Starting /dee2/code/volunteer_pipeline.sh SRR8742304 current disk space = 1543092092928 free memory = 1595199760 SRR8742304 SRAfilesize 1022a9aca1e1b31ffc681eb3f3f398c2 SRR8742304.sra SRR8742304.sra file validated SRR8742304 is single end SRR8742304 is conventional basespace SRR8742304 read1 length is 76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8742304_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3735 32.0 32.0 32.0 32.0 32.0 2 31.35125 32.0 32.0 32.0 32.0 32.0 3 31.55975 32.0 32.0 32.0 32.0 32.0 4 31.6115 32.0 32.0 32.0 32.0 32.0 5 31.6365 32.0 32.0 32.0 32.0 32.0 6 35.1435 36.0 36.0 36.0 36.0 36.0 7 35.1735 36.0 36.0 36.0 36.0 36.0 8 35.22125 36.0 36.0 36.0 36.0 36.0 9 35.20175 36.0 36.0 36.0 36.0 36.0 10-11 35.1075 36.0 36.0 36.0 36.0 36.0 12-13 35.2425 36.0 36.0 36.0 36.0 36.0 14-15 35.218875 36.0 36.0 36.0 36.0 36.0 16-17 35.157875000000004 36.0 36.0 36.0 36.0 36.0 18-19 35.183375 36.0 36.0 36.0 36.0 36.0 20-21 35.042625 36.0 36.0 36.0 36.0 36.0 22-23 35.069375 36.0 36.0 36.0 36.0 36.0 24-25 35.02225 36.0 36.0 36.0 36.0 36.0 26-27 34.9835 36.0 36.0 36.0 36.0 36.0 28-29 35.146 36.0 36.0 36.0 36.0 36.0 30-31 35.04425 36.0 36.0 36.0 36.0 36.0 32-33 35.03425 36.0 36.0 36.0 36.0 36.0 34-35 34.913 36.0 36.0 36.0 36.0 36.0 36-37 34.9465 36.0 36.0 36.0 34.0 36.0 38-39 34.895625 36.0 36.0 36.0 34.0 36.0 40-41 34.912625000000006 36.0 36.0 36.0 36.0 36.0 42-43 34.87775 36.0 36.0 36.0 36.0 36.0 44-45 34.967625 36.0 36.0 36.0 36.0 36.0 46-47 34.969875 36.0 36.0 36.0 36.0 36.0 48-49 34.8275 36.0 36.0 36.0 34.0 36.0 50-51 34.850375 36.0 36.0 36.0 34.0 36.0 52-53 34.779624999999996 36.0 36.0 36.0 34.0 36.0 54-55 34.663250000000005 36.0 36.0 36.0 32.0 36.0 56-57 34.32475 36.0 36.0 36.0 32.0 36.0 58-59 34.391375 36.0 36.0 36.0 32.0 36.0 60-61 34.362375 36.0 36.0 36.0 32.0 36.0 62-63 34.238375 36.0 36.0 36.0 32.0 36.0 64-65 34.106875 36.0 36.0 36.0 32.0 36.0 66-67 34.147875 36.0 36.0 36.0 32.0 36.0 68-69 34.445 36.0 36.0 36.0 32.0 36.0 70-71 34.234125 36.0 36.0 36.0 32.0 36.0 72-73 34.272375 36.0 36.0 36.0 32.0 36.0 74-75 33.967 36.0 36.0 36.0 29.5 36.0 76 31.989 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 5.0 25 10.0 26 17.0 27 20.0 28 33.0 29 69.0 30 90.0 31 114.0 32 159.0 33 268.0 34 747.0 35 2465.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.425 10.8 6.0249999999999995 43.75 2 20.075000000000003 13.625000000000002 40.825 25.474999999999998 3 20.1 16.775000000000002 24.7 38.425 4 25.55 27.975 21.25 25.224999999999998 5 24.4 32.225 23.875 19.5 6 22.453066332916144 31.66458072590738 24.080100125156445 21.802252816020026 7 17.825 23.549999999999997 40.275 18.35 8 17.9 22.85 33.074999999999996 26.174999999999997 9 18.4 21.3 34.725 25.575 10-11 22.55 31.337500000000002 23.775 22.3375 12-13 22.6875 23.8125 26.687499999999996 26.8125 14-15 21.25 25.4625 28.1375 25.15 16-17 23.8125 26.224999999999998 26.137500000000003 23.825 18-19 22.6875 25.2625 25.9625 26.087500000000002 20-21 22.8875 25.474999999999998 26.3 25.337500000000002 22-23 22.625 25.974999999999998 26.137500000000003 25.2625 24-25 22.15 25.662499999999998 26.0125 26.174999999999997 26-27 21.925 25.525 27.250000000000004 25.3 28-29 22.912499999999998 25.85 26.6 24.637500000000003 30-31 23.0625 24.9875 26.237500000000004 25.7125 32-33 21.987499999999997 26.125 26.05 25.837500000000002 34-35 22.0625 26.174999999999997 25.912499999999998 25.85 36-37 21.9 25.137500000000003 26.974999999999998 25.9875 38-39 22.575 26.150000000000002 26.0 25.275 40-41 22.225 26.375 26.1125 25.2875 42-43 22.15 26.6 25.387500000000003 25.8625 44-45 22.125 25.575 26.1125 26.187500000000004 46-47 22.35 26.487500000000004 26.0 25.162499999999998 48-49 22.5125 26.450000000000003 25.55 25.4875 50-51 22.25 25.5375 26.887499999999996 25.324999999999996 52-53 23.25 25.974999999999998 25.0625 25.7125 54-55 22.162499999999998 25.424999999999997 26.1125 26.3 56-57 22.537499999999998 26.424999999999997 26.487500000000004 24.55 58-59 23.1625 25.7375 25.6 25.5 60-61 22.5125 25.35 25.7 26.437500000000004 62-63 23.175 26.187500000000004 24.85 25.7875 64-65 22.0125 26.4625 25.5375 25.9875 66-67 22.5125 25.912499999999998 26.4125 25.162499999999998 68-69 23.35 26.375 25.45 24.825 70-71 23.3625 26.0 25.087500000000002 25.55 72-73 23.225 24.712500000000002 25.9625 26.1 74-75 23.5 25.637500000000003 25.662499999999998 25.2 76 23.674999999999997 25.525 25.650000000000002 25.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.0 26 2.5 27 3.0 28 7.0 29 12.0 30 11.0 31 15.5 32 28.5 33 36.0 34 37.5 35 59.0 36 91.0 37 103.0 38 112.5 39 145.0 40 197.5 41 229.5 42 232.0 43 250.0 44 272.5 45 269.5 46 262.0 47 251.0 48 242.0 49 234.5 50 225.0 51 215.5 52 199.5 53 178.0 54 163.0 55 153.5 56 137.0 57 122.0 58 114.0 59 101.5 60 87.5 61 77.5 62 69.0 63 65.0 64 54.5 65 40.5 66 28.0 67 23.0 68 22.0 69 15.5 70 10.5 71 11.0 72 9.0 73 7.5 74 6.5 75 5.0 76 4.5 77 2.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 76 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.7317688619732526 1.4500000000000002 3 0.10093363613424174 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 57 0.1 0.0 0.0 0.0 0.0 58 0.1 0.0 0.0 0.0 0.0 59 0.1 0.0 0.0 0.0 0.0 60 0.15 0.0 0.0 0.0 0.0 61 0.175 0.0 0.0 0.0 0.0 62 0.175 0.0 0.0 0.0 0.0 63 0.175 0.0 0.0 0.0 0.0 64 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982415 READS because READLEN < 1 Read 1982415 spots for SRR8742304.sra Written 1982415 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra Rejected 1982408 READS because READLEN < 1 Read 1982408 spots for SRR8742304.sra Written 1982408 spots for SRR8742304.sra SRR ids: ['SRR8742304.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_12s2flzm SRR8742304.sra spots: 39648167 blocks: [[1, 1982408], [1982409, 3964816], [3964817, 5947224], [5947225, 7929632], [7929633, 9912040], [9912041, 11894448], [11894449, 13876856], [13876857, 15859264], [15859265, 17841672], [17841673, 19824080], [19824081, 21806488], [21806489, 23788896], [23788897, 25771304], [25771305, 27753712], [27753713, 29736120], [29736121, 31718528], [31718529, 33700936], [33700937, 35683344], [35683345, 37665752], [37665753, 39648167]] SRR8742304 file size 7567206 SRR8742304 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8742304 SRR8742304_1.fastq Input file: SRR8742304_1.fastq trimmed: SRR8742304-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:32:40 2024 >> started Sat Dec 7 11:32:58 2024 >> done (18.460s) 39648167 reads processed; of these: 639 ( 0.00%) short reads filtered out after trimming by size control 13646 ( 0.03%) empty reads filtered out after trimming by size control 39633882 (99.96%) reads available; of these: 9762 ( 0.02%) trimmed reads available after processing 39624120 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 13 0.00% 20 11 0.00% 21 15 0.00% 22 18 0.00% 23 31 0.00% 24 42 0.00% 25 58 0.00% 26 77 0.00% 27 101 0.00% 28 142 0.00% 29 173 0.00% 30 220 0.00% 31 228 0.00% 32 324 0.00% 33 341 0.00% 34 371 0.00% 35 419 0.00% 36 440 0.00% 37 502 0.00% 38 595 0.00% 39 661 0.00% 40 801 0.00% 41 877 0.00% 42 1032 0.00% 43 1097 0.00% 44 1156 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 1 0.00% 76 39624120 99.98% 39633882 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=21 prefix-density=0.39 prefix-fanout=2.1 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=45.69 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.1 sequence=CAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAA Started job on | Dec 07 11:33:11 Started mapping on | Dec 07 11:33:13 Finished on | Dec 07 11:33:36 Mapping speed, Million of reads per hour | 6203.56 Number of input reads | 39633882 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 38358381 Uniquely mapped reads % | 96.78% Average mapped length | 75.76 Number of splices: Total | 9885541 Number of splices: Annotated (sjdb) | 9514896 Number of splices: GT/AG | 9750826 Number of splices: GC/AG | 122189 Number of splices: AT/AC | 5710 Number of splices: Non-canonical | 6816 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 808616 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 324558 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.32% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 466885 466885 466885 N_multimapping 808616 808616 808616 N_noFeature 1198019 37493529 1382104 N_ambiguous 735403 3120 55939 UnstrandedReadsAssigned:36424959 PositiveStrandReadsAssigned:861732 NegativeStrandReadsAssigned:36920338 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=76 echo kmer=71 SRR8742304 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8742304-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,633,882 reads, 37,271,433 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,274 rounds 52973 SRR8742304.ke.tsv 35125 SRR8742304.se.tsv 88098 total ==> SRR8742304.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 218.996 11.4681 PNS24247 1044 945 62.8626 2.91569 PNS24249 1928 1829 40.0252 0.959181 PNS24246 1044 945 62.8626 2.91569 PNS24248 1044 945 62.8626 2.91569 PNS24244 1471 1372 240.391 7.67972 PNS24243 293 194 0 0 KQK14069 1603 1504 5176.8 150.867 KQK14071 474 375 142.804 16.6914 ==> SRR8742304.se.tsv <== BRADI_1g14170v3 5532 BRADI_1g53295v3 89 BRADI_1g59795v3 499 BRADI_1g07683v3 0 BRADI_1g00485v3 196 BRADI_1g20270v3 6171 BRADI_1g74790v3 439 BRADI_1g09890v3 4 BRADI_1g77505v3 689 BRADI_1g48960v3 1 SRR8742304 completed mapping pipeline successfully