Starting /dee2/code/volunteer_pipeline.sh SRR8635314 current disk space = 1525829763072 free memory = 1576378632 SRR8635314 SRAfilesize 83f7facd798e29a5f104bbe94109f337 SRR8635314.sra SRR8635314.sra file validated SRR8635314 is single end SRR8635314 is conventional basespace SRR8635314 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635314_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.17 32.0 32.0 32.0 27.0 32.0 2 31.10625 32.0 32.0 32.0 32.0 32.0 3 32.57375 32.0 32.0 37.0 22.0 37.0 4 33.345 37.0 32.0 37.0 27.0 37.0 5 34.835 37.0 37.0 37.0 27.0 37.0 6 37.3325 41.0 37.0 41.0 32.0 41.0 7 37.7695 41.0 37.0 41.0 32.0 41.0 8 38.25775 41.0 37.0 41.0 32.0 41.0 9 38.58925 41.0 37.0 41.0 32.0 41.0 10-14 39.2189 41.0 40.2 41.0 37.0 41.0 15-19 39.410849999999996 41.0 41.0 41.0 37.0 41.0 20-24 39.49015 41.0 41.0 41.0 37.0 41.0 25-29 39.12825 41.0 41.0 41.0 36.0 41.0 30-34 39.127300000000005 41.0 41.0 41.0 36.0 41.0 35-39 39.296200000000006 41.0 41.0 41.0 36.0 41.0 40-44 38.73955 41.0 39.4 41.0 34.0 41.0 45-49 38.884449999999994 41.0 39.4 41.0 35.0 41.0 50-54 39.00115000000001 41.0 41.0 41.0 35.0 41.0 55-59 38.852999999999994 41.0 39.4 41.0 35.0 41.0 60-64 38.482749999999996 41.0 37.8 41.0 33.0 41.0 65-69 38.348400000000005 41.0 37.0 41.0 32.0 41.0 70-74 37.4622 41.0 37.0 41.0 29.0 41.0 75-79 36.1539 39.4 35.0 41.0 25.0 41.0 80-84 36.35185 41.0 35.0 41.0 24.0 41.0 85-89 36.9809 41.0 36.0 41.0 26.0 41.0 90-94 37.498650000000005 41.0 37.0 41.0 30.0 41.0 95-99 37.048899999999996 41.0 37.0 41.0 27.0 41.0 100-104 36.225 41.0 37.0 41.0 26.0 41.0 105-109 33.78489999999999 37.0 31.0 41.0 16.0 41.0 110-114 33.84325 37.0 30.0 41.0 16.0 41.0 115-119 32.11465 37.0 28.0 41.0 12.0 41.0 120-124 31.824100000000005 37.0 26.0 41.0 12.0 41.0 125-129 29.84425 34.0 22.0 40.2 12.0 41.0 130-134 28.824 32.0 22.0 37.8 12.0 41.0 135-139 27.312199999999997 28.0 16.0 37.0 12.0 41.0 140-144 25.9146 25.0 14.0 36.0 11.2 40.2 145-149 24.955 26.0 12.0 36.0 12.0 40.2 150 24.35975 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 1.0 19 0.0 20 3.0 21 4.0 22 7.0 23 21.0 24 25.0 25 37.0 26 63.0 27 60.0 28 77.0 29 93.0 30 123.0 31 174.0 32 190.0 33 258.0 34 321.0 35 386.0 36 462.0 37 558.0 38 597.0 39 460.0 40 77.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.9 15.2 25.224999999999998 15.675 2 43.475 17.125 24.275 15.125 3 42.449999999999996 17.4 24.975 15.174999999999999 4 43.1 16.85 24.224999999999998 15.825 5 41.375 14.45 26.1 18.075 6 43.85 13.575000000000001 26.25 16.325 7 42.875 13.0 26.400000000000002 17.724999999999998 8 40.050000000000004 13.350000000000001 27.950000000000003 18.65 9 36.125 15.775 27.6 20.5 10-14 31.34 20.669999999999998 28.95 19.040000000000003 15-19 28.249999999999996 22.0 26.534999999999997 23.215 20-24 27.644999999999996 22.095000000000002 25.759999999999998 24.5 25-29 27.725 22.845 25.915 23.515 30-34 28.65 22.08 27.189999999999998 22.08 35-39 27.38 22.605 27.994999999999997 22.02 40-44 26.474999999999998 22.99 27.495000000000005 23.04 45-49 25.929999999999996 24.22 28.08 21.77 50-54 25.96 25.019999999999996 26.775 22.245 55-59 25.380000000000003 27.27 26.88 20.47 60-64 26.02 26.075 26.05 21.855 65-69 27.08 25.795 27.255000000000003 19.869999999999997 70-74 26.435 26.39 27.785 19.39 75-79 24.905 28.78 26.534999999999997 19.78 80-84 22.919999999999998 30.525000000000002 25.665 20.89 85-89 22.98 31.56 25.36 20.1 90-94 24.315 31.685000000000002 24.845 19.155 95-99 23.5 34.69 24.11 17.7 100-104 22.155 35.485 23.544999999999998 18.815 105-109 21.44 37.15 22.435 18.975 110-114 21.23 38.365 22.16 18.245 115-119 20.865000000000002 39.1 22.09 17.945 120-124 22.134999999999998 39.295 20.424999999999997 18.145 125-129 21.935 38.43 20.495 19.139999999999997 130-134 21.61 38.07 21.22 19.1 135-139 21.07 38.74 21.16 19.03 140-144 20.830000000000002 37.875 20.855 20.44 145-149 20.355 36.230000000000004 22.275 21.14 150 20.45 35.125 22.825 21.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 2.0 20 1.5 21 0.0 22 0.0 23 0.5 24 2.5 25 8.0 26 9.5 27 10.0 28 11.5 29 16.0 30 25.0 31 38.5 32 47.0 33 48.5 34 62.5 35 82.0 36 95.5 37 101.5 38 117.0 39 143.0 40 160.5 41 167.5 42 163.0 43 168.0 44 164.5 45 145.5 46 137.0 47 127.0 48 119.0 49 103.0 50 101.5 51 107.0 52 100.0 53 111.5 54 103.0 55 97.0 56 111.5 57 96.0 58 73.5 59 60.5 60 61.0 61 76.5 62 73.0 63 68.0 64 54.0 65 26.0 66 21.0 67 24.5 68 48.0 69 82.0 70 74.0 71 49.5 72 30.5 73 15.5 74 13.0 75 16.5 76 15.0 77 6.0 78 3.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.84255561893896 80.5 2 6.303479749001712 11.05 3 0.8841985168282943 2.325 4 0.37079292641186534 1.3 5 0.1426126640045636 0.625 6 0.11409013120365087 0.6 7 0.08556759840273817 0.525 8 0.028522532800912718 0.2 9 0.057045065601825436 0.44999999999999996 >10 0.17113519680547634 2.4250000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 32 0.8 No Hit GTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCC 21 0.525 No Hit CGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGG 13 0.325 No Hit GGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTT 11 0.27499999999999997 No Hit GGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGC 10 0.25 No Hit CGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTT 10 0.25 No Hit GTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAA 9 0.22499999999999998 No Hit TCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAG 9 0.22499999999999998 No Hit CGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTC 8 0.2 No Hit GTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAAT 7 0.17500000000000002 No Hit CTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAG 7 0.17500000000000002 No Hit GGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCT 7 0.17500000000000002 No Hit GGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAA 6 0.15 No Hit AGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCA 6 0.15 No Hit AGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCG 6 0.15 No Hit CGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGCG 6 0.15 No Hit GGGTTTAGGTTGGGCTTCGGGCCATAGGGGTCCGTCTGTGTCATCCGTCT 5 0.125 No Hit GCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTG 5 0.125 No Hit GCCTGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAG 5 0.125 No Hit GAGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAG 5 0.125 No Hit GGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.0625 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.11249999999999999 0.0 0.0 0.0 0.0 50-51 0.16249999999999998 0.0 0.0 0.0 0.0 52-53 0.21250000000000002 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.2625 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.375 0.0 0.0 0.0 0.0 62-63 0.475 0.0 0.0 0.0 0.0 64-65 0.5375000000000001 0.0 0.0 0.0 0.0 66-67 0.5874999999999999 0.0 0.0 0.0 0.0 68-69 0.6 0.0 0.0 0.0 0.0 70-71 0.6499999999999999 0.0 0.0 0.0 0.0 72-73 0.7375 0.0 0.0 0.0 0.0 74-75 0.8625 0.0 0.0 0.0 0.0 76-77 0.925 0.0 0.0 0.0 0.0 78-79 1.0499999999999998 0.0 0.0 0.0 0.0 80-81 1.2375 0.0 0.0 0.0 0.0 82-83 1.5125000000000002 0.0 0.0 0.0 0.0 84-85 1.825 0.0 0.0 0.0 0.0 86-87 2.0374999999999996 0.0 0.0 0.0 0.0 88-89 2.3125 0.0 0.0 0.0 0.0 90-91 2.65 0.0 0.0 0.0 0.0 92-93 2.9875 0.0 0.0 0.0 0.0 94-95 3.4625000000000004 0.0 0.0 0.0 0.0 96-97 3.9875 0.0 0.0 0.0 0.0 98-99 4.3875 0.0 0.0 0.0 0.0 100-101 4.699999999999999 0.0 0.0 0.0 0.0 102-103 5.199999999999999 0.0 0.0 0.0 0.0 104-105 5.6625 0.0 0.0 0.0 0.0 106-107 6.475 0.0 0.0 0.0 0.0 108-109 7.225 0.0 0.0 0.0 0.0 110-111 8.075 0.0 0.0 0.0 0.0 112-113 9.075 0.0 0.0 0.0 0.0 114-115 10.075 0.0 0.0 0.0 0.0 116-117 11.0 0.0 0.0 0.0 0.0 118-119 11.837499999999999 0.0 0.0 0.0 0.0 120-121 12.8 0.0 0.0 0.0 0.0 122-123 13.75 0.0 0.0 0.0 0.0 124-125 14.775 0.0 0.0 0.0 0.0 126-127 15.525 0.0 0.0 0.0 0.0 128-129 16.3875 0.0 0.0 0.0 0.0 130-131 17.275 0.0 0.0 0.0 0.0 132-133 17.9375 0.0 0.0 0.0 0.0 134-135 18.675 0.0 0.0 0.0 0.0 136-137 19.424999999999997 0.0 0.0 0.0 0.0 138 20.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGTG 10 0.006973645 144.0 1 CTTGCGA 10 0.006973645 144.0 1 GCGAGTC 10 0.006973645 144.0 4 >>END_MODULE Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra Rejected 227283 READS because READLEN < 1 Read 227283 spots for SRR8635314.sra Written 227283 spots for SRR8635314.sra SRR ids: ['SRR8635314.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8jbo8tkb SRR8635314.sra spots: 4545660 blocks: [[1, 227283], [227284, 454566], [454567, 681849], [681850, 909132], [909133, 1136415], [1136416, 1363698], [1363699, 1590981], [1590982, 1818264], [1818265, 2045547], [2045548, 2272830], [2272831, 2500113], [2500114, 2727396], [2727397, 2954679], [2954680, 3181962], [3181963, 3409245], [3409246, 3636528], [3636529, 3863811], [3863812, 4091094], [4091095, 4318377], [4318378, 4545660]] SRR8635314 file size 1520449 SRR8635314 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635314 SRR8635314_1.fastq Input file: SRR8635314_1.fastq trimmed: SRR8635314-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:39:11 2024 >> started Mon Dec 9 12:39:16 2024 >> done (4.554s) 4545660 reads processed; of these: 131 ( 0.00%) short reads filtered out after trimming by size control 44 ( 0.00%) empty reads filtered out after trimming by size control 4545485 (100.00%) reads available; of these: 930717 (20.48%) trimmed reads available after processing 3614768 (79.52%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 41 0.00% 19 66 0.00% 20 133 0.00% 21 252 0.01% 22 361 0.01% 23 402 0.01% 24 447 0.01% 25 431 0.01% 26 378 0.01% 27 369 0.01% 28 389 0.01% 29 449 0.01% 30 470 0.01% 31 378 0.01% 32 420 0.01% 33 379 0.01% 34 354 0.01% 35 356 0.01% 36 385 0.01% 37 392 0.01% 38 348 0.01% 39 349 0.01% 40 352 0.01% 41 346 0.01% 42 336 0.01% 43 368 0.01% 44 407 0.01% 45 433 0.01% 46 528 0.01% 47 621 0.01% 48 676 0.01% 49 685 0.02% 50 889 0.02% 51 971 0.02% 52 952 0.02% 53 1345 0.03% 54 1745 0.04% 55 1605 0.04% 56 1466 0.03% 57 1646 0.04% 58 1692 0.04% 59 1814 0.04% 60 1663 0.04% 61 1858 0.04% 62 1791 0.04% 63 1658 0.04% 64 1747 0.04% 65 1881 0.04% 66 1908 0.04% 67 2086 0.05% 68 2101 0.05% 69 2120 0.05% 70 2364 0.05% 71 2724 0.06% 72 2761 0.06% 73 2647 0.06% 74 2745 0.06% 75 2815 0.06% 76 3060 0.07% 77 3281 0.07% 78 4045 0.09% 79 4853 0.11% 80 6235 0.14% 81 6749 0.15% 82 6967 0.15% 83 7701 0.17% 84 9081 0.20% 85 8901 0.20% 86 8077 0.18% 87 8076 0.18% 88 8219 0.18% 89 9167 0.20% 90 9900 0.22% 91 11218 0.25% 92 11438 0.25% 93 11382 0.25% 94 12525 0.28% 95 13670 0.30% 96 13783 0.30% 97 12980 0.29% 98 12653 0.28% 99 12757 0.28% 100 13225 0.29% 101 14187 0.31% 102 14730 0.32% 103 14876 0.33% 104 15904 0.35% 105 17715 0.39% 106 19602 0.43% 107 21219 0.47% 108 22622 0.50% 109 24012 0.53% 110 25236 0.56% 111 28478 0.63% 112 28597 0.63% 113 26510 0.58% 114 25745 0.57% 115 25803 0.57% 116 27029 0.59% 117 27356 0.60% 118 20981 0.46% 119 0 0.00% 120 0 0.00% 121 1 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 1 0.00% 129 0 0.00% 130 0 0.00% 131 1 0.00% 132 2 0.00% 133 5 0.00% 134 2 0.00% 135 7 0.00% 136 17 0.00% 137 41 0.00% 138 47 0.00% 139 115 0.00% 140 190 0.00% 141 417 0.01% 142 681 0.01% 143 1437 0.03% 144 2860 0.06% 145 5474 0.12% 146 11019 0.24% 147 22649 0.50% 148 46636 1.03% 149 147275 3.24% 150 3614768 79.52% 4545485 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=45.07 fanout-score-rank=8 prefix-density=25.87 prefix-fanout=1.1 sequence=AGGCTAAATACTCCTGGGTGACCGATAGCG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=814.57 fanout-score-rank=1 prefix-density=17.86 prefix-fanout=1.0 sequence=AACGAGTCGGGGTGTTTGGGAAT Started job on | Dec 09 12:39:41 Started mapping on | Dec 09 12:39:41 Finished on | Dec 09 12:40:08 Mapping speed, Million of reads per hour | 606.06 Number of input reads | 4545485 Average input read length | 142 UNIQUE READS: Uniquely mapped reads number | 2490697 Uniquely mapped reads % | 54.79% Average mapped length | 132.96 Number of splices: Total | 203656 Number of splices: Annotated (sjdb) | 150759 Number of splices: GT/AG | 170404 Number of splices: GC/AG | 3552 Number of splices: AT/AC | 186 Number of splices: Non-canonical | 29514 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.01% Deletion average length | 1.49 Insertion rate per base | 0.01% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311461 % of reads mapped to multiple loci | 6.85% Number of reads mapped to too many loci | 1347836 % of reads mapped to too many loci | 29.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.94% % of reads unmapped: other | 1.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1743327 1743327 1743327 N_multimapping 311461 311461 311461 N_noFeature 224463 247119 2414905 N_ambiguous 62370 10320 325 UnstrandedReadsAssigned:2203864 PositiveStrandReadsAssigned:2233258 NegativeStrandReadsAssigned:75467 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8635314 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635314-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,545,485 reads, 2,424,969 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 940 rounds 52973 SRR8635314.ke.tsv 35125 SRR8635314.se.tsv 88098 total ==> SRR8635314.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 31 13.0531 PNS24243 293 194 0 0 KQK14069 1603 1504 23.0787 8.86486 KQK14071 474 375 0 0 ==> SRR8635314.se.tsv <== BRADI_1g14170v3 25 BRADI_1g53295v3 3 BRADI_1g59795v3 39 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 251 BRADI_1g74790v3 0 BRADI_1g09890v3 1 BRADI_1g77505v3 42 BRADI_1g48960v3 0 SRR8635314 completed mapping pipeline successfully