Starting /dee2/code/volunteer_pipeline.sh SRR8846497 current disk space = 1500448632832 free memory = 1415839128 SRR8846497 SRAfilesize f2164e2ed6de8bd9f28f9ee798a94e0d SRR8846497.sra SRR8846497.sra file validated SRR8846497 is paired end SRR8846497 is conventional basespace SRR8846497 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846497_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.83175 28.0 18.0 32.0 18.0 33.0 2 30.9695 32.0 31.0 33.0 27.0 33.0 3 31.012 33.0 31.0 33.0 27.0 33.0 4 31.248 33.0 31.0 33.0 28.0 33.0 5 32.05075 33.0 32.0 33.0 31.0 34.0 6 36.828 38.0 37.0 38.0 34.0 38.0 7 37.2015 38.0 38.0 38.0 36.0 38.0 8 37.021 38.0 38.0 38.0 35.0 38.0 9 37.2055 38.0 38.0 38.0 36.0 38.0 10-14 37.1852 38.0 38.0 38.0 36.0 38.0 15-19 36.99175 38.0 38.0 38.0 35.6 38.0 20-24 37.01295 38.0 38.0 38.0 35.6 38.0 25-29 37.2475 38.0 38.0 38.0 36.2 38.0 30-34 37.116200000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.9645 38.0 38.0 38.0 35.6 38.0 40-44 36.59355 38.0 38.0 38.0 34.0 38.0 45-49 36.5975 38.0 38.0 38.0 34.0 38.0 50-54 36.832800000000006 38.0 38.0 38.0 35.0 38.0 55-59 36.6139 38.0 38.0 38.0 34.2 38.0 60-64 36.2959 38.0 37.6 38.0 33.0 38.0 65-69 36.03605 38.0 37.0 38.0 31.8 38.0 70-74 35.857800000000005 38.0 36.8 38.0 30.2 38.0 75-79 36.089600000000004 38.0 36.8 38.0 32.2 38.0 80-84 35.99875 38.0 36.8 38.0 31.8 38.0 85-89 35.7132 38.0 36.2 38.0 30.2 38.0 90-94 34.972950000000004 38.0 35.2 38.0 27.6 38.0 95-99 34.89605 38.0 35.0 38.0 27.4 38.0 100-104 35.13975 38.0 35.2 38.0 28.8 38.0 105-109 34.5598 38.0 34.4 38.0 25.8 38.0 110-114 33.1803 37.2 32.4 38.0 16.6 38.0 115-119 32.4211 36.2 31.4 38.0 15.0 38.0 120-124 32.9035 36.8 32.4 38.0 15.0 38.0 125-129 32.63715 36.6 32.2 38.0 16.2 38.0 130-134 31.253750000000004 35.2 28.4 38.0 14.4 38.0 135-139 29.83125 34.8 24.4 38.0 13.6 38.0 140-144 29.18875 34.2 23.4 38.0 13.0 38.0 145-149 27.88775 34.0 20.8 38.0 2.0 38.0 150-151 22.455750000000002 28.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 3.0 16 4.0 17 2.0 18 3.0 19 4.0 20 8.0 21 8.0 22 9.0 23 13.0 24 15.0 25 31.0 26 49.0 27 50.0 28 58.0 29 88.0 30 116.0 31 159.0 32 206.0 33 298.0 34 489.0 35 816.0 36 1052.0 37 518.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.65071151358344 15.472186287192754 15.446313065976714 39.43078913324709 2 24.975 21.275 34.225 19.525000000000002 3 19.950000000000003 27.05 25.7 27.3 4 23.849999999999998 33.324999999999996 21.175 21.65 5 23.88694347173587 32.016008004002 23.21160580290145 20.885442721360683 6 20.200000000000003 31.35 23.849999999999998 24.6 7 15.85 20.225 41.575 22.35 8 19.85 20.575 28.7 30.875000000000004 9 19.325 20.05 31.8 28.825 10-14 22.855 25.255 25.28 26.61 15-19 22.675 25.619999999999997 26.240000000000002 25.465 20-24 22.33 25.795 26.405 25.47 25-29 22.155 26.105 26.634999999999998 25.105 30-34 22.14 25.885 26.985 24.990000000000002 35-39 21.64 26.595000000000002 26.365 25.4 40-44 22.67 25.85 26.27 25.21 45-49 22.18 25.845000000000002 26.57 25.405 50-54 22.455 26.145000000000003 26.265 25.135 55-59 22.515 26.26 25.040000000000003 26.185000000000002 60-64 22.665 26.125 25.974999999999998 25.235000000000003 65-69 22.175 25.645 26.25 25.929999999999996 70-74 22.215 26.055 26.295 25.435000000000002 75-79 22.485 26.045 26.115 25.355 80-84 22.685 25.77 25.979999999999997 25.564999999999998 85-89 22.99 25.319999999999997 26.045 25.645 90-94 23.175 25.569999999999997 25.540000000000003 25.715 95-99 23.1 25.314999999999998 26.005 25.580000000000002 100-104 22.994999999999997 25.669999999999998 25.990000000000002 25.345000000000002 105-109 22.91 25.505 26.279999999999998 25.305 110-114 22.59 25.11 26.305 25.995 115-119 23.525 25.52 25.805 25.15 120-124 23.13 25.915 25.569999999999997 25.385 125-129 23.36 25.935000000000002 25.729999999999997 24.975 130-134 23.035 25.759999999999998 25.575 25.629999999999995 135-139 23.665 25.55 25.474999999999998 25.31 140-144 22.95 26.064999999999998 25.85 25.135 145-149 23.400000000000002 25.509999999999998 25.955000000000002 25.135 150-151 23.3 25.7 26.325 24.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 1.5 27 2.0 28 4.0 29 5.0 30 8.5 31 14.5 32 20.5 33 24.0 34 35.0 35 48.0 36 56.5 37 73.0 38 88.0 39 102.5 40 134.5 41 169.5 42 186.5 43 204.0 44 222.0 45 224.0 46 218.5 47 211.5 48 197.5 49 189.5 50 167.0 51 137.5 52 124.5 53 119.5 54 119.5 55 99.0 56 76.0 57 74.0 58 74.0 59 63.5 60 62.0 61 61.5 62 50.5 63 43.5 64 42.0 65 42.5 66 39.5 67 29.0 68 27.5 69 28.0 70 20.5 71 17.0 72 11.0 73 9.0 74 6.5 75 2.0 76 2.0 77 2.0 78 2.0 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.375 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.0750000000000002 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.3875 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.875 0.0 0.0 0.0 0.0 136-137 2.1625 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8846497 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846497_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79475 33.0 33.0 34.0 32.0 34.0 2 32.81125 33.0 33.0 34.0 32.0 34.0 3 32.82975 33.0 33.0 34.0 32.0 34.0 4 32.81525 33.0 33.0 34.0 32.0 34.0 5 32.75125 33.0 33.0 34.0 32.0 34.0 6 36.961 38.0 38.0 38.0 36.0 38.0 7 36.99 38.0 38.0 38.0 36.0 38.0 8 36.99875 38.0 38.0 38.0 36.0 38.0 9 36.9515 38.0 38.0 38.0 36.0 38.0 10-14 36.929950000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.940749999999994 38.0 38.0 38.0 36.0 38.0 20-24 36.92995 38.0 38.0 38.0 36.0 38.0 25-29 36.85145 38.0 38.0 38.0 35.6 38.0 30-34 36.60955 38.0 38.0 38.0 34.4 38.0 35-39 36.79815 38.0 38.0 38.0 35.2 38.0 40-44 36.657999999999994 38.0 38.0 38.0 34.8 38.0 45-49 36.5198 38.0 38.0 38.0 34.0 38.0 50-54 36.320750000000004 38.0 38.0 38.0 33.8 38.0 55-59 36.19815 38.0 37.8 38.0 32.8 38.0 60-64 36.31320000000001 38.0 38.0 38.0 33.6 38.0 65-69 36.41235 38.0 38.0 38.0 33.8 38.0 70-74 36.173 38.0 37.4 38.0 32.8 38.0 75-79 35.75475 38.0 37.0 38.0 30.4 38.0 80-84 35.91485 38.0 37.0 38.0 31.8 38.0 85-89 35.868 38.0 37.0 38.0 32.6 38.0 90-94 35.53505 38.0 36.2 38.0 30.2 38.0 95-99 34.92215 38.0 35.4 38.0 27.4 38.0 100-104 34.7704 38.0 35.0 38.0 27.0 38.0 105-109 34.65305 38.0 35.0 38.0 26.2 38.0 110-114 34.389050000000005 38.0 34.6 38.0 24.8 38.0 115-119 33.76995000000001 38.0 34.0 38.0 22.2 38.0 120-124 33.18885 37.8 33.4 38.0 15.0 38.0 125-129 32.849000000000004 37.4 32.8 38.0 15.0 38.0 130-134 32.132149999999996 36.0 31.0 38.0 14.6 38.0 135-139 31.2003 35.4 29.4 38.0 13.2 38.0 140-144 29.467750000000002 33.2 25.2 38.0 12.6 38.0 145-149 28.099200000000003 33.2 23.2 38.0 2.0 38.0 150-151 21.280250000000002 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 1.0 6 1.0 7 2.0 8 1.0 9 0.0 10 3.0 11 0.0 12 3.0 13 2.0 14 0.0 15 3.0 16 2.0 17 5.0 18 13.0 19 3.0 20 6.0 21 13.0 22 18.0 23 19.0 24 23.0 25 27.0 26 37.0 27 47.0 28 67.0 29 76.0 30 87.0 31 107.0 32 158.0 33 231.0 34 360.0 35 590.0 36 1049.0 37 1037.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.9 12.9 12.8 36.4 2 29.325000000000003 18.95 31.775 19.950000000000003 3 21.125 23.200000000000003 29.549999999999997 26.125 4 26.650000000000002 32.025 19.525000000000002 21.8 5 26.25 32.7 20.0 21.05 6 20.724999999999998 32.9 21.325 25.05 7 21.15 14.674999999999999 38.625 25.55 8 21.825 22.05 25.074999999999996 31.05 9 22.3 21.75 28.799999999999997 27.150000000000002 10-14 25.905 24.64 23.165 26.290000000000003 15-19 25.405 24.735 25.27 24.59 20-24 25.215 26.340000000000003 24.42 24.025 25-29 25.405 25.595000000000002 24.43 24.57 30-34 25.259999999999998 25.790000000000003 24.925 24.025 35-39 25.36 25.555 24.884999999999998 24.2 40-44 25.805 25.55 24.79 23.855 45-49 25.94 25.19 24.834999999999997 24.035 50-54 25.185000000000002 24.975 25.72 24.12 55-59 25.840000000000003 25.545 24.995 23.62 60-64 25.285000000000004 25.215 25.174999999999997 24.325 65-69 25.395 25.935000000000002 24.935 23.735 70-74 26.0 25.46 25.035 23.505000000000003 75-79 25.545 24.965 26.029999999999998 23.46 80-84 25.374999999999996 25.885 24.995 23.745 85-89 25.540000000000003 25.88 24.77 23.810000000000002 90-94 25.785000000000004 25.8 25.025 23.39 95-99 25.94 25.44 25.545 23.075000000000003 100-104 25.929999999999996 26.174999999999997 24.93 22.965 105-109 24.985 25.264999999999997 26.195 23.555 110-114 25.619999999999997 26.11 25.09 23.18 115-119 25.95 26.279999999999998 24.98 22.79 120-124 26.090000000000003 25.545 25.480000000000004 22.884999999999998 125-129 26.245 25.615 25.650000000000002 22.49 130-134 26.384999999999998 25.665 25.36 22.59 135-139 25.61 26.355 25.180000000000003 22.855 140-144 26.105 26.35 25.064999999999998 22.48 145-149 26.279999999999998 26.19 25.415 22.115000000000002 150-151 25.7875 25.2875 26.0625 22.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 1.5 26 0.5 27 1.5 28 4.0 29 5.0 30 7.0 31 7.5 32 10.0 33 18.5 34 25.0 35 35.0 36 52.0 37 59.0 38 72.5 39 97.5 40 116.0 41 136.0 42 162.5 43 181.5 44 183.5 45 194.5 46 216.0 47 203.5 48 181.5 49 172.0 50 154.0 51 142.0 52 131.5 53 131.0 54 118.5 55 95.5 56 82.0 57 87.5 58 92.5 59 86.5 60 79.5 61 74.5 62 79.0 63 67.0 64 57.5 65 52.5 66 56.5 67 55.0 68 45.5 69 46.0 70 35.5 71 24.0 72 16.0 73 12.5 74 10.0 75 5.0 76 5.0 77 5.0 78 3.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49685534591195 98.875 2 0.42767295597484273 0.8500000000000001 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.0750000000000002 0.0 0.0 0.0 0.0 128-129 1.2 0.0 0.0 0.0 0.0 130-131 1.4375 0.0 0.0 0.0 0.0 132-133 1.75 0.0 0.0 0.0 0.0 134-135 1.95 0.0 0.0 0.0 0.0 136-137 2.25 0.0 0.0 0.0 0.0 138-139 2.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAATT 10 0.006830828 145.0 145 GCCTGGA 10 0.006830828 145.0 7 GGGGGGG 20 0.00593511 29.0 40-44 TTTTTTT 30 0.0014437955 24.166668 135-139 >>END_MODULE Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024073 spots for SRR8846497.sra Written 1024073 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra Read 1024056 spots for SRR8846497.sra Written 1024056 spots for SRR8846497.sra SRR ids: ['SRR8846497.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bdv_sqqd SRR8846497.sra spots: 20481137 blocks: [[1, 1024056], [1024057, 2048112], [2048113, 3072168], [3072169, 4096224], [4096225, 5120280], [5120281, 6144336], [6144337, 7168392], [7168393, 8192448], [8192449, 9216504], [9216505, 10240560], [10240561, 11264616], [11264617, 12288672], [12288673, 13312728], [13312729, 14336784], [14336785, 15360840], [15360841, 16384896], [16384897, 17408952], [17408953, 18433008], [18433009, 19457064], [19457065, 20481137]] SRR8846497 file size 6918684 SRR8846497 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846497 SRR8846497_1.fastq SRR8846497_2.fastq Input file: SRR8846497_1.fastq Paired file: SRR8846497_2.fastq trimmed: SRR8846497-trimmed-pair1.fastq, SRR8846497-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Dec 8 23:14:10 2024 >> started Sun Dec 8 23:16:46 2024 >> done (155.979s) 20481137 read pairs processed; of these: 12893 ( 0.06%) short read pairs filtered out after trimming by size control 8889 ( 0.04%) empty read pairs filtered out after trimming by size control 20459355 (99.89%) read pairs available; of these: 11643795 (56.91%) trimmed read pairs available after processing 8815560 (43.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 12 0.00% 21 7 0.00% 22 6 0.00% 23 15 0.00% 24 12 0.00% 25 5 0.00% 26 15 0.00% 27 15 0.00% 28 12 0.00% 29 5 0.00% 30 5 0.00% 31 14 0.00% 32 8 0.00% 33 12 0.00% 34 8 0.00% 35 14 0.00% 36 10 0.00% 37 17 0.00% 38 17 0.00% 39 19 0.00% 40 14 0.00% 41 16 0.00% 42 20 0.00% 43 20 0.00% 44 26 0.00% 45 25 0.00% 46 26 0.00% 47 31 0.00% 48 27 0.00% 49 40 0.00% 50 36 0.00% 51 40 0.00% 52 38 0.00% 53 47 0.00% 54 56 0.00% 55 59 0.00% 56 56 0.00% 57 61 0.00% 58 82 0.00% 59 103 0.00% 60 88 0.00% 61 92 0.00% 62 129 0.00% 63 125 0.00% 64 159 0.00% 65 189 0.00% 66 175 0.00% 67 218 0.00% 68 233 0.00% 69 289 0.00% 70 299 0.00% 71 333 0.00% 72 388 0.00% 73 406 0.00% 74 468 0.00% 75 488 0.00% 76 585 0.00% 77 649 0.00% 78 749 0.00% 79 820 0.00% 80 864 0.00% 81 1061 0.01% 82 1162 0.01% 83 1350 0.01% 84 1982 0.01% 85 2303 0.01% 86 2423 0.01% 87 2524 0.01% 88 2844 0.01% 89 2978 0.01% 90 3149 0.02% 91 3287 0.02% 92 3597 0.02% 93 3821 0.02% 94 4201 0.02% 95 4500 0.02% 96 5012 0.02% 97 5209 0.03% 98 5683 0.03% 99 6175 0.03% 100 6513 0.03% 101 6852 0.03% 102 7270 0.04% 103 7932 0.04% 104 8602 0.04% 105 9328 0.05% 106 10053 0.05% 107 10949 0.05% 108 11759 0.06% 109 12490 0.06% 110 13251 0.06% 111 13895 0.07% 112 15100 0.07% 113 16195 0.08% 114 17261 0.08% 115 18370 0.09% 116 19363 0.09% 117 20755 0.10% 118 22486 0.11% 119 23502 0.11% 120 25226 0.12% 121 26948 0.13% 122 28726 0.14% 123 30574 0.15% 124 32978 0.16% 125 35027 0.17% 126 37336 0.18% 127 39905 0.20% 128 42975 0.21% 129 46218 0.23% 130 50284 0.25% 131 53711 0.26% 132 58214 0.28% 133 63780 0.31% 134 68974 0.34% 135 75688 0.37% 136 82811 0.40% 137 91982 0.45% 138 102309 0.50% 139 114483 0.56% 140 128894 0.63% 141 146843 0.72% 142 170987 0.84% 143 201772 0.99% 144 241767 1.18% 145 302122 1.48% 146 396755 1.94% 147 558612 2.73% 148 810824 3.96% 149 1531830 7.49% 150 5701246 27.87% 151 8815560 43.09% 20459355 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=309.46 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=20.5 sequence=ATCATCATCGTGGTAGTACAAGTGAAACCAGCTACACACACTTGGTCGCGAGCATAGTCGATTTGCATATACACATGTGCCTCTCATTGACACCTTACTTGCCGGGAACG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=36 prefix-density=0.38 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=636.20 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=20.1 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846497 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 08 23:21:04 Started mapping on | Dec 08 23:21:05 Finished on | Dec 08 23:37:49 Mapping speed, Million of reads per hour | 73.36 Number of input reads | 20459355 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19961581 Uniquely mapped reads % | 97.57% Average mapped length | 296.02 Number of splices: Total | 23109500 Number of splices: Annotated (sjdb) | 21806128 Number of splices: GT/AG | 22815285 Number of splices: GC/AG | 264265 Number of splices: AT/AC | 13086 Number of splices: Non-canonical | 16864 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 174519 % of reads mapped to multiple loci | 0.85% Number of reads mapped to too many loci | 11444 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.21% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 332314 332314 332314 N_multimapping 174519 174519 174519 N_noFeature 757308 19434899 924367 N_ambiguous 414744 2702 55922 UnstrandedReadsAssigned:18789529 PositiveStrandReadsAssigned:523980 NegativeStrandReadsAssigned:18981292 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR8846497 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846497-trimmed-pair1.fastq SRR8846497-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,459,355 reads, 19,037,867 reads pseudoaligned [quant] estimated average fragment length: 280.589 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR8846497.ke.tsv 35125 SRR8846497.se.tsv 88098 total ==> SRR8846497.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.976 0 0 PNS24247 1044 764.411 69.4557 6.91584 PNS24249 1928 1648.41 41.3315 1.90845 PNS24246 1044 764.411 69.4557 6.91584 PNS24248 1044 764.411 69.4557 6.91584 PNS24244 1471 1191.41 71.3014 4.55513 PNS24243 293 78.0289 0 0 KQK14069 1603 1323.41 1504.51 86.5294 KQK14071 474 214.705 12.5743 4.45767 ==> SRR8846497.se.tsv <== BRADI_1g14170v3 1689 BRADI_1g53295v3 57 BRADI_1g59795v3 294 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 2806 BRADI_1g74790v3 125 BRADI_1g09890v3 1 BRADI_1g77505v3 237 BRADI_1g48960v3 1 SRR8846497 completed mapping pipeline successfully