Starting /dee2/code/volunteer_pipeline.sh SRR8742292 current disk space = 1543056076800 free memory = 1599811292 SRR8742292 SRAfilesize cbb84d17dc00ffe43acc3c251844c873 SRR8742292.sra SRR8742292.sra file validated SRR8742292 is single end SRR8742292 is conventional basespace SRR8742292 read1 length is 39-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8742292_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 39-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.80325 32.0 32.0 32.0 32.0 32.0 2 30.96775 32.0 32.0 32.0 32.0 32.0 3 31.1715 32.0 32.0 32.0 32.0 32.0 4 31.28525 32.0 32.0 32.0 32.0 32.0 5 31.27275 32.0 32.0 32.0 32.0 32.0 6 34.065 36.0 36.0 36.0 32.0 36.0 7 34.6765 36.0 36.0 36.0 32.0 36.0 8 34.601 36.0 36.0 36.0 32.0 36.0 9 34.613 36.0 36.0 36.0 32.0 36.0 10-11 34.522875 36.0 36.0 36.0 32.0 36.0 12-13 34.554874999999996 36.0 36.0 36.0 32.0 36.0 14-15 34.4995 36.0 36.0 36.0 32.0 36.0 16-17 34.536375 36.0 36.0 36.0 32.0 36.0 18-19 34.429125 36.0 36.0 36.0 32.0 36.0 20-21 34.43075 36.0 36.0 36.0 32.0 36.0 22-23 34.492125 36.0 36.0 36.0 32.0 36.0 24-25 34.306625 36.0 36.0 36.0 32.0 36.0 26-27 34.325874999999996 36.0 36.0 36.0 32.0 36.0 28-29 34.0945 36.0 36.0 36.0 32.0 36.0 30-31 33.9315 36.0 36.0 36.0 32.0 36.0 32-33 34.085625 36.0 36.0 36.0 32.0 36.0 34-35 34.05425 36.0 36.0 36.0 32.0 36.0 36-37 34.027875 36.0 36.0 36.0 32.0 36.0 38-39 34.063375 36.0 36.0 36.0 32.0 36.0 40-41 33.94048512128032 36.0 36.0 36.0 32.0 36.0 42-43 34.057139284821204 36.0 36.0 36.0 32.0 36.0 44-45 33.844586146536635 36.0 36.0 36.0 32.0 36.0 46-47 33.97524381095273 36.0 36.0 36.0 32.0 36.0 48-49 33.94336084021005 36.0 36.0 36.0 32.0 36.0 50-51 33.68692173043261 36.0 36.0 36.0 29.5 36.0 52-53 33.687171792948234 36.0 36.0 36.0 27.0 36.0 54-55 33.290197549387344 36.0 36.0 36.0 24.0 36.0 56-57 33.31132783195799 36.0 36.0 36.0 27.0 36.0 58-59 33.30182545636409 36.0 36.0 36.0 24.0 36.0 60-61 33.39222305576394 36.0 36.0 36.0 24.0 36.0 62-63 33.12053013253313 36.0 36.0 36.0 21.0 36.0 64-65 33.18217054263566 36.0 36.0 36.0 21.0 36.0 66-67 32.94447242375877 36.0 32.0 36.0 24.0 36.0 68-69 33.039577948003085 36.0 32.0 36.0 24.0 36.0 70-71 32.94227397946406 36.0 32.0 36.0 21.0 36.0 72-73 32.889474124237104 36.0 32.0 36.0 21.0 36.0 74-75 32.71644835865241 36.0 32.0 36.0 17.5 36.0 76 31.57942170484416 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 4.0 23 9.0 24 11.0 25 28.0 26 45.0 27 57.0 28 101.0 29 154.0 30 172.0 31 229.0 32 286.0 33 433.0 34 821.0 35 1648.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.275 11.275 5.8999999999999995 47.55 2 18.85 13.975000000000001 43.15 24.025 3 19.2 17.474999999999998 23.549999999999997 39.775 4 25.324999999999996 27.375 20.525 26.775 5 23.5 34.25 22.975 19.275000000000002 6 21.03134479271992 32.077856420626894 25.40444893832154 21.48634984833165 7 17.424999999999997 24.05 40.2 18.325 8 19.425 22.375 31.924999999999997 26.275 9 19.525000000000002 20.849999999999998 35.125 24.5 10-11 23.549999999999997 30.7375 23.325000000000003 22.3875 12-13 22.7 24.5625 27.2625 25.474999999999998 14-15 21.9375 25.900000000000002 27.150000000000002 25.0125 16-17 23.175 25.374999999999996 25.674999999999997 25.775 18-19 22.6875 25.025 26.325 25.9625 20-21 22.925 24.9875 26.900000000000002 25.1875 22-23 22.925 26.0375 26.087500000000002 24.95 24-25 22.6875 25.15 25.637500000000003 26.525 26-27 23.375 25.724999999999998 25.5375 25.362499999999997 28-29 22.325 25.4 26.737499999999997 25.5375 30-31 22.912499999999998 25.5625 24.9125 26.6125 32-33 23.5625 25.25 25.4375 25.75 34-35 23.0125 26.1 25.337500000000002 25.55 36-37 23.025000000000002 25.374999999999996 25.387500000000003 26.2125 38-39 23.2125 24.712500000000002 25.687500000000004 26.387500000000003 40-41 23.193298324581146 26.144036009002253 25.693923480870218 24.968742185546386 42-43 23.668417104276067 25.218804701175294 25.806451612903224 25.30632658164541 44-45 22.918229557389346 25.11877969492373 26.094023505876468 25.868967241810452 46-47 23.055763940985248 25.831457864466117 25.868967241810452 25.243810952738183 48-49 23.643410852713178 24.55613903475869 25.6064016004001 26.19404851212803 50-51 23.705926481620406 26.131532883220803 25.23130782695674 24.93123280820205 52-53 22.893223305826456 25.79394848712178 25.98149537384346 25.331332833208304 54-55 23.36834208552138 25.49387346836709 25.456364091022753 25.681420355088775 56-57 22.61815453863466 25.331332833208304 25.918979744936234 26.131532883220803 58-59 22.73068267066767 26.16904226056514 25.218804701175294 25.881470367591895 60-61 24.168542135533883 25.35633908477119 24.843710927731934 25.63140785196299 62-63 23.605901475368842 25.531382845711427 25.618904726181547 25.243810952738183 64-65 22.95573893473368 26.131532883220803 24.256064016004 26.65666416604151 66-67 23.23371264224084 25.4345379517319 25.797173940227587 25.534575465799676 68-69 22.715894868585732 25.018773466833544 27.033792240300375 25.231539424280353 70-71 23.31580265464563 25.331830703731526 25.6824442774856 25.66992236413724 72-73 23.66767219708396 25.72900955253896 24.87430869783811 25.72900955253896 74-75 24.21136696392919 21.589245308132572 27.219486223878608 26.97990150405963 76 25.497559143822755 0.0 33.871573413443485 40.63086744273376 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.5 25 1.0 26 0.5 27 3.0 28 10.0 29 15.5 30 17.5 31 18.5 32 24.5 33 35.5 34 48.0 35 65.5 36 83.5 37 93.5 38 109.0 39 134.5 40 170.0 41 202.5 42 202.0 43 232.0 44 262.5 45 272.5 46 276.5 47 257.0 48 245.0 49 222.0 50 208.0 51 197.5 52 180.5 53 173.5 54 170.5 55 156.0 56 141.0 57 128.5 58 120.0 59 118.5 60 105.5 61 90.0 62 79.0 63 70.0 64 68.0 65 64.0 66 49.5 67 41.5 68 36.0 69 24.5 70 18.5 71 16.5 72 12.5 73 12.0 74 10.0 75 6.5 76 3.5 77 1.0 78 1.5 79 2.0 80 1.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0999999999999999 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 39 1.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 2.0 68 2.0 69 1.0 70 0.0 71 6.0 72 18.0 73 77.0 74 271.0 75 958.0 76 2663.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra Rejected 1200906 READS because READLEN < 1 Read 1200906 spots for SRR8742292.sra Written 1200906 spots for SRR8742292.sra SRR ids: ['SRR8742292.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_91k349k7 SRR8742292.sra spots: 24018120 blocks: [[1, 1200906], [1200907, 2401812], [2401813, 3602718], [3602719, 4803624], [4803625, 6004530], [6004531, 7205436], [7205437, 8406342], [8406343, 9607248], [9607249, 10808154], [10808155, 12009060], [12009061, 13209966], [13209967, 14410872], [14410873, 15611778], [15611779, 16812684], [16812685, 18013590], [18013591, 19214496], [19214497, 20415402], [20415403, 21616308], [21616309, 22817214], [22817215, 24018120]] SRR8742292 file size 4551719 SRR8742292 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8742292 SRR8742292_1.fastq Input file: SRR8742292_1.fastq trimmed: SRR8742292-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:26:11 2024 >> started Sat Dec 7 11:26:22 2024 >> done (11.123s) 24018120 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 3058 ( 0.01%) empty reads filtered out after trimming by size control 24015061 (99.99%) reads available; of these: 1727 ( 0.01%) trimmed reads available after processing 24013334 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 15 0.00% 23 21 0.00% 24 30 0.00% 25 41 0.00% 26 50 0.00% 27 60 0.00% 28 69 0.00% 29 90 0.00% 30 105 0.00% 31 119 0.00% 32 145 0.00% 33 157 0.00% 34 662 0.00% 35 301 0.00% 36 301 0.00% 37 345 0.00% 38 349 0.00% 39 355 0.00% 40 457 0.00% 41 518 0.00% 42 580 0.00% 43 574 0.00% 44 624 0.00% 45 697 0.00% 46 814 0.00% 47 849 0.00% 48 964 0.00% 49 1064 0.00% 50 1121 0.00% 51 1338 0.01% 52 1435 0.01% 53 1674 0.01% 54 1753 0.01% 55 1900 0.01% 56 2049 0.01% 57 2147 0.01% 58 2531 0.01% 59 2736 0.01% 60 3111 0.01% 61 3391 0.01% 62 3782 0.02% 63 4267 0.02% 64 4755 0.02% 65 5579 0.02% 66 6448 0.03% 67 6320 0.03% 68 6222 0.03% 69 7668 0.03% 70 11247 0.05% 71 40639 0.17% 72 114775 0.48% 73 430296 1.79% 74 1548423 6.45% 75 5665080 23.59% 76 16124016 67.14% 24015061 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=16 prefix-density=0.34 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=72.00 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=11.3 sequence=CAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGAT Started job on | Dec 07 11:26:47 Started mapping on | Dec 07 11:26:47 Finished on | Dec 07 11:27:07 Mapping speed, Million of reads per hour | 4322.71 Number of input reads | 24015061 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 23225393 Uniquely mapped reads % | 96.71% Average mapped length | 75.29 Number of splices: Total | 5948638 Number of splices: Annotated (sjdb) | 5726262 Number of splices: GT/AG | 5868598 Number of splices: GC/AG | 72617 Number of splices: AT/AC | 3429 Number of splices: Non-canonical | 3994 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 451171 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 183496 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 338497 338497 338497 N_multimapping 451171 451171 451171 N_noFeature 787041 22725108 900260 N_ambiguous 420584 1625 34481 UnstrandedReadsAssigned:22017768 PositiveStrandReadsAssigned:498660 NegativeStrandReadsAssigned:22290652 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR8742292 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8742292-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,015,061 reads, 22,334,918 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR8742292.ke.tsv 35125 SRR8742292.se.tsv 88098 total ==> SRR8742292.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 132.355 11.5113 PNS24247 1044 945 35.0061 2.69662 PNS24249 1928 1829 19.1734 0.76312 PNS24246 1044 945 35.0061 2.69662 PNS24248 1044 945 35.0061 2.69662 PNS24244 1471 1372 137.453 7.29304 PNS24243 293 194 0 0 KQK14069 1603 1504 3779.51 182.934 KQK14071 474 375 476.612 92.5212 ==> SRR8742292.se.tsv <== BRADI_1g14170v3 4590 BRADI_1g53295v3 77 BRADI_1g59795v3 353 BRADI_1g07683v3 0 BRADI_1g00485v3 68 BRADI_1g20270v3 3225 BRADI_1g74790v3 165 BRADI_1g09890v3 2 BRADI_1g77505v3 415 BRADI_1g48960v3 0 SRR8742292 completed mapping pipeline successfully