Starting /dee2/code/volunteer_pipeline.sh SRR8635313 current disk space = 1525826666496 free memory = 1576356664 SRR8635313 SRAfilesize cb44ee9b7b3c09712cf809201df6501f SRR8635313.sra SRR8635313.sra file validated SRR8635313 is single end SRR8635313 is conventional basespace SRR8635313 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635313_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.1075 32.0 32.0 32.0 27.0 32.0 2 31.27625 32.0 32.0 32.0 32.0 32.0 3 33.73875 37.0 32.0 37.0 32.0 37.0 4 34.58625 37.0 37.0 37.0 27.0 37.0 5 35.085 37.0 37.0 37.0 27.0 37.0 6 37.7935 41.0 37.0 41.0 32.0 41.0 7 38.6905 41.0 37.0 41.0 32.0 41.0 8 39.01325 41.0 37.0 41.0 37.0 41.0 9 39.10525 41.0 41.0 41.0 37.0 41.0 10-14 39.38875 41.0 41.0 41.0 37.0 41.0 15-19 39.571400000000004 41.0 41.0 41.0 37.0 41.0 20-24 39.40815 41.0 41.0 41.0 37.0 41.0 25-29 38.7614 41.0 39.4 41.0 34.0 41.0 30-34 38.7381 41.0 40.2 41.0 34.0 41.0 35-39 38.9293 41.0 40.2 41.0 36.0 41.0 40-44 38.30715 41.0 37.8 41.0 32.0 41.0 45-49 38.658699999999996 41.0 39.4 41.0 32.0 41.0 50-54 38.760400000000004 41.0 40.2 41.0 32.0 41.0 55-59 38.5313 41.0 39.4 41.0 32.0 41.0 60-64 38.059999999999995 41.0 37.0 41.0 32.0 41.0 65-69 38.13275 41.0 37.0 41.0 31.0 41.0 70-74 37.14425 41.0 37.0 41.0 28.0 41.0 75-79 35.82445 39.4 35.0 41.0 23.0 41.0 80-84 35.96595 41.0 34.0 41.0 24.0 41.0 85-89 36.4999 41.0 36.0 41.0 26.0 41.0 90-94 37.03535 41.0 37.0 41.0 26.0 41.0 95-99 36.46835 41.0 37.0 41.0 26.0 41.0 100-104 35.71155 40.2 36.0 41.0 22.0 41.0 105-109 32.8155 37.0 29.0 41.0 12.0 41.0 110-114 32.939049999999995 37.0 29.0 41.0 12.0 41.0 115-119 31.3421 37.0 24.0 41.0 12.0 41.0 120-124 31.3082 36.0 26.0 41.0 12.0 41.0 125-129 29.1137 31.0 20.0 39.4 12.0 41.0 130-134 28.07295 31.0 18.0 37.0 12.0 41.0 135-139 26.663850000000004 28.0 14.0 37.0 11.2 41.0 140-144 25.291449999999998 24.0 12.0 35.0 11.2 40.2 145-149 24.5269 26.0 12.0 36.0 8.0 40.2 150 24.2305 27.0 12.0 37.0 8.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 2.0 20 10.0 21 8.0 22 22.0 23 29.0 24 34.0 25 43.0 26 74.0 27 77.0 28 110.0 29 113.0 30 145.0 31 169.0 32 235.0 33 248.0 34 271.0 35 361.0 36 436.0 37 495.0 38 522.0 39 520.0 40 75.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.975 14.825 26.150000000000002 14.05 2 45.225 16.575 23.275000000000002 14.924999999999999 3 43.824999999999996 17.549999999999997 24.224999999999998 14.399999999999999 4 44.675 16.525000000000002 23.025000000000002 15.775 5 40.775 17.2 24.95 17.075000000000003 6 44.725 13.875000000000002 25.324999999999996 16.075 7 44.275 14.75 24.85 16.125 8 39.900000000000006 15.4 27.150000000000002 17.549999999999997 9 36.175000000000004 15.7 28.875 19.25 10-14 32.32 20.169999999999998 28.904999999999998 18.605 15-19 27.339999999999996 22.28 27.05 23.330000000000002 20-24 27.515 22.1 26.119999999999997 24.265 25-29 27.27 22.56 26.405 23.765 30-34 27.805000000000003 21.575 27.98 22.64 35-39 28.075 22.314999999999998 26.884999999999998 22.725 40-44 26.75 23.755000000000003 27.255000000000003 22.24 45-49 26.465 23.25 28.01 22.275 50-54 26.400000000000002 24.93 26.845000000000002 21.825 55-59 25.145 28.065 26.105 20.685000000000002 60-64 26.02 25.47 26.245 22.264999999999997 65-69 27.175 26.135 27.169999999999998 19.52 70-74 25.790000000000003 27.26 27.38 19.57 75-79 24.115000000000002 29.84 26.729999999999997 19.314999999999998 80-84 23.325000000000003 31.374999999999996 24.745 20.555 85-89 22.23 33.155 25.040000000000003 19.575 90-94 24.654999999999998 31.94 23.745 19.66 95-99 23.76 34.675 23.7 17.865000000000002 100-104 21.709999999999997 35.754999999999995 23.43 19.105 105-109 21.3 36.325 22.45 19.925 110-114 20.995 37.714999999999996 22.515 18.775 115-119 20.895 38.32 22.45 18.335 120-124 23.27 37.025000000000006 20.5 19.205 125-129 23.29 38.095 20.04 18.575 130-134 22.52 37.14 20.65 19.689999999999998 135-139 21.77 37.875 20.27 20.085 140-144 21.875 37.405 20.055 20.665 145-149 21.595 36.35 20.294999999999998 21.759999999999998 150 21.025 36.6 20.200000000000003 22.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.0 18 1.0 19 1.0 20 1.5 21 4.5 22 3.5 23 0.5 24 2.5 25 6.5 26 11.0 27 12.0 28 13.0 29 22.5 30 29.0 31 38.5 32 47.5 33 57.0 34 74.5 35 82.5 36 95.0 37 103.0 38 112.5 39 149.0 40 156.5 41 149.5 42 151.5 43 147.5 44 151.0 45 145.5 46 140.0 47 130.5 48 121.5 49 109.5 50 88.5 51 87.0 52 99.5 53 102.0 54 106.5 55 117.5 56 116.0 57 95.5 58 85.0 59 71.5 60 56.5 61 69.0 62 71.5 63 69.5 64 51.0 65 21.0 66 20.0 67 26.0 68 48.0 69 95.5 70 91.5 71 52.0 72 25.5 73 10.0 74 12.5 75 12.5 76 10.5 77 8.5 78 3.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.6 #Duplication Level Percentage of deduplicated Percentage of total 1 91.3527397260274 80.025 2 6.56392694063927 11.5 3 1.1700913242009132 3.075 4 0.3995433789954338 1.4000000000000001 5 0.228310502283105 1.0 6 0.08561643835616438 0.44999999999999996 7 0.028538812785388126 0.17500000000000002 8 0.05707762557077625 0.4 9 0.028538812785388126 0.22499999999999998 >10 0.08561643835616438 1.7500000000000002 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 47 1.175 No Hit GTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCC 12 0.3 No Hit TGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCG 11 0.27499999999999997 No Hit GCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTG 9 0.22499999999999998 No Hit GTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAA 8 0.2 No Hit GGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGC 8 0.2 No Hit GGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTT 7 0.17500000000000002 No Hit TCGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGC 6 0.15 No Hit GAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCC 6 0.15 No Hit GGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCT 6 0.15 No Hit GGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCC 5 0.125 No Hit GGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAATACAG 5 0.125 No Hit CCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGC 5 0.125 No Hit GGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAA 5 0.125 No Hit ACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGT 5 0.125 No Hit CGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGA 5 0.125 No Hit GGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGT 5 0.125 No Hit CGGGCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.0625 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1125 0.025 0.0 0.0 0.0 34-35 0.15 0.025 0.0 0.0 0.0 36-37 0.15 0.025 0.0 0.0 0.0 38-39 0.16249999999999998 0.025 0.0 0.0 0.0 40-41 0.2 0.025 0.0 0.0 0.0 42-43 0.2 0.025 0.0 0.0 0.0 44-45 0.21250000000000002 0.025 0.0 0.0 0.0 46-47 0.2875 0.025 0.0 0.0 0.0 48-49 0.3 0.025 0.0 0.0 0.0 50-51 0.3 0.025 0.0 0.0 0.0 52-53 0.325 0.025 0.0 0.0 0.0 54-55 0.36250000000000004 0.025 0.0 0.0 0.0 56-57 0.475 0.025 0.0 0.0 0.0 58-59 0.5625 0.025 0.0 0.0 0.0 60-61 0.625 0.025 0.0 0.0 0.0 62-63 0.7 0.025 0.0 0.0 0.0 64-65 0.725 0.025 0.0 0.0 0.0 66-67 0.7375 0.025 0.0 0.0 0.0 68-69 0.75 0.025 0.0 0.0 0.0 70-71 0.825 0.025 0.0 0.0 0.0 72-73 1.0 0.025 0.0 0.0 0.0 74-75 1.0875 0.025 0.0 0.0 0.0 76-77 1.15 0.025 0.0 0.0 0.0 78-79 1.175 0.025 0.0 0.0 0.0 80-81 1.2875 0.025 0.0 0.0 0.0 82-83 1.4874999999999998 0.025 0.0 0.0 0.0 84-85 1.775 0.025 0.0 0.0 0.0 86-87 2.1375 0.025 0.0 0.0 0.0 88-89 2.4625 0.025 0.0 0.0 0.0 90-91 2.825 0.025 0.0 0.0 0.0 92-93 3.1875 0.025 0.0 0.0 0.0 94-95 3.625 0.025 0.0 0.0 0.0 96-97 4.225 0.025 0.0 0.0 0.0 98-99 4.6625 0.025 0.0 0.0 0.0 100-101 4.9375 0.025 0.0 0.0 0.0 102-103 5.425000000000001 0.025 0.0 0.0 0.0 104-105 6.15 0.025 0.0 0.0 0.0 106-107 6.8 0.025 0.0 0.0 0.0 108-109 7.375 0.025 0.0 0.0 0.0 110-111 7.925 0.025 0.0 0.0 0.0 112-113 8.675 0.025 0.0 0.0 0.0 114-115 9.5 0.025 0.0 0.0 0.0 116-117 10.2625 0.025 0.0 0.0 0.0 118-119 11.3125 0.025 0.0 0.0 0.0 120-121 12.1 0.025 0.0 0.0 0.0 122-123 12.8875 0.025 0.0 0.0 0.0 124-125 13.4875 0.025 0.0 0.0 0.0 126-127 13.975 0.025 0.0 0.0 0.0 128-129 14.825 0.025 0.0 0.0 0.0 130-131 15.4625 0.025 0.0 0.0 0.0 132-133 16.075 0.025 0.0 0.0 0.0 134-135 16.675 0.025 0.0 0.0 0.0 136-137 17.375 0.025 0.0 0.0 0.0 138 17.775 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTGG 10 0.006973645 144.0 2 GGCGCCT 10 0.006973645 144.0 6 CATTTTG 10 0.006973645 144.0 6 >>END_MODULE Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499200 READS because READLEN < 1 Read 499200 spots for SRR8635313.sra Written 499200 spots for SRR8635313.sra Rejected 499217 READS because READLEN < 1 Read 499217 spots for SRR8635313.sra Written 499217 spots for SRR8635313.sra SRR ids: ['SRR8635313.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_751t0z90 SRR8635313.sra spots: 9984017 blocks: [[1, 499200], [499201, 998400], [998401, 1497600], [1497601, 1996800], [1996801, 2496000], [2496001, 2995200], [2995201, 3494400], [3494401, 3993600], [3993601, 4492800], [4492801, 4992000], [4992001, 5491200], [5491201, 5990400], [5990401, 6489600], [6489601, 6988800], [6988801, 7488000], [7488001, 7987200], [7987201, 8486400], [8486401, 8985600], [8985601, 9484800], [9484801, 9984017]] SRR8635313 file size 3342086 SRR8635313 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635313 SRR8635313_1.fastq Input file: SRR8635313_1.fastq trimmed: SRR8635313-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:40:51 2024 >> started Mon Dec 9 12:41:01 2024 >> done (9.484s) 9984017 reads processed; of these: 355 ( 0.00%) short reads filtered out after trimming by size control 155 ( 0.00%) empty reads filtered out after trimming by size control 9983507 (99.99%) reads available; of these: 2141408 (21.45%) trimmed reads available after processing 7842099 (78.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 88 0.00% 19 164 0.00% 20 314 0.00% 21 527 0.01% 22 892 0.01% 23 1029 0.01% 24 1066 0.01% 25 984 0.01% 26 962 0.01% 27 920 0.01% 28 952 0.01% 29 957 0.01% 30 1017 0.01% 31 948 0.01% 32 850 0.01% 33 836 0.01% 34 815 0.01% 35 849 0.01% 36 829 0.01% 37 832 0.01% 38 814 0.01% 39 804 0.01% 40 790 0.01% 41 830 0.01% 42 800 0.01% 43 888 0.01% 44 880 0.01% 45 979 0.01% 46 1085 0.01% 47 1322 0.01% 48 1411 0.01% 49 1528 0.02% 50 1815 0.02% 51 2015 0.02% 52 2166 0.02% 53 2692 0.03% 54 3876 0.04% 55 3698 0.04% 56 3123 0.03% 57 3568 0.04% 58 3833 0.04% 59 3965 0.04% 60 3877 0.04% 61 3837 0.04% 62 3977 0.04% 63 3839 0.04% 64 3824 0.04% 65 4083 0.04% 66 4402 0.04% 67 4714 0.05% 68 4766 0.05% 69 4908 0.05% 70 5728 0.06% 71 6168 0.06% 72 6211 0.06% 73 6524 0.07% 74 6590 0.07% 75 6854 0.07% 76 7216 0.07% 77 8087 0.08% 78 9324 0.09% 79 11314 0.11% 80 14432 0.14% 81 15292 0.15% 82 15703 0.16% 83 17471 0.17% 84 20354 0.20% 85 20244 0.20% 86 18792 0.19% 87 18294 0.18% 88 19344 0.19% 89 20646 0.21% 90 22734 0.23% 91 25057 0.25% 92 25863 0.26% 93 26092 0.26% 94 27639 0.28% 95 30575 0.31% 96 30226 0.30% 97 28323 0.28% 98 27108 0.27% 99 26676 0.27% 100 27547 0.28% 101 28788 0.29% 102 30054 0.30% 103 31174 0.31% 104 32817 0.33% 105 35737 0.36% 106 38169 0.38% 107 41324 0.41% 108 43411 0.43% 109 45959 0.46% 110 47441 0.48% 111 51345 0.51% 112 52298 0.52% 113 50016 0.50% 114 48236 0.48% 115 49445 0.50% 116 51565 0.52% 117 52993 0.53% 118 34913 0.35% 119 0 0.00% 120 0 0.00% 121 1 0.00% 122 0 0.00% 123 0 0.00% 124 2 0.00% 125 1 0.00% 126 1 0.00% 127 2 0.00% 128 7 0.00% 129 10 0.00% 130 12 0.00% 131 30 0.00% 132 32 0.00% 133 60 0.00% 134 63 0.00% 135 123 0.00% 136 194 0.00% 137 314 0.00% 138 480 0.00% 139 746 0.01% 140 1130 0.01% 141 1946 0.02% 142 3216 0.03% 143 5666 0.06% 144 10036 0.10% 145 17895 0.18% 146 33416 0.33% 147 69121 0.69% 148 161752 1.62% 149 416099 4.17% 150 7842099 78.55% 9983507 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=40.53 fanout-score-rank=9 prefix-density=23.32 prefix-fanout=1.1 sequence=AGGCTAAATACTCCTGGGTGACCGATAGCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=551.40 fanout-score-rank=1 prefix-density=16.25 prefix-fanout=1.0 sequence=AACGAGTCGGGGTGTTTGGGAAT Started job on | Dec 09 12:43:17 Started mapping on | Dec 09 12:43:19 Finished on | Dec 09 12:44:38 Mapping speed, Million of reads per hour | 454.94 Number of input reads | 9983507 Average input read length | 142 UNIQUE READS: Uniquely mapped reads number | 5404126 Uniquely mapped reads % | 54.13% Average mapped length | 132.70 Number of splices: Total | 454602 Number of splices: Annotated (sjdb) | 340947 Number of splices: GT/AG | 384192 Number of splices: GC/AG | 7819 Number of splices: AT/AC | 428 Number of splices: Non-canonical | 62163 Mismatch rate per base, % | 0.64% Deletion rate per base | 0.00% Deletion average length | 1.51 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 683024 % of reads mapped to multiple loci | 6.84% Number of reads mapped to too many loci | 2737352 % of reads mapped to too many loci | 27.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.83% % of reads unmapped: other | 2.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3896357 3896357 3896357 N_multimapping 683024 683024 683024 N_noFeature 495085 545569 5241116 N_ambiguous 132645 22609 661 UnstrandedReadsAssigned:4776396 PositiveStrandReadsAssigned:4835948 NegativeStrandReadsAssigned:162349 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8635313 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635313-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,983,507 reads, 5,318,281 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR8635313.ke.tsv 35125 SRR8635313.se.tsv 88098 total ==> SRR8635313.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 83 15.7599 PNS24243 293 194 0 0 KQK14069 1603 1504 43 7.44819 KQK14071 474 375 0 0 ==> SRR8635313.se.tsv <== BRADI_1g14170v3 36 BRADI_1g53295v3 9 BRADI_1g59795v3 75 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 704 BRADI_1g74790v3 4 BRADI_1g09890v3 2 BRADI_1g77505v3 87 BRADI_1g48960v3 1 SRR8635313 completed mapping pipeline successfully