Starting /dee2/code/volunteer_pipeline.sh SRR8846489 current disk space = 1502672920576 free memory = 1382453936 SRR8846489 SRAfilesize 5d68c110324b4054315b7d35d94068f7 SRR8846489.sra SRR8846489.sra file validated SRR8846489 is paired end SRR8846489 is conventional basespace SRR8846489 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846489_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.58775 25.0 18.0 32.0 18.0 33.0 2 29.20725 31.0 27.0 33.0 25.0 33.0 3 31.8025 33.0 32.0 33.0 28.0 33.0 4 32.19275 33.0 33.0 33.0 31.0 34.0 5 32.299 33.0 33.0 33.0 31.0 34.0 6 36.824 38.0 37.0 38.0 35.0 38.0 7 37.0805 38.0 38.0 38.0 35.0 38.0 8 37.0605 38.0 38.0 38.0 36.0 38.0 9 37.37925 38.0 38.0 38.0 37.0 38.0 10-14 37.320800000000006 38.0 38.0 38.0 36.8 38.0 15-19 37.272149999999996 38.0 38.0 38.0 36.6 38.0 20-24 37.27595 38.0 38.0 38.0 36.8 38.0 25-29 37.4089 38.0 38.0 38.0 37.0 38.0 30-34 37.40755 38.0 38.0 38.0 37.0 38.0 35-39 37.262800000000006 38.0 38.0 38.0 36.6 38.0 40-44 37.0172 38.0 38.0 38.0 35.6 38.0 45-49 36.9034 38.0 38.0 38.0 35.2 38.0 50-54 37.08015 38.0 38.0 38.0 35.8 38.0 55-59 36.8832 38.0 38.0 38.0 34.8 38.0 60-64 36.7366 38.0 38.0 38.0 34.2 38.0 65-69 36.6071 38.0 38.0 38.0 34.0 38.0 70-74 36.49325 38.0 37.4 38.0 34.0 38.0 75-79 36.42135 38.0 37.2 38.0 33.8 38.0 80-84 36.18105 38.0 37.0 38.0 33.0 38.0 85-89 35.9525 38.0 36.8 38.0 31.8 38.0 90-94 35.3861 38.0 36.0 38.0 29.4 38.0 95-99 35.4519 38.0 36.0 38.0 29.4 38.0 100-104 35.43455 38.0 35.8 38.0 29.6 38.0 105-109 35.167199999999994 38.0 35.2 38.0 28.8 38.0 110-114 34.262750000000004 38.0 34.2 38.0 24.2 38.0 115-119 33.58390000000001 37.4 33.6 38.0 21.4 38.0 120-124 33.6705 38.0 33.8 38.0 22.6 38.0 125-129 33.24485 37.0 32.8 38.0 20.2 38.0 130-134 32.425 36.0 31.4 38.0 15.0 38.0 135-139 31.3565 35.0 28.6 38.0 14.0 38.0 140-144 30.51465 35.0 27.4 38.0 13.8 38.0 145-149 28.878449999999997 33.8 24.2 38.0 6.4 38.0 150-151 23.972875000000002 30.5 8.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 5.0 19 1.0 20 4.0 21 0.0 22 8.0 23 8.0 24 13.0 25 17.0 26 31.0 27 40.0 28 41.0 29 64.0 30 93.0 31 131.0 32 188.0 33 247.0 34 421.0 35 727.0 36 1161.0 37 798.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.46406570841889 19.738193018480494 8.367556468172484 44.43018480492813 2 22.025 20.875 35.05 22.05 3 18.625 28.849999999999998 25.15 27.375 4 24.975 31.45 22.475 21.099999999999998 5 24.23711855927964 33.41670835417709 23.186593296648326 19.15957978989495 6 18.675 34.375 24.025 22.925 7 15.775 19.775000000000002 42.95 21.5 8 19.575 21.125 29.075 30.225 9 17.349999999999998 21.525 31.924999999999997 29.2 10-14 22.205 26.58 24.93 26.284999999999997 15-19 21.825 26.575 26.484999999999996 25.115 20-24 21.52 27.215 26.240000000000002 25.025 25-29 22.105 27.075 26.38 24.44 30-34 21.185000000000002 27.084999999999997 26.99 24.740000000000002 35-39 21.57 26.889999999999997 26.56 24.98 40-44 22.0 26.884999999999998 26.395000000000003 24.72 45-49 21.945 27.005000000000003 26.155 24.895 50-54 22.15 26.290000000000003 26.729999999999997 24.83 55-59 22.1 26.840000000000003 26.150000000000002 24.91 60-64 22.03 26.93 26.545 24.495 65-69 21.85 26.590000000000003 26.345000000000002 25.215 70-74 22.075 26.815 26.495 24.615000000000002 75-79 22.220000000000002 26.605 26.045 25.130000000000003 80-84 22.365 26.86 25.655 25.119999999999997 85-89 22.75 26.525 26.22 24.505 90-94 22.814999999999998 26.13 26.16 24.895 95-99 23.155 26.474999999999998 26.345000000000002 24.025 100-104 23.03 26.575 25.635 24.759999999999998 105-109 22.400000000000002 26.36 26.57 24.67 110-114 22.82 26.075 26.565 24.54 115-119 22.67 26.27 25.715 25.345000000000002 120-124 22.985 25.740000000000002 26.005 25.27 125-129 22.855 26.534999999999997 26.169999999999998 24.44 130-134 22.759999999999998 26.57 26.135 24.535 135-139 22.525000000000002 25.52 26.695 25.259999999999998 140-144 23.24 26.245 26.07 24.445 145-149 22.81 26.150000000000002 26.39 24.65 150-151 22.5125 25.8 26.437500000000004 25.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 3.0 27 5.5 28 9.0 29 12.5 30 15.5 31 18.5 32 27.5 33 35.0 34 39.0 35 52.5 36 63.5 37 84.0 38 107.0 39 135.5 40 168.5 41 164.0 42 181.0 43 230.5 44 238.5 45 225.5 46 222.5 47 202.5 48 189.5 49 183.5 50 160.5 51 146.0 52 129.0 53 105.0 54 83.5 55 78.0 56 80.5 57 74.0 58 63.5 59 54.5 60 52.5 61 42.0 62 37.0 63 38.0 64 40.5 65 39.0 66 28.0 67 25.0 68 23.0 69 21.0 70 18.0 71 13.5 72 9.0 73 4.0 74 4.0 75 4.5 76 3.0 77 2.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.35167043456417985 0.7000000000000001 3 0.025119316754584273 0.075 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8374999999999999 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.625 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.45 0.0 0.0 0.0 0.0 138-139 2.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATCTC 10 0.006832588 144.9875 2 CTGTTCA 10 0.006832588 144.9875 6 >>END_MODULE SRR8846489 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846489_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79675 33.0 33.0 34.0 32.0 34.0 2 32.84275 33.0 33.0 34.0 32.0 34.0 3 32.63325 33.0 33.0 34.0 31.0 34.0 4 32.84925 34.0 33.0 34.0 32.0 34.0 5 32.81425 34.0 33.0 34.0 32.0 34.0 6 37.03225 38.0 38.0 38.0 36.0 38.0 7 37.053 38.0 38.0 38.0 36.0 38.0 8 37.1365 38.0 38.0 38.0 37.0 38.0 9 37.064 38.0 38.0 38.0 36.0 38.0 10-14 37.0484 38.0 38.0 38.0 36.2 38.0 15-19 37.018649999999994 38.0 38.0 38.0 36.2 38.0 20-24 36.95235 38.0 38.0 38.0 36.0 38.0 25-29 36.976150000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.894549999999995 38.0 38.0 38.0 35.6 38.0 35-39 36.760850000000005 38.0 38.0 38.0 35.4 38.0 40-44 36.78415 38.0 38.0 38.0 35.8 38.0 45-49 36.68925 38.0 38.0 38.0 35.2 38.0 50-54 36.5628 38.0 38.0 38.0 34.4 38.0 55-59 36.32185 38.0 38.0 38.0 33.6 38.0 60-64 36.460699999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.50975 38.0 38.0 38.0 34.0 38.0 70-74 36.4018 38.0 38.0 38.0 34.0 38.0 75-79 36.048199999999994 38.0 37.2 38.0 32.8 38.0 80-84 36.022850000000005 38.0 37.0 38.0 32.8 38.0 85-89 35.87875 38.0 37.0 38.0 32.4 38.0 90-94 35.721199999999996 38.0 36.8 38.0 31.4 38.0 95-99 35.4217 38.0 36.0 38.0 29.6 38.0 100-104 35.1421 38.0 35.8 38.0 28.4 38.0 105-109 34.8145 38.0 35.0 38.0 27.4 38.0 110-114 34.3414 38.0 34.4 38.0 24.6 38.0 115-119 33.93765 38.0 34.0 38.0 22.6 38.0 120-124 33.46554999999999 38.0 34.0 38.0 20.2 38.0 125-129 32.66224999999999 37.0 32.0 38.0 16.2 38.0 130-134 32.25935 36.2 31.4 38.0 14.8 38.0 135-139 31.00505 35.6 29.2 38.0 13.2 38.0 140-144 30.03435 34.6 27.6 38.0 12.4 38.0 145-149 28.315350000000002 33.2 23.6 38.0 3.8 38.0 150-151 20.87325 25.5 2.0 34.5 2.0 37.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 0.0 14 1.0 15 4.0 16 5.0 17 4.0 18 6.0 19 7.0 20 10.0 21 13.0 22 16.0 23 17.0 24 23.0 25 19.0 26 26.0 27 38.0 28 44.0 29 57.0 30 93.0 31 111.0 32 142.0 33 215.0 34 353.0 35 644.0 36 1130.0 37 1003.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.5 14.424999999999999 12.55 36.525 2 28.7 18.975 32.875 19.45 3 21.25 23.125 30.4 25.224999999999998 4 26.474999999999998 32.6 19.55 21.375 5 27.250000000000004 33.85 19.225 19.675 6 20.8 34.575 21.8 22.825 7 20.175 15.6 40.125 24.099999999999998 8 22.6 20.974999999999998 25.974999999999998 30.45 9 22.650000000000002 22.225 26.5 28.625 10-14 25.745 25.09 23.549999999999997 25.615 15-19 25.22 25.624999999999996 24.63 24.525 20-24 25.09 26.25 24.985 23.674999999999997 25-29 25.46 25.53 25.145 23.865 30-34 25.365 25.91 25.28 23.445 35-39 25.155 25.935000000000002 25.3 23.61 40-44 25.365 25.669999999999998 25.009999999999998 23.955000000000002 45-49 25.064999999999998 26.009999999999998 25.06 23.865 50-54 24.87 26.145000000000003 25.335 23.65 55-59 25.09 25.96 25.130000000000003 23.82 60-64 25.31 25.545 25.4 23.745 65-69 25.145 26.13 25.465 23.26 70-74 25.365 26.0 25.330000000000002 23.305 75-79 25.264999999999997 26.36 25.35 23.025000000000002 80-84 25.46 25.8 25.685000000000002 23.055 85-89 25.679999999999996 26.155 25.155 23.01 90-94 24.615000000000002 26.57 25.474999999999998 23.34 95-99 25.455 25.895000000000003 25.55 23.1 100-104 25.41 25.56 26.009999999999998 23.02 105-109 24.955 26.14 25.765 23.14 110-114 24.884999999999998 25.575 26.21 23.330000000000002 115-119 25.11 26.384999999999998 25.39 23.115 120-124 24.505 26.35 25.924999999999997 23.22 125-129 24.959999999999997 26.015 26.340000000000003 22.685 130-134 25.485000000000003 26.085 25.85 22.58 135-139 25.64 26.19 25.814999999999998 22.355 140-144 25.83 26.605 25.695 21.87 145-149 25.495 25.97 26.245 22.29 150-151 25.887500000000003 25.5375 26.325 22.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.0 24 0.0 25 1.0 26 3.0 27 3.5 28 3.5 29 6.5 30 11.5 31 16.5 32 20.5 33 26.5 34 29.5 35 35.5 36 46.0 37 62.0 38 77.5 39 97.5 40 122.0 41 137.0 42 161.0 43 192.5 44 214.5 45 214.0 46 212.0 47 201.0 48 184.5 49 185.5 50 164.5 51 136.5 52 134.5 53 120.0 54 98.0 55 98.0 56 86.5 57 76.0 58 87.0 59 87.0 60 77.5 61 71.5 62 67.5 63 60.0 64 49.5 65 42.5 66 47.5 67 45.0 68 38.0 69 35.5 70 24.0 71 22.5 72 23.0 73 17.0 74 9.5 75 5.5 76 4.5 77 1.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.5039052658100277 1.0 3 0.10078105316200556 0.3 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.425 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.7625000000000002 0.0 0.0 0.0 0.0 132-133 1.9749999999999999 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCTCC 10 0.006830828 145.0 5 >>END_MODULE Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015310 spots for SRR8846489.sra Written 1015310 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra Read 1015305 spots for SRR8846489.sra Written 1015305 spots for SRR8846489.sra SRR ids: ['SRR8846489.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gw3855b3 SRR8846489.sra spots: 20306105 blocks: [[1, 1015305], [1015306, 2030610], [2030611, 3045915], [3045916, 4061220], [4061221, 5076525], [5076526, 6091830], [6091831, 7107135], [7107136, 8122440], [8122441, 9137745], [9137746, 10153050], [10153051, 11168355], [11168356, 12183660], [12183661, 13198965], [13198966, 14214270], [14214271, 15229575], [15229576, 16244880], [16244881, 17260185], [17260186, 18275490], [18275491, 19290795], [19290796, 20306105]] SRR8846489 file size 6859372 SRR8846489 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846489 SRR8846489_1.fastq SRR8846489_2.fastq Input file: SRR8846489_1.fastq Paired file: SRR8846489_2.fastq trimmed: SRR8846489-trimmed-pair1.fastq, SRR8846489-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Dec 8 19:57:44 2024 >> started Sun Dec 8 20:00:16 2024 >> done (152.004s) 20306105 read pairs processed; of these: 13164 ( 0.06%) short read pairs filtered out after trimming by size control 10212 ( 0.05%) empty read pairs filtered out after trimming by size control 20282729 (99.88%) read pairs available; of these: 11461242 (56.51%) trimmed read pairs available after processing 8821487 (43.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 6 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 12 0.00% 25 9 0.00% 26 6 0.00% 27 6 0.00% 28 12 0.00% 29 8 0.00% 30 6 0.00% 31 4 0.00% 32 3 0.00% 33 10 0.00% 34 10 0.00% 35 5 0.00% 36 12 0.00% 37 10 0.00% 38 13 0.00% 39 16 0.00% 40 13 0.00% 41 8 0.00% 42 17 0.00% 43 14 0.00% 44 13 0.00% 45 18 0.00% 46 24 0.00% 47 19 0.00% 48 20 0.00% 49 26 0.00% 50 30 0.00% 51 34 0.00% 52 33 0.00% 53 49 0.00% 54 35 0.00% 55 57 0.00% 56 49 0.00% 57 67 0.00% 58 71 0.00% 59 82 0.00% 60 78 0.00% 61 103 0.00% 62 109 0.00% 63 119 0.00% 64 133 0.00% 65 140 0.00% 66 168 0.00% 67 194 0.00% 68 182 0.00% 69 219 0.00% 70 253 0.00% 71 295 0.00% 72 328 0.00% 73 349 0.00% 74 408 0.00% 75 487 0.00% 76 520 0.00% 77 576 0.00% 78 613 0.00% 79 705 0.00% 80 783 0.00% 81 935 0.00% 82 968 0.00% 83 1156 0.01% 84 1810 0.01% 85 2208 0.01% 86 2194 0.01% 87 2376 0.01% 88 2480 0.01% 89 2631 0.01% 90 2770 0.01% 91 3072 0.02% 92 3226 0.02% 93 3534 0.02% 94 3832 0.02% 95 4052 0.02% 96 4313 0.02% 97 4916 0.02% 98 5278 0.03% 99 5600 0.03% 100 6026 0.03% 101 6440 0.03% 102 7075 0.03% 103 7482 0.04% 104 8135 0.04% 105 8691 0.04% 106 9491 0.05% 107 10185 0.05% 108 10971 0.05% 109 11880 0.06% 110 12517 0.06% 111 13484 0.07% 112 14628 0.07% 113 15578 0.08% 114 16442 0.08% 115 17726 0.09% 116 19011 0.09% 117 19990 0.10% 118 21288 0.10% 119 23059 0.11% 120 24182 0.12% 121 25892 0.13% 122 27651 0.14% 123 29332 0.14% 124 31393 0.15% 125 33345 0.16% 126 35585 0.18% 127 38533 0.19% 128 40678 0.20% 129 43953 0.22% 130 47620 0.23% 131 51107 0.25% 132 55142 0.27% 133 60344 0.30% 134 65579 0.32% 135 71664 0.35% 136 78756 0.39% 137 87236 0.43% 138 96048 0.47% 139 107867 0.53% 140 122182 0.60% 141 138510 0.68% 142 162083 0.80% 143 192062 0.95% 144 232873 1.15% 145 294227 1.45% 146 393171 1.94% 147 554720 2.73% 148 814505 4.02% 149 1508007 7.43% 150 5671937 27.96% 151 8821487 43.49% 20282729 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=8.86 fanout-score-rank=10 prefix-density=0.78 prefix-fanout=2.0 sequence=TCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=38.80 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=12.4 sequence=CCTTGATCTTCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=36 prefix-density=0.34 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=600.53 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=20.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846489 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 08 20:04:39 Started mapping on | Dec 08 20:04:40 Finished on | Dec 08 20:23:38 Mapping speed, Million of reads per hour | 64.16 Number of input reads | 20282729 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19718857 Uniquely mapped reads % | 97.22% Average mapped length | 296.23 Number of splices: Total | 22683280 Number of splices: Annotated (sjdb) | 21385469 Number of splices: GT/AG | 22391947 Number of splices: GC/AG | 262951 Number of splices: AT/AC | 11833 Number of splices: Non-canonical | 16549 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 163880 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 12381 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.56% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 408718 408718 408718 N_multimapping 163880 163880 163880 N_noFeature 832273 19196447 979501 N_ambiguous 436667 2790 62280 UnstrandedReadsAssigned:18449917 PositiveStrandReadsAssigned:519620 NegativeStrandReadsAssigned:18677076 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846489 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846489-trimmed-pair1.fastq SRR8846489-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,282,729 reads, 18,726,694 reads pseudoaligned [quant] estimated average fragment length: 275.674 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52973 SRR8846489.ke.tsv 35125 SRR8846489.se.tsv 88098 total ==> SRR8846489.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.785 0 0 PNS24247 1044 769.326 77.1083 7.81915 PNS24249 1928 1653.33 36.1713 1.70677 PNS24246 1044 769.326 77.1083 7.81915 PNS24248 1044 769.326 77.1083 7.81915 PNS24244 1471 1196.33 78.5037 5.11929 PNS24243 293 78.5028 0 0 KQK14069 1603 1328.33 3241.5 190.375 KQK14071 474 216.286 104.728 37.7749 ==> SRR8846489.se.tsv <== BRADI_1g14170v3 4784 BRADI_1g53295v3 65 BRADI_1g59795v3 345 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 2726 BRADI_1g74790v3 115 BRADI_1g09890v3 0 BRADI_1g77505v3 302 BRADI_1g48960v3 0 SRR8846489 completed mapping pipeline successfully