Starting /dee2/code/volunteer_pipeline.sh SRR8846499 current disk space = 1500739788800 free memory = 1359562164 SRR8846499 SRAfilesize 3441ceefab6b062f4729e591d6ebe64a SRR8846499.sra SRR8846499.sra file validated SRR8846499 is paired end SRR8846499 is conventional basespace SRR8846499 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846499_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.252 33.0 31.0 33.0 18.0 34.0 2 32.1645 33.0 32.0 33.0 30.0 34.0 3 31.38575 33.0 31.0 33.0 28.0 34.0 4 32.37475 33.0 33.0 34.0 31.0 34.0 5 32.45125 33.0 33.0 34.0 31.0 34.0 6 36.92875 38.0 37.0 38.0 35.0 38.0 7 37.0675 38.0 38.0 38.0 35.0 38.0 8 37.3095 38.0 38.0 38.0 36.0 38.0 9 37.363 38.0 38.0 38.0 37.0 38.0 10-14 37.3084 38.0 38.0 38.0 36.6 38.0 15-19 37.1103 38.0 38.0 38.0 36.0 38.0 20-24 37.085800000000006 38.0 38.0 38.0 35.8 38.0 25-29 37.22535 38.0 38.0 38.0 36.4 38.0 30-34 37.051100000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.99210000000001 38.0 38.0 38.0 35.6 38.0 40-44 36.7007 38.0 38.0 38.0 34.6 38.0 45-49 36.5193 38.0 38.0 38.0 34.0 38.0 50-54 36.7842 38.0 38.0 38.0 34.6 38.0 55-59 36.593599999999995 38.0 38.0 38.0 34.2 38.0 60-64 36.252250000000004 38.0 37.2 38.0 32.6 38.0 65-69 36.006949999999996 38.0 37.0 38.0 31.0 38.0 70-74 35.96265 38.0 36.8 38.0 30.8 38.0 75-79 36.07424999999999 38.0 36.8 38.0 32.4 38.0 80-84 35.95795 38.0 36.4 38.0 31.4 38.0 85-89 35.65245 38.0 36.0 38.0 29.8 38.0 90-94 35.1019 38.0 35.4 38.0 28.2 38.0 95-99 34.86245 38.0 35.0 38.0 27.2 38.0 100-104 35.1272 38.0 35.0 38.0 28.6 38.0 105-109 34.5871 38.0 34.4 38.0 26.6 38.0 110-114 33.2524 37.4 32.4 38.0 16.6 38.0 115-119 32.5757 36.4 31.2 38.0 15.0 38.0 120-124 32.6454 36.6 31.2 38.0 15.0 38.0 125-129 32.5565 36.6 31.6 38.0 15.0 38.0 130-134 31.25335 35.4 28.2 38.0 14.2 38.0 135-139 29.748199999999997 34.6 24.2 38.0 13.6 38.0 140-144 28.783300000000004 34.0 22.6 38.0 13.0 38.0 145-149 27.724899999999998 34.0 19.2 38.0 2.0 38.0 150-151 22.321125000000002 28.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 3.0 19 1.0 20 7.0 21 11.0 22 8.0 23 16.0 24 28.0 25 28.0 26 39.0 27 55.0 28 50.0 29 72.0 30 98.0 31 171.0 32 234.0 33 322.0 34 470.0 35 749.0 36 1065.0 37 567.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.30540609787343 14.296694850115296 11.45272867025365 37.94517038175762 2 25.424999999999997 20.125 34.725 19.725 3 20.549999999999997 26.950000000000003 26.200000000000003 26.3 4 23.150000000000002 33.975 22.15 20.724999999999998 5 23.78689344672336 34.86743371685843 22.686343171585793 18.659329664832416 6 19.05 33.675 23.849999999999998 23.425 7 15.55 21.15 42.1 21.2 8 21.175 19.175 27.775 31.874999999999996 9 18.55 21.099999999999998 30.7 29.65 10-14 22.805 26.135 24.585 26.474999999999998 15-19 22.720000000000002 25.885 26.1 25.295 20-24 22.445 26.195 26.215 25.145 25-29 22.71 26.295 26.275 24.72 30-34 22.475 26.640000000000004 25.785000000000004 25.1 35-39 22.720000000000002 26.045 26.290000000000003 24.945 40-44 22.66 26.265 25.919999999999998 25.155 45-49 22.225 26.369999999999997 25.619999999999997 25.785000000000004 50-54 22.705000000000002 25.955000000000002 25.735000000000003 25.605 55-59 22.685 26.205000000000002 25.419999999999998 25.69 60-64 22.485 26.150000000000002 26.240000000000002 25.124999999999996 65-69 22.650000000000002 26.169999999999998 25.765 25.415 70-74 22.57 25.255 26.619999999999997 25.555 75-79 22.915 26.424999999999997 25.590000000000003 25.069999999999997 80-84 22.705000000000002 26.515 26.029999999999998 24.75 85-89 23.285 26.029999999999998 25.805 24.88 90-94 22.855 26.085 25.835 25.224999999999998 95-99 23.325000000000003 25.169999999999998 26.185000000000002 25.319999999999997 100-104 22.770000000000003 25.81 26.405 25.014999999999997 105-109 23.185 26.05 25.650000000000002 25.115 110-114 23.635 25.365 25.869999999999997 25.130000000000003 115-119 23.86 25.195 25.94 25.005 120-124 23.31 25.685000000000002 25.575 25.430000000000003 125-129 23.43 25.8 25.605 25.165 130-134 23.345 25.8 25.525 25.330000000000002 135-139 23.74 25.61 25.435000000000002 25.215 140-144 23.095 25.955000000000002 25.595000000000002 25.355 145-149 23.119999999999997 26.33 25.259999999999998 25.290000000000003 150-151 23.35 25.424999999999997 26.0125 25.2125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 2.5 27 3.0 28 5.0 29 9.0 30 9.5 31 11.0 32 15.5 33 21.5 34 32.5 35 45.0 36 60.5 37 77.5 38 102.0 39 132.0 40 147.5 41 157.5 42 162.5 43 198.0 44 218.5 45 216.5 46 227.5 47 209.0 48 191.5 49 181.0 50 163.5 51 147.0 52 135.0 53 118.5 54 97.5 55 89.0 56 85.0 57 80.0 58 78.0 59 73.0 60 67.0 61 58.5 62 46.0 63 38.5 64 45.0 65 45.0 66 37.5 67 34.5 68 27.5 69 23.5 70 23.5 71 14.0 72 7.0 73 6.5 74 6.0 75 5.5 76 2.5 77 0.5 78 2.0 79 2.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.7875 0.0 0.0 0.0 0.0 136-137 1.925 0.0 0.0 0.0 0.0 138-139 2.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTC 10 0.0068343505 144.975 2 CACGCAC 10 0.0068343505 144.975 9 >>END_MODULE SRR8846499 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846499_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7425 33.0 33.0 34.0 32.0 34.0 2 32.75025 33.0 33.0 34.0 32.0 34.0 3 32.7875 33.0 33.0 34.0 32.0 34.0 4 32.814 33.0 33.0 34.0 32.0 34.0 5 32.6425 33.0 33.0 34.0 32.0 34.0 6 36.955 38.0 38.0 38.0 35.0 38.0 7 36.98575 38.0 38.0 38.0 36.0 38.0 8 37.03075 38.0 38.0 38.0 36.0 38.0 9 36.90025 38.0 38.0 38.0 35.0 38.0 10-14 36.92145 38.0 38.0 38.0 35.6 38.0 15-19 36.9351 38.0 38.0 38.0 35.8 38.0 20-24 36.90560000000001 38.0 38.0 38.0 35.6 38.0 25-29 36.79875 38.0 38.0 38.0 35.2 38.0 30-34 36.6519 38.0 38.0 38.0 34.4 38.0 35-39 36.702299999999994 38.0 38.0 38.0 35.0 38.0 40-44 36.658 38.0 38.0 38.0 34.6 38.0 45-49 36.53345 38.0 38.0 38.0 34.0 38.0 50-54 36.354949999999995 38.0 38.0 38.0 33.8 38.0 55-59 36.1295 38.0 37.0 38.0 32.8 38.0 60-64 36.22305 38.0 37.4 38.0 33.4 38.0 65-69 36.33985 38.0 38.0 38.0 33.8 38.0 70-74 36.081649999999996 38.0 37.2 38.0 32.4 38.0 75-79 35.69070000000001 38.0 37.0 38.0 30.2 38.0 80-84 35.806400000000004 38.0 36.8 38.0 31.4 38.0 85-89 35.73945 38.0 37.0 38.0 30.8 38.0 90-94 35.38185 38.0 36.0 38.0 29.4 38.0 95-99 34.7782 38.0 35.2 38.0 26.8 38.0 100-104 34.610749999999996 38.0 34.6 38.0 26.4 38.0 105-109 34.4397 38.0 34.8 38.0 25.6 38.0 110-114 34.0668 38.0 34.0 38.0 23.4 38.0 115-119 33.52735 38.0 34.0 38.0 19.0 38.0 120-124 32.895599999999995 37.2 32.4 38.0 15.0 38.0 125-129 32.5042 36.8 31.8 38.0 15.0 38.0 130-134 31.750049999999998 36.0 30.6 38.0 14.0 38.0 135-139 30.676649999999995 35.0 28.6 38.0 13.2 38.0 140-144 28.922050000000002 33.0 23.8 38.0 8.6 38.0 145-149 27.20815 33.0 18.8 38.0 2.0 38.0 150-151 19.948625 25.5 2.0 34.5 2.0 37.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 2.0 5 1.0 6 2.0 7 0.0 8 3.0 9 0.0 10 0.0 11 2.0 12 4.0 13 0.0 14 3.0 15 1.0 16 4.0 17 7.0 18 8.0 19 2.0 20 11.0 21 16.0 22 13.0 23 17.0 24 27.0 25 34.0 26 45.0 27 35.0 28 76.0 29 96.0 30 117.0 31 142.0 32 153.0 33 232.0 34 374.0 35 618.0 36 1074.0 37 878.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.8 13.675 14.025000000000002 35.5 2 29.625 17.925 32.125 20.325 3 22.3 23.65 28.749999999999996 25.3 4 25.424999999999997 31.474999999999998 19.725 23.375 5 26.75 32.800000000000004 19.425 21.025 6 20.424999999999997 33.525 21.975 24.075 7 21.0 14.825 39.225 24.95 8 22.25 20.075000000000003 25.474999999999998 32.2 9 21.7 22.1 26.875 29.325000000000003 10-14 25.835 24.345 23.505000000000003 26.314999999999998 15-19 25.564999999999998 24.87 24.86 24.705 20-24 24.815 25.965 25.06 24.16 25-29 25.629999999999995 25.295 24.915000000000003 24.16 30-34 25.36 25.319999999999997 25.245 24.075 35-39 25.255 25.45 25.41 23.885 40-44 25.345000000000002 25.88 24.795 23.98 45-49 25.490000000000002 25.56 25.025 23.925 50-54 25.21 25.169999999999998 25.355 24.265 55-59 26.11 24.755 24.92 24.215 60-64 25.385 24.81 25.740000000000002 24.065 65-69 25.679999999999996 25.019999999999996 25.515 23.785 70-74 25.580000000000002 25.365 25.480000000000004 23.575 75-79 25.555 25.655 25.080000000000002 23.71 80-84 25.77 25.715 25.119999999999997 23.395 85-89 26.119999999999997 25.564999999999998 24.759999999999998 23.555 90-94 25.840000000000003 25.380000000000003 25.575 23.205000000000002 95-99 25.019999999999996 25.645 25.27 24.065 100-104 26.14 25.535000000000004 25.035 23.29 105-109 25.215 25.424999999999997 25.885 23.474999999999998 110-114 25.4 25.869999999999997 25.380000000000003 23.35 115-119 25.2 26.045 25.245 23.51 120-124 25.124999999999996 26.165 25.735000000000003 22.975 125-129 25.674999999999997 25.825 25.080000000000002 23.419999999999998 130-134 25.415 26.419999999999998 25.105 23.06 135-139 25.935000000000002 26.02 25.635 22.41 140-144 26.545 25.505 25.16 22.79 145-149 26.32 25.895000000000003 25.230000000000004 22.555 150-151 26.3625 26.200000000000003 26.275 21.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.5 27 0.5 28 1.5 29 4.5 30 9.0 31 11.5 32 11.0 33 13.5 34 25.0 35 39.5 36 47.0 37 56.0 38 76.0 39 101.0 40 122.0 41 156.5 42 176.0 43 177.0 44 189.0 45 198.0 46 201.0 47 195.5 48 173.0 49 170.0 50 173.0 51 149.0 52 121.0 53 104.0 54 100.0 55 95.5 56 90.0 57 83.0 58 89.5 59 88.5 60 77.5 61 77.5 62 77.5 63 68.0 64 60.0 65 60.5 66 57.5 67 51.5 68 48.5 69 46.0 70 36.0 71 24.0 72 18.0 73 17.0 74 12.0 75 6.0 76 3.5 77 3.0 78 3.5 79 1.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39470365699874 98.52499999999999 2 0.5044136191677175 1.0 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.05044136191677175 0.25 6 0.025220680958385876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit GCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.625 0.0 0.0 0.0 0.0 134-135 1.8625 0.0 0.0 0.0 0.0 136-137 1.9874999999999998 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGAAG 10 0.006830828 145.0 8 >>END_MODULE Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854290 spots for SRR8846499.sra Written 854290 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra Read 854277 spots for SRR8846499.sra Written 854277 spots for SRR8846499.sra SRR ids: ['SRR8846499.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rgz05_e8 SRR8846499.sra spots: 17085553 blocks: [[1, 854277], [854278, 1708554], [1708555, 2562831], [2562832, 3417108], [3417109, 4271385], [4271386, 5125662], [5125663, 5979939], [5979940, 6834216], [6834217, 7688493], [7688494, 8542770], [8542771, 9397047], [9397048, 10251324], [10251325, 11105601], [11105602, 11959878], [11959879, 12814155], [12814156, 13668432], [13668433, 14522709], [14522710, 15376986], [15376987, 16231263], [16231264, 17085553]] SRR8846499 file size 5768032 SRR8846499 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846499 SRR8846499_1.fastq SRR8846499_2.fastq Input file: SRR8846499_1.fastq Paired file: SRR8846499_2.fastq trimmed: SRR8846499-trimmed-pair1.fastq, SRR8846499-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 00:11:51 2024 >> started Mon Dec 9 00:14:02 2024 >> done (131.498s) 17085553 read pairs processed; of these: 11189 ( 0.07%) short read pairs filtered out after trimming by size control 6715 ( 0.04%) empty read pairs filtered out after trimming by size control 17067649 (99.90%) read pairs available; of these: 9803719 (57.44%) trimmed read pairs available after processing 7263930 (42.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 4 0.00% 21 7 0.00% 22 8 0.00% 23 9 0.00% 24 7 0.00% 25 11 0.00% 26 9 0.00% 27 13 0.00% 28 8 0.00% 29 10 0.00% 30 7 0.00% 31 9 0.00% 32 12 0.00% 33 7 0.00% 34 10 0.00% 35 5 0.00% 36 12 0.00% 37 16 0.00% 38 19 0.00% 39 12 0.00% 40 10 0.00% 41 13 0.00% 42 11 0.00% 43 21 0.00% 44 19 0.00% 45 11 0.00% 46 10 0.00% 47 26 0.00% 48 32 0.00% 49 27 0.00% 50 32 0.00% 51 32 0.00% 52 27 0.00% 53 44 0.00% 54 45 0.00% 55 51 0.00% 56 34 0.00% 57 46 0.00% 58 59 0.00% 59 66 0.00% 60 72 0.00% 61 98 0.00% 62 97 0.00% 63 96 0.00% 64 123 0.00% 65 146 0.00% 66 150 0.00% 67 145 0.00% 68 160 0.00% 69 187 0.00% 70 231 0.00% 71 258 0.00% 72 259 0.00% 73 326 0.00% 74 338 0.00% 75 398 0.00% 76 423 0.00% 77 460 0.00% 78 555 0.00% 79 584 0.00% 80 705 0.00% 81 738 0.00% 82 844 0.00% 83 1029 0.01% 84 1493 0.01% 85 1814 0.01% 86 1845 0.01% 87 1886 0.01% 88 1995 0.01% 89 2135 0.01% 90 2280 0.01% 91 2368 0.01% 92 2542 0.01% 93 2866 0.02% 94 3070 0.02% 95 3328 0.02% 96 3394 0.02% 97 3880 0.02% 98 4052 0.02% 99 4520 0.03% 100 4722 0.03% 101 5093 0.03% 102 5488 0.03% 103 5946 0.03% 104 6495 0.04% 105 6742 0.04% 106 7535 0.04% 107 8097 0.05% 108 8638 0.05% 109 9279 0.05% 110 9991 0.06% 111 10720 0.06% 112 11529 0.07% 113 12236 0.07% 114 13208 0.08% 115 14004 0.08% 116 15102 0.09% 117 16143 0.09% 118 17215 0.10% 119 18397 0.11% 120 19715 0.12% 121 21140 0.12% 122 22405 0.13% 123 24085 0.14% 124 26072 0.15% 125 27820 0.16% 126 29834 0.17% 127 31924 0.19% 128 34375 0.20% 129 37372 0.22% 130 40285 0.24% 131 43209 0.25% 132 47510 0.28% 133 51920 0.30% 134 56376 0.33% 135 61986 0.36% 136 68464 0.40% 137 76167 0.45% 138 84934 0.50% 139 96067 0.56% 140 108509 0.64% 141 123153 0.72% 142 143056 0.84% 143 170893 1.00% 144 206509 1.21% 145 258118 1.51% 146 339327 1.99% 147 478196 2.80% 148 697515 4.09% 149 1314272 7.70% 150 4803214 28.14% 151 7263930 42.56% 17067649 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=8.52 fanout-score-rank=11 prefix-density=0.93 prefix-fanout=1.9 sequence=TCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=121.72 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=12.7 sequence=AGAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCGAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=38 prefix-density=0.41 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=661.12 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=20.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846499 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 00:18:12 Started mapping on | Dec 09 00:18:13 Finished on | Dec 09 00:28:00 Mapping speed, Million of reads per hour | 104.67 Number of input reads | 17067649 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16757021 Uniquely mapped reads % | 98.18% Average mapped length | 296.20 Number of splices: Total | 19373493 Number of splices: Annotated (sjdb) | 18281298 Number of splices: GT/AG | 19123336 Number of splices: GC/AG | 225973 Number of splices: AT/AC | 10049 Number of splices: Non-canonical | 14135 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 143854 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 13239 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.44% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 174621 174621 174621 N_multimapping 143854 143854 143854 N_noFeature 661730 16320143 784183 N_ambiguous 366211 2322 52373 UnstrandedReadsAssigned:15729080 PositiveStrandReadsAssigned:434556 NegativeStrandReadsAssigned:15920465 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR8846499 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846499-trimmed-pair1.fastq SRR8846499-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,067,649 reads, 15,963,207 reads pseudoaligned [quant] estimated average fragment length: 283.196 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR8846499.ke.tsv 35125 SRR8846499.se.tsv 88098 total ==> SRR8846499.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.273 0 0 PNS24247 1044 761.804 57.6417 6.83021 PNS24249 1928 1645.8 41.1878 2.25908 PNS24246 1044 761.804 57.6417 6.83021 PNS24248 1044 761.804 57.6417 6.83021 PNS24244 1471 1188.8 52.8871 4.01587 PNS24243 293 75.8423 0 0 KQK14069 1603 1320.8 2285.57 156.206 KQK14071 474 210.813 97.8799 41.9119 ==> SRR8846499.se.tsv <== BRADI_1g14170v3 3492 BRADI_1g53295v3 77 BRADI_1g59795v3 266 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 2254 BRADI_1g74790v3 86 BRADI_1g09890v3 0 BRADI_1g77505v3 293 BRADI_1g48960v3 0 SRR8846499 completed mapping pipeline successfully