Starting /dee2/code/volunteer_pipeline.sh SRR8846490 current disk space = 1502363414528 free memory = 1361711872 SRR8846490 SRAfilesize b00499b6dd7a2b7a74205b402c8eb35c SRR8846490.sra SRR8846490.sra file validated SRR8846490 is paired end SRR8846490 is conventional basespace SRR8846490 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846490_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.28475 25.0 18.0 32.0 18.0 33.0 2 28.876 30.0 27.0 33.0 18.0 33.0 3 31.81425 33.0 32.0 33.0 28.0 33.0 4 32.24825 33.0 33.0 33.0 30.0 34.0 5 32.207 33.0 32.0 33.0 31.0 34.0 6 36.94525 38.0 37.0 38.0 35.0 38.0 7 37.26875 38.0 38.0 38.0 36.0 38.0 8 37.30375 38.0 38.0 38.0 36.0 38.0 9 37.5205 38.0 38.0 38.0 37.0 38.0 10-14 37.422 38.0 38.0 38.0 37.0 38.0 15-19 37.30395 38.0 38.0 38.0 37.0 38.0 20-24 37.326499999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.39385 38.0 38.0 38.0 37.0 38.0 30-34 37.4189 38.0 38.0 38.0 37.0 38.0 35-39 37.33805 38.0 38.0 38.0 36.8 38.0 40-44 37.113 38.0 38.0 38.0 36.0 38.0 45-49 37.0269 38.0 38.0 38.0 35.6 38.0 50-54 37.1192 38.0 38.0 38.0 36.0 38.0 55-59 37.028600000000004 38.0 38.0 38.0 35.6 38.0 60-64 36.898849999999996 38.0 38.0 38.0 35.2 38.0 65-69 36.763799999999996 38.0 38.0 38.0 34.6 38.0 70-74 36.665000000000006 38.0 38.0 38.0 34.2 38.0 75-79 36.54575 38.0 37.8 38.0 34.0 38.0 80-84 36.4054 38.0 37.0 38.0 33.6 38.0 85-89 36.0653 38.0 36.8 38.0 32.4 38.0 90-94 35.716300000000004 38.0 36.4 38.0 30.4 38.0 95-99 35.6553 38.0 36.0 38.0 30.8 38.0 100-104 35.5952 38.0 36.0 38.0 30.6 38.0 105-109 35.357549999999996 38.0 35.6 38.0 29.2 38.0 110-114 34.5548 38.0 34.4 38.0 26.0 38.0 115-119 33.98625 38.0 34.0 38.0 23.0 38.0 120-124 33.928399999999996 38.0 34.0 38.0 23.2 38.0 125-129 33.5215 37.2 33.4 38.0 20.6 38.0 130-134 32.902550000000005 36.8 32.2 38.0 17.4 38.0 135-139 31.7551 35.6 30.6 38.0 14.2 38.0 140-144 30.972749999999998 35.0 28.2 38.0 14.0 38.0 145-149 29.535649999999997 33.8 26.2 38.0 8.6 38.0 150-151 24.548125 31.0 13.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 0.0 18 1.0 19 1.0 20 3.0 21 4.0 22 6.0 23 4.0 24 5.0 25 20.0 26 26.0 27 29.0 28 44.0 29 60.0 30 74.0 31 105.0 32 178.0 33 243.0 34 386.0 35 674.0 36 1264.0 37 869.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.100616016427107 22.715605749486652 7.802874743326489 46.380903490759756 2 23.325000000000003 20.575 33.5 22.6 3 19.45 30.075000000000003 24.325 26.150000000000002 4 24.3 33.4 20.525 21.775 5 24.099999999999998 33.7 22.375 19.825 6 19.775000000000002 35.175 23.325000000000003 21.725 7 14.674999999999999 19.875 42.775 22.675 8 20.05 19.55 28.000000000000004 32.4 9 19.5 19.575 31.75 29.175 10-14 22.564999999999998 26.3 24.25 26.884999999999998 15-19 22.445 26.595000000000002 25.915 25.045 20-24 22.009999999999998 26.955000000000002 25.89 25.145 25-29 21.915000000000003 26.674999999999997 25.835 25.575 30-34 22.275 26.915 25.895000000000003 24.915000000000003 35-39 22.105 26.665 26.245 24.985 40-44 22.405 26.165 26.665 24.765 45-49 22.36 26.384999999999998 26.255 25.0 50-54 21.975 26.82 25.895000000000003 25.31 55-59 22.0 25.995 26.605 25.4 60-64 22.07 26.490000000000002 26.275 25.165 65-69 22.564999999999998 26.575 26.215 24.645 70-74 22.845 25.635 26.14 25.380000000000003 75-79 22.855 26.05 25.869999999999997 25.224999999999998 80-84 22.425 26.314999999999998 26.179999999999996 25.080000000000002 85-89 22.689999999999998 26.055 26.77 24.485 90-94 22.57 25.945 26.424999999999997 25.06 95-99 22.259999999999998 26.27 26.575 24.895 100-104 22.955000000000002 26.340000000000003 26.365 24.34 105-109 22.39 26.35 25.814999999999998 25.445 110-114 23.064999999999998 26.5 25.825 24.610000000000003 115-119 23.115 26.32 26.19 24.375 120-124 22.41 26.484999999999996 25.81 25.295 125-129 23.005 26.55 25.695 24.75 130-134 22.689999999999998 26.575 25.615 25.119999999999997 135-139 23.369999999999997 25.53 25.85 25.25 140-144 23.22 26.05 25.955000000000002 24.775 145-149 23.115 26.314999999999998 25.505 25.064999999999998 150-151 22.825 25.137500000000003 26.0625 25.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 1.0 28 2.5 29 6.5 30 8.5 31 12.0 32 18.0 33 22.0 34 31.5 35 50.5 36 68.0 37 78.5 38 101.0 39 121.5 40 149.0 41 177.0 42 203.0 43 236.5 44 237.0 45 228.0 46 223.0 47 206.0 48 201.5 49 186.0 50 158.5 51 134.5 52 121.0 53 113.0 54 94.0 55 85.0 56 77.0 57 64.5 58 57.0 59 66.5 60 61.5 61 45.0 62 37.5 63 40.5 64 46.5 65 38.5 66 39.0 67 34.5 68 25.0 69 21.0 70 19.5 71 15.5 72 8.0 73 9.0 74 5.5 75 2.0 76 3.0 77 2.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.7374999999999998 0.0 0.0 0.0 0.0 116-117 1.8875000000000002 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.362500000000001 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.95 0.0 0.0 0.0 0.0 136-137 6.5625 0.0 0.0 0.0 0.0 138-139 7.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8846490 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846490_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8505 33.0 33.0 34.0 32.0 34.0 2 32.887 34.0 33.0 34.0 32.0 34.0 3 32.62875 33.0 33.0 34.0 32.0 34.0 4 32.806 34.0 33.0 34.0 32.0 34.0 5 32.847 34.0 33.0 34.0 32.0 34.0 6 37.08825 38.0 38.0 38.0 36.0 38.0 7 37.116 38.0 38.0 38.0 36.0 38.0 8 37.16075 38.0 38.0 38.0 37.0 38.0 9 37.094 38.0 38.0 38.0 36.0 38.0 10-14 37.11535 38.0 38.0 38.0 36.4 38.0 15-19 37.11045 38.0 38.0 38.0 36.4 38.0 20-24 37.057900000000004 38.0 38.0 38.0 36.2 38.0 25-29 37.0407 38.0 38.0 38.0 36.4 38.0 30-34 36.95635 38.0 38.0 38.0 36.0 38.0 35-39 36.830349999999996 38.0 38.0 38.0 35.6 38.0 40-44 36.83045 38.0 38.0 38.0 35.8 38.0 45-49 36.876850000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.649 38.0 38.0 38.0 34.8 38.0 55-59 36.46035 38.0 38.0 38.0 33.8 38.0 60-64 36.55685 38.0 38.0 38.0 34.4 38.0 65-69 36.58635 38.0 38.0 38.0 34.2 38.0 70-74 36.4433 38.0 38.0 38.0 34.2 38.0 75-79 36.1942 38.0 37.4 38.0 33.2 38.0 80-84 36.16455 38.0 37.4 38.0 33.2 38.0 85-89 35.9761 38.0 37.0 38.0 32.6 38.0 90-94 35.82055 38.0 37.0 38.0 31.8 38.0 95-99 35.50215 38.0 36.2 38.0 30.6 38.0 100-104 35.2178 38.0 36.0 38.0 29.0 38.0 105-109 34.927200000000006 38.0 35.4 38.0 27.8 38.0 110-114 34.529700000000005 38.0 34.6 38.0 25.8 38.0 115-119 34.18985 38.0 34.2 38.0 23.8 38.0 120-124 33.64605 38.0 33.8 38.0 20.6 38.0 125-129 32.99245 37.4 33.0 38.0 17.4 38.0 130-134 32.6074 36.8 31.6 38.0 16.2 38.0 135-139 31.337699999999995 35.8 30.6 38.0 13.6 38.0 140-144 30.281799999999997 35.2 28.2 38.0 12.4 38.0 145-149 28.42715 34.0 24.6 38.0 2.0 38.0 150-151 21.020375 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 2.0 5 0.0 6 1.0 7 0.0 8 2.0 9 1.0 10 0.0 11 1.0 12 2.0 13 3.0 14 2.0 15 2.0 16 2.0 17 2.0 18 9.0 19 4.0 20 8.0 21 7.0 22 12.0 23 12.0 24 16.0 25 30.0 26 27.0 27 35.0 28 58.0 29 63.0 30 72.0 31 118.0 32 167.0 33 200.0 34 307.0 35 534.0 36 1151.0 37 1140.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.075 12.625 15.299999999999999 38.0 2 29.875 18.6 33.275 18.25 3 21.2 23.575 29.825000000000003 25.4 4 26.75 32.225 17.95 23.075000000000003 5 26.924999999999997 34.4 19.05 19.625 6 20.974999999999998 35.025 20.7 23.3 7 19.725 14.95 40.775 24.55 8 22.525000000000002 20.225 25.2 32.05 9 22.625 22.825 25.874999999999996 28.675 10-14 25.665 25.03 23.805 25.5 15-19 25.290000000000003 25.195 25.509999999999998 24.005000000000003 20-24 25.124999999999996 26.32 25.014999999999997 23.54 25-29 25.19 25.845000000000002 25.135 23.830000000000002 30-34 24.805 26.224999999999998 25.15 23.82 35-39 25.27 26.200000000000003 25.185000000000002 23.345 40-44 25.624999999999996 26.375 24.83 23.169999999999998 45-49 25.650000000000002 25.835 25.615 22.900000000000002 50-54 25.430000000000003 25.919999999999998 25.035 23.615 55-59 25.740000000000002 26.165 24.88 23.215 60-64 25.045 25.915 25.91 23.13 65-69 24.745 26.345000000000002 25.929999999999996 22.98 70-74 25.835 26.155 25.235000000000003 22.775000000000002 75-79 24.685000000000002 26.25 25.995 23.07 80-84 25.31 26.090000000000003 25.650000000000002 22.95 85-89 25.564999999999998 25.705 25.509999999999998 23.22 90-94 25.915 25.995 25.590000000000003 22.5 95-99 25.14 26.26 25.72 22.88 100-104 25.525 25.72 25.595000000000002 23.16 105-109 25.215 26.14 25.779999999999998 22.865 110-114 25.305 25.785000000000004 25.615 23.294999999999998 115-119 26.395000000000003 25.735000000000003 26.115 21.755 120-124 25.765 25.945 25.865 22.425 125-129 25.790000000000003 26.284999999999997 25.805 22.12 130-134 26.290000000000003 26.334999999999997 25.495 21.88 135-139 26.474999999999998 26.105 25.66 21.759999999999998 140-144 26.825 26.195 25.335 21.645 145-149 26.825 26.8 24.834999999999997 21.54 150-151 26.275 27.025 25.837500000000002 20.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 4.0 28 6.0 29 5.0 30 7.0 31 13.0 32 17.0 33 21.0 34 27.0 35 44.5 36 53.5 37 62.0 38 89.0 39 109.0 40 129.0 41 146.0 42 163.5 43 192.0 44 204.0 45 199.5 46 217.0 47 212.5 48 190.0 49 186.5 50 160.0 51 138.5 52 140.5 53 126.0 54 107.0 55 89.5 56 77.0 57 73.5 58 79.0 59 80.0 60 68.0 61 70.5 62 69.0 63 55.5 64 57.5 65 59.0 66 44.5 67 39.0 68 37.5 69 35.5 70 28.0 71 19.5 72 17.0 73 11.0 74 5.0 75 3.5 76 2.5 77 1.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.4021110831867303 0.8 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.7625000000000002 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.3499999999999996 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 4.075 0.0 0.0 0.0 0.0 128-129 4.4125 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.4625 0.0 0.0 0.0 0.0 134-135 5.949999999999999 0.0 0.0 0.0 0.0 136-137 6.5125 0.0 0.0 0.0 0.0 138-139 7.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAAATC 10 0.006830828 145.0 2 >>END_MODULE Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944491 spots for SRR8846490.sra Written 944491 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra Read 944477 spots for SRR8846490.sra Written 944477 spots for SRR8846490.sra SRR ids: ['SRR8846490.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ea787v9o SRR8846490.sra spots: 18889554 blocks: [[1, 944477], [944478, 1888954], [1888955, 2833431], [2833432, 3777908], [3777909, 4722385], [4722386, 5666862], [5666863, 6611339], [6611340, 7555816], [7555817, 8500293], [8500294, 9444770], [9444771, 10389247], [10389248, 11333724], [11333725, 12278201], [12278202, 13222678], [13222679, 14167155], [14167156, 15111632], [15111633, 16056109], [16056110, 17000586], [17000587, 17945063], [17945064, 18889554]] SRR8846490 file size 6379349 SRR8846490 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846490 SRR8846490_1.fastq SRR8846490_2.fastq Input file: SRR8846490_1.fastq Paired file: SRR8846490_2.fastq trimmed: SRR8846490-trimmed-pair1.fastq, SRR8846490-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Dec 8 20:36:00 2024 >> started Sun Dec 8 20:38:24 2024 >> done (144.019s) 18889554 read pairs processed; of these: 9271 ( 0.05%) short read pairs filtered out after trimming by size control 6725 ( 0.04%) empty read pairs filtered out after trimming by size control 18873558 (99.92%) read pairs available; of these: 11047734 (58.54%) trimmed read pairs available after processing 7825824 (41.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 7 0.00% 21 12 0.00% 22 6 0.00% 23 4 0.00% 24 11 0.00% 25 12 0.00% 26 11 0.00% 27 7 0.00% 28 11 0.00% 29 8 0.00% 30 12 0.00% 31 9 0.00% 32 10 0.00% 33 10 0.00% 34 12 0.00% 35 14 0.00% 36 11 0.00% 37 16 0.00% 38 15 0.00% 39 10 0.00% 40 22 0.00% 41 35 0.00% 42 26 0.00% 43 24 0.00% 44 29 0.00% 45 17 0.00% 46 22 0.00% 47 36 0.00% 48 37 0.00% 49 53 0.00% 50 58 0.00% 51 64 0.00% 52 63 0.00% 53 92 0.00% 54 73 0.00% 55 88 0.00% 56 104 0.00% 57 103 0.00% 58 151 0.00% 59 154 0.00% 60 143 0.00% 61 172 0.00% 62 208 0.00% 63 231 0.00% 64 269 0.00% 65 291 0.00% 66 294 0.00% 67 350 0.00% 68 359 0.00% 69 433 0.00% 70 563 0.00% 71 570 0.00% 72 706 0.00% 73 807 0.00% 74 851 0.00% 75 1009 0.01% 76 1128 0.01% 77 1245 0.01% 78 1367 0.01% 79 1577 0.01% 80 1815 0.01% 81 2054 0.01% 82 2385 0.01% 83 2695 0.01% 84 3286 0.02% 85 3952 0.02% 86 4161 0.02% 87 4560 0.02% 88 5041 0.03% 89 5505 0.03% 90 5730 0.03% 91 6303 0.03% 92 7055 0.04% 93 7762 0.04% 94 8643 0.05% 95 9320 0.05% 96 10201 0.05% 97 11034 0.06% 98 11806 0.06% 99 12695 0.07% 100 13753 0.07% 101 14742 0.08% 102 15933 0.08% 103 16971 0.09% 104 18104 0.10% 105 19427 0.10% 106 21126 0.11% 107 22425 0.12% 108 23425 0.12% 109 24796 0.13% 110 25775 0.14% 111 27317 0.14% 112 28799 0.15% 113 30335 0.16% 114 32377 0.17% 115 34151 0.18% 116 35802 0.19% 117 37129 0.20% 118 38664 0.20% 119 40237 0.21% 120 42078 0.22% 121 43821 0.23% 122 46099 0.24% 123 48283 0.26% 124 50455 0.27% 125 52354 0.28% 126 54558 0.29% 127 56915 0.30% 128 59628 0.32% 129 62750 0.33% 130 66246 0.35% 131 69183 0.37% 132 72728 0.39% 133 76334 0.40% 134 82224 0.44% 135 86560 0.46% 136 92835 0.49% 137 99963 0.53% 138 107564 0.57% 139 118420 0.63% 140 130585 0.69% 141 143554 0.76% 142 163241 0.86% 143 188479 1.00% 144 222903 1.18% 145 274447 1.45% 146 357070 1.89% 147 495087 2.62% 148 715778 3.79% 149 1315624 6.97% 150 4990632 26.44% 151 7825824 41.46% 18873558 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=8.55 fanout-score-rank=15 prefix-density=0.77 prefix-fanout=2.0 sequence=TCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=43 fanout-score=40.73 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=8.6 sequence=ACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=34 prefix-density=0.31 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=691.47 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=20.0 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846490 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 08 20:42:37 Started mapping on | Dec 08 20:42:38 Finished on | Dec 08 20:57:06 Mapping speed, Million of reads per hour | 78.28 Number of input reads | 18873558 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18431129 Uniquely mapped reads % | 97.66% Average mapped length | 293.60 Number of splices: Total | 20834786 Number of splices: Annotated (sjdb) | 19608892 Number of splices: GT/AG | 20564333 Number of splices: GC/AG | 242191 Number of splices: AT/AC | 11192 Number of splices: Non-canonical | 17070 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 153301 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 15019 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.05% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 295403 295403 295403 N_multimapping 153301 153301 153301 N_noFeature 807154 17935634 970452 N_ambiguous 385667 2456 53919 UnstrandedReadsAssigned:17238308 PositiveStrandReadsAssigned:493039 NegativeStrandReadsAssigned:17406758 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR8846490 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846490-trimmed-pair1.fastq SRR8846490-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,873,558 reads, 17,457,195 reads pseudoaligned [quant] estimated average fragment length: 254.403 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR8846490.ke.tsv 35125 SRR8846490.se.tsv 88098 total ==> SRR8846490.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.026 4.38627 0.555107 PNS24247 1044 790.597 43.8978 4.79961 PNS24249 1928 1674.6 44.3722 2.29044 PNS24246 1044 790.597 43.8978 4.79961 PNS24248 1044 790.597 43.8978 4.79961 PNS24244 1471 1217.6 81.5482 5.78935 PNS24243 293 92.8146 0 0 KQK14069 1603 1349.6 2774.77 177.722 KQK14071 474 235.437 111.432 40.9121 ==> SRR8846490.se.tsv <== BRADI_1g14170v3 4031 BRADI_1g53295v3 80 BRADI_1g59795v3 317 BRADI_1g07683v3 0 BRADI_1g00485v3 63 BRADI_1g20270v3 2548 BRADI_1g74790v3 90 BRADI_1g09890v3 1 BRADI_1g77505v3 314 BRADI_1g48960v3 0 SRR8846490 completed mapping pipeline successfully