0 0.0 0.0 0.0 116-117 10.3875 0.0 0.0 0.0 0.0 118-119 11.287500000000001 0.0 0.0 0.0 0.0 120-121 11.8625 0.0 0.0 0.0 0.0 122-123 12.725000000000001 0.0 0.0 0.0 0.0 124-125 13.475000000000001 0.0 0.0 0.0 0.0 126-127 14.1625 0.0 0.0 0.0 0.0 128-129 15.0 0.0 0.0 0.0 0.0 130-131 15.850000000000001 0.0 0.0 0.0 0.0 132-133 16.575000000000003 0.0 0.0 0.0 0.0 134-135 17.0625 0.0 0.0 0.0 0.0 136-137 17.475 0.0 0.0 0.0 0.0 138 17.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATACGC 10 0.006973645 144.0 3 AGGGTTG 10 0.006973645 144.0 5 CTGATAC 10 0.006973645 144.0 1 TGATACG 10 0.006973645 144.0 2 ATACGCG 10 0.006973645 144.0 4 GAGGGTT 10 0.006973645 144.0 4 ACGCGCA 10 0.006973645 144.0 6 CGCGCAC 10 0.006973645 144.0 7 ACACAGA 40 3.1003024E-4 21.599998 140-144 CAGTCAC 45 6.8636134E-4 19.2 135-139 CACACAG 45 6.8636134E-4 19.2 140-144 CCAGTCA 50 0.0013929702 17.279999 135-139 CACACGT 55 0.0026350126 15.709091 120-124 GAACTCC 60 0.0047032754 14.4 130-134 GATCGGA 75 0.0013041105 13.439999 110-114 ATCGGAA 75 0.0013041105 13.439999 110-114 GCACACG 80 0.0021206664 12.599999 120-124 AAGAGCA 85 0.003342231 11.858823 115-119 GAAGAGC 90 0.0051234453 11.2 115-119 >>END_MODULE Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250017 READS because READLEN < 1 Read 250017 spots for SRR8635312.sra Written 250017 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra Rejected 250000 READS because READLEN < 1 Read 250000 spots for SRR8635312.sra Written 250000 spots for SRR8635312.sra SRR ids: ['SRR8635312.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l9vvpc0p SRR8635312.sra spots: 5000017 blocks: [[1, 250000], [250001, 500000], [500001, 750000], [750001, 1000000], [1000001, 1250000], [1250001, 1500000], [1500001, 1750000], [1750001, 2000000], [2000001, 2250000], [2250001, 2500000], [2500001, 2750000], [2750001, 3000000], [3000001, 3250000], [3250001, 3500000], [3500001, 3750000], [3750001, 4000000], [4000001, 4250000], [4250001, 4500000], [4500001, 4750000], [4750001, 5000017]] SRR8635312 file size 1672641 SRR8635312 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635312 SRR8635312_1.fastq Input file: SRR8635312_1.fastq trimmed: SRR8635312-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:35:51 2024 >> started Mon Dec 9 12:35:54 2024 >> done (3.425s) 5000017 reads processed; of these: 147 ( 0.00%) short reads filtered out after trimming by size control 80 ( 0.00%) empty reads filtered out after trimming by size control 4999790 (100.00%) reads available; of these: 1055119 (21.10%) trimmed reads available after processing 3944671 (78.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 53 0.00% 19 121 0.00% 20 187 0.00% 21 318 0.01% 22 457 0.01% 23 543 0.01% 24 607 0.01% 25 554 0.01% 26 551 0.01% 27 537 0.01% 28 588 0.01% 29 597 0.01% 30 638 0.01% 31 466 0.01% 32 476 0.01% 33 442 0.01% 34 442 0.01% 35 450 0.01% 36 469 0.01% 37 452 0.01% 38 451 0.01% 39 488 0.01% 40 434 0.01% 41 436 0.01% 42 468 0.01% 43 464 0.01% 44 504 0.01% 45 531 0.01% 46 590 0.01% 47 714 0.01% 48 808 0.02% 49 826 0.02% 50 974 0.02% 51 1035 0.02% 52 1129 0.02% 53 1536 0.03% 54 2022 0.04% 55 1956 0.04% 56 1753 0.04% 57 1975 0.04% 58 2243 0.04% 59 2144 0.04% 60 2144 0.04% 61 2273 0.05% 62 2335 0.05% 63 2192 0.04% 64 2182 0.04% 65 2314 0.05% 66 2483 0.05% 67 2661 0.05% 68 2565 0.05% 69 2763 0.06% 70 3187 0.06% 71 3500 0.07% 72 3599 0.07% 73 3676 0.07% 74 3768 0.08% 75 3932 0.08% 76 4060 0.08% 77 4385 0.09% 78 5214 0.10% 79 6679 0.13% 80 8182 0.16% 81 8750 0.18% 82 8807 0.18% 83 10051 0.20% 84 11751 0.24% 85 11405 0.23% 86 10378 0.21% 87 10481 0.21% 88 10917 0.22% 89 11402 0.23% 90 12772 0.26% 91 14229 0.28% 92 14779 0.30% 93 14713 0.29% 94 15385 0.31% 95 17694 0.35% 96 17137 0.34% 97 15371 0.31% 98 14250 0.29% 99 13821 0.28% 100 14589 0.29% 101 15124 0.30% 102 15605 0.31% 103 16034 0.32% 104 16950 0.34% 105 19092 0.38% 106 20780 0.42% 107 22980 0.46% 108 24091 0.48% 109 25476 0.51% 110 26820 0.54% 111 29699 0.59% 112 30446 0.61% 113 28076 0.56% 114 27055 0.54% 115 27192 0.54% 116 29197 0.58% 117 29391 0.59% 118 21529 0.43% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 2 0.00% 132 3 0.00% 133 4 0.00% 134 7 0.00% 135 16 0.00% 136 20 0.00% 137 50 0.00% 138 85 0.00% 139 143 0.00% 140 237 0.00% 141 447 0.01% 142 761 0.02% 143 1457 0.03% 144 3136 0.06% 145 5975 0.12% 146 12146 0.24% 147 25498 0.51% 148 53054 1.06% 149 161336 3.23% 150 3944671 78.90% 4999790 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=47.08 fanout-score-rank=7 prefix-density=23.15 prefix-fanout=1.1 sequence=AGGCTAAATACTCCTGGGTGACCGATAGCG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=643.37 fanout-score-rank=1 prefix-density=13.71 prefix-fanout=1.0 sequence=AACGAGTCGGGGTGTTTGGGAAT Started job on | Dec 09 12:36:44 Started mapping on | Dec 09 12:36:52 Finished on | Dec 09 12:37:29 Mapping speed, Million of reads per hour | 486.47 Number of input reads | 4999790 Average input read length | 137 UNIQUE READS: Uniquely mapped reads number | 2887736 Uniquely mapped reads % | 57.76% Average mapped length | 131.49 Number of splices: Total | 253710 Number of splices: Annotated (sjdb) | 197797 Number of splices: GT/AG | 218733 Number of splices: GC/AG | 4111 Number of splices: AT/AC | 651 Number of splices: Non-canonical | 30215 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.00% Deletion average length | 1.57 Insertion rate per base | 0.01% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334308 % of reads mapped to multiple loci | 6.69% Number of reads mapped to too many loci | 1317269 % of reads mapped to too many loci | 26.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.88% % of reads unmapped: other | 1.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1777746 1777746 1777746 N_multimapping 334308 334308 334308 N_noFeature 268072 295313 2795342 N_ambiguous 77132 13429 385 UnstrandedReadsAssigned:2542532 PositiveStrandReadsAssigned:2578994 NegativeStrandReadsAssigned:92009 Dataset is classified positive stranded MeadianReadLen=146 20thPercentileLength=145 echo kmer=141 SRR8635312 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635312-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,999,790 reads, 2,782,976 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52973 SRR8635312.ke.tsv 35125 SRR8635312.se.tsv 88098 total ==> SRR8635312.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 52 19.3391 PNS24243 293 194 0 0 KQK14069 1603 1504 33.1575 11.2492 KQK14071 474 375 0 0 ==> SRR8635312.se.tsv <== BRADI_1g14170v3 40 BRADI_1g53295v3 6 BRADI_1g59795v3 43 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 340 BRADI_1g74790v3 2 BRADI_1g09890v3 2 BRADI_1g77505v3 45 BRADI_1g48960v3 4 SRR8635312 completed mapping pipeline successfully