Starting /dee2/code/volunteer_pipeline.sh SRR8846502 current disk space = 1500614492160 free memory = 1352658596 SRR8846502 SRAfilesize 3ba3d36a33c9e4425468b54dacc41a44 SRR8846502.sra SRR8846502.sra file validated SRR8846502 is paired end SRR8846502 is conventional basespace SRR8846502 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846502_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.558 25.0 18.0 32.0 18.0 33.0 2 23.0515 18.0 18.0 29.0 18.0 31.0 3 26.4325 27.0 25.0 30.0 18.0 31.0 4 30.5955 32.0 31.0 33.0 27.0 33.0 5 32.14325 33.0 32.0 33.0 32.0 33.0 6 36.7815 38.0 37.0 38.0 34.0 38.0 7 37.12725 38.0 38.0 38.0 36.0 38.0 8 37.27525 38.0 38.0 38.0 36.0 38.0 9 37.33625 38.0 38.0 38.0 37.0 38.0 10-14 37.1994 38.0 38.0 38.0 36.0 38.0 15-19 37.100750000000005 38.0 38.0 38.0 35.8 38.0 20-24 37.134 38.0 38.0 38.0 36.0 38.0 25-29 37.380700000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.3209 38.0 38.0 38.0 36.6 38.0 35-39 37.111149999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.865500000000004 38.0 38.0 38.0 35.2 38.0 45-49 36.9644 38.0 38.0 38.0 35.6 38.0 50-54 36.87975 38.0 38.0 38.0 34.8 38.0 55-59 36.75075 38.0 38.0 38.0 34.6 38.0 60-64 36.46335 38.0 37.6 38.0 33.4 38.0 65-69 36.4317 38.0 37.2 38.0 33.8 38.0 70-74 36.315999999999995 38.0 37.0 38.0 33.4 38.0 75-79 36.348850000000006 38.0 37.0 38.0 33.4 38.0 80-84 36.11794999999999 38.0 36.8 38.0 32.4 38.0 85-89 35.89105000000001 38.0 36.8 38.0 31.8 38.0 90-94 35.22745 38.0 35.6 38.0 28.4 38.0 95-99 35.066649999999996 38.0 35.2 38.0 28.2 38.0 100-104 35.183899999999994 38.0 35.4 38.0 28.8 38.0 105-109 34.721450000000004 38.0 34.8 38.0 26.8 38.0 110-114 33.6576 37.6 33.6 38.0 19.8 38.0 115-119 32.8705 37.0 32.0 38.0 15.0 38.0 120-124 32.9479 36.8 32.4 38.0 15.0 38.0 125-129 32.84905 36.6 32.2 38.0 16.2 38.0 130-134 31.608250000000005 35.4 29.4 38.0 14.4 38.0 135-139 30.12855 34.8 25.0 38.0 13.6 38.0 140-144 29.167499999999997 34.6 23.2 38.0 13.0 38.0 145-149 28.1803 34.2 21.4 38.0 2.0 38.0 150-151 22.923125 29.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 2.0 19 9.0 20 2.0 21 5.0 22 14.0 23 11.0 24 12.0 25 26.0 26 33.0 27 46.0 28 67.0 29 90.0 30 98.0 31 163.0 32 206.0 33 292.0 34 472.0 35 787.0 36 1159.0 37 501.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.35260712441921 13.267940113577698 9.137842023748064 36.241610738255034 2 27.925 20.150000000000002 35.225 16.7 3 21.85 26.650000000000002 25.650000000000002 25.85 4 25.8 32.5 19.975 21.725 5 22.230557639409852 34.98374593648413 23.93098274568642 18.854713678419603 6 19.45 32.65 25.174999999999997 22.725 7 15.625 19.15 42.275 22.95 8 19.325 20.825 28.075 31.775 9 19.400000000000002 20.424999999999997 32.4 27.775 10-14 22.49 26.945000000000004 24.0 26.565 15-19 22.305 26.455000000000002 25.900000000000002 25.34 20-24 22.264999999999997 26.495 26.369999999999997 24.87 25-29 21.565 26.915 26.905 24.615000000000002 30-34 22.055 26.125 26.169999999999998 25.650000000000002 35-39 21.62 26.240000000000002 26.955000000000002 25.185000000000002 40-44 22.445 26.51 26.255 24.79 45-49 22.295 26.32 26.435 24.95 50-54 22.220000000000002 26.8 26.14 24.84 55-59 22.415 26.375 26.179999999999996 25.03 60-64 22.275 26.040000000000003 26.495 25.19 65-69 22.314999999999998 25.935000000000002 26.33 25.419999999999998 70-74 22.685 26.185000000000002 25.990000000000002 25.14 75-79 22.185 26.63 25.874999999999996 25.31 80-84 22.275 25.745 26.529999999999998 25.45 85-89 22.585 26.19 26.205000000000002 25.019999999999996 90-94 22.36 26.265 26.015 25.36 95-99 22.650000000000002 26.125 26.19 25.035 100-104 23.035 25.779999999999998 26.07 25.115 105-109 22.74 25.580000000000002 26.265 25.415 110-114 22.625 26.595000000000002 25.580000000000002 25.2 115-119 23.21 26.174999999999997 25.75 24.865000000000002 120-124 22.85 25.785000000000004 25.790000000000003 25.575 125-129 23.265 24.965 26.26 25.509999999999998 130-134 23.765 25.314999999999998 25.865 25.055 135-139 23.175 25.595000000000002 25.705 25.525 140-144 23.54 26.13 26.08 24.25 145-149 23.355 25.415 25.56 25.669999999999998 150-151 23.75 25.162499999999998 26.137500000000003 24.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 2.5 27 5.5 28 6.0 29 5.5 30 6.0 31 9.5 32 16.5 33 31.5 34 43.5 35 48.0 36 64.5 37 89.5 38 103.5 39 110.0 40 136.5 41 176.0 42 198.5 43 193.5 44 200.0 45 224.5 46 224.5 47 212.0 48 212.5 49 201.0 50 172.0 51 145.0 52 130.5 53 119.0 54 104.0 55 87.0 56 75.0 57 77.0 58 69.5 59 56.0 60 51.0 61 50.5 62 48.5 63 42.0 64 41.0 65 41.0 66 32.0 67 28.5 68 28.0 69 23.0 70 17.5 71 10.0 72 4.5 73 5.5 74 5.5 75 4.0 76 3.0 77 2.5 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.15 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.6000000000000001 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.7875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.0750000000000002 0.0 0.0 0.0 0.0 126-127 1.1749999999999998 0.0 0.0 0.0 0.0 128-129 1.2625 0.0 0.0 0.0 0.0 130-131 1.4875 0.0 0.0 0.0 0.0 132-133 1.7374999999999998 0.0 0.0 0.0 0.0 134-135 1.9500000000000002 0.0 0.0 0.0 0.0 136-137 2.0375 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGATT 10 0.006577216 146.82278 1 CATCTCC 15 1.14152615E-4 144.9875 5 ACATCTC 10 0.006832588 144.9875 4 >>END_MODULE SRR8846502 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846502_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.583 33.0 33.0 34.0 32.0 34.0 2 32.48725 33.0 33.0 34.0 31.0 34.0 3 32.6775 33.0 33.0 34.0 32.0 34.0 4 32.6025 33.0 33.0 34.0 32.0 34.0 5 32.62475 33.0 33.0 34.0 32.0 34.0 6 36.83025 38.0 38.0 38.0 35.0 38.0 7 36.795 38.0 38.0 38.0 35.0 38.0 8 36.7925 38.0 38.0 38.0 35.0 38.0 9 36.91525 38.0 38.0 38.0 36.0 38.0 10-14 36.92465 38.0 38.0 38.0 35.4 38.0 15-19 36.9002 38.0 38.0 38.0 35.6 38.0 20-24 36.90125 38.0 38.0 38.0 35.6 38.0 25-29 36.6871 38.0 38.0 38.0 34.8 38.0 30-34 36.6453 38.0 38.0 38.0 34.6 38.0 35-39 36.72845 38.0 38.0 38.0 34.8 38.0 40-44 36.6419 38.0 38.0 38.0 34.4 38.0 45-49 36.4803 38.0 38.0 38.0 34.0 38.0 50-54 36.18415 38.0 37.8 38.0 32.8 38.0 55-59 36.06420000000001 38.0 37.2 38.0 32.6 38.0 60-64 36.2078 38.0 37.4 38.0 33.2 38.0 65-69 36.3138 38.0 38.0 38.0 33.6 38.0 70-74 36.052200000000006 38.0 37.4 38.0 32.8 38.0 75-79 35.722249999999995 38.0 37.0 38.0 30.6 38.0 80-84 35.78175 38.0 37.0 38.0 31.2 38.0 85-89 35.5059 38.0 36.6 38.0 30.0 38.0 90-94 35.28525 38.0 36.0 38.0 28.8 38.0 95-99 34.8751 38.0 35.2 38.0 27.4 38.0 100-104 34.3948 38.0 35.0 38.0 25.0 38.0 105-109 34.382749999999994 38.0 34.8 38.0 24.8 38.0 110-114 33.94015 38.0 34.0 38.0 23.0 38.0 115-119 33.439949999999996 38.0 33.6 38.0 17.4 38.0 120-124 32.807849999999995 37.2 32.4 38.0 15.0 38.0 125-129 32.501 37.0 32.0 38.0 15.0 38.0 130-134 31.7044 36.2 30.4 38.0 14.2 38.0 135-139 29.9471 34.2 26.2 38.0 13.2 38.0 140-144 28.5525 33.0 22.8 38.0 6.4 38.0 145-149 26.359299999999998 33.0 13.2 38.0 2.0 38.0 150-151 19.870625 17.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 3.0 6 0.0 7 4.0 8 1.0 9 1.0 10 2.0 11 2.0 12 4.0 13 2.0 14 3.0 15 8.0 16 2.0 17 9.0 18 7.0 19 6.0 20 7.0 21 17.0 22 23.0 23 19.0 24 27.0 25 41.0 26 48.0 27 47.0 28 65.0 29 80.0 30 93.0 31 127.0 32 191.0 33 256.0 34 380.0 35 582.0 36 1075.0 37 864.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.550000000000004 14.149999999999999 10.8 35.5 2 28.15 19.675 32.45 19.725 3 21.375 23.875 29.349999999999998 25.4 4 27.075 31.75 19.650000000000002 21.525 5 25.775 34.050000000000004 20.925 19.25 6 21.8 33.625 22.0 22.575 7 19.75 15.35 40.075 24.825 8 21.6 20.575 27.025 30.8 9 24.55 21.775 27.400000000000002 26.275 10-14 25.765 25.474999999999998 23.65 25.11 15-19 25.135 25.165 25.7 24.0 20-24 25.14 26.384999999999998 24.93 23.544999999999998 25-29 25.005 25.629999999999995 25.335 24.03 30-34 25.1 26.115 25.535000000000004 23.25 35-39 25.39 25.72 24.725 24.165 40-44 25.7 26.179999999999996 24.529999999999998 23.59 45-49 26.205000000000002 25.569999999999997 24.79 23.435 50-54 25.259999999999998 25.89 25.45 23.400000000000002 55-59 26.13 25.3 25.575 22.994999999999997 60-64 25.790000000000003 25.55 24.884999999999998 23.775 65-69 25.669999999999998 25.6 25.855 22.875 70-74 25.415 24.985 25.835 23.765 75-79 25.124999999999996 25.64 25.81 23.425 80-84 25.7 25.619999999999997 25.369999999999997 23.31 85-89 25.285000000000004 25.555 25.419999999999998 23.74 90-94 25.165 26.27 25.424999999999997 23.14 95-99 25.415 26.035000000000004 25.495 23.055 100-104 25.715 25.845000000000002 25.935000000000002 22.505 105-109 25.335 25.97 25.419999999999998 23.275000000000002 110-114 25.545 25.924999999999997 25.259999999999998 23.27 115-119 25.89 25.569999999999997 25.695 22.845 120-124 25.314999999999998 26.295 25.39 23.0 125-129 25.405 25.985000000000003 26.375 22.235 130-134 25.995 26.35 25.235000000000003 22.42 135-139 25.900000000000002 25.25 26.455000000000002 22.395 140-144 26.145000000000003 25.869999999999997 25.874999999999996 22.11 145-149 26.200000000000003 26.119999999999997 25.82 21.86 150-151 26.6625 25.4875 25.85 22.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 2.5 28 4.5 29 5.5 30 5.5 31 10.0 32 15.5 33 18.0 34 25.5 35 36.5 36 39.0 37 58.0 38 88.0 39 104.0 40 128.0 41 156.5 42 190.0 43 201.5 44 193.5 45 182.0 46 183.5 47 208.5 48 212.0 49 188.5 50 165.0 51 145.0 52 123.0 53 106.5 54 99.0 55 100.0 56 92.0 57 83.5 58 85.0 59 76.0 60 70.5 61 83.0 62 74.5 63 58.0 64 58.5 65 57.0 66 58.0 67 51.5 68 36.5 69 30.0 70 25.0 71 19.0 72 14.5 73 11.0 74 9.0 75 5.5 76 2.0 77 0.5 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.35175879396984927 0.7000000000000001 3 0.07537688442211055 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.3375 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.8 0.0 0.0 0.0 0.0 134-135 1.9625 0.0 0.0 0.0 0.0 136-137 2.0375 0.0 0.0 0.0 0.0 138-139 2.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra Read 985836 spots for SRR8846502.sra Written 985836 spots for SRR8846502.sra SRR ids: ['SRR8846502.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j1g1x94t SRR8846502.sra spots: 19716720 blocks: [[1, 985836], [985837, 1971672], [1971673, 2957508], [2957509, 3943344], [3943345, 4929180], [4929181, 5915016], [5915017, 6900852], [6900853, 7886688], [7886689, 8872524], [8872525, 9858360], [9858361, 10844196], [10844197, 11830032], [11830033, 12815868], [12815869, 13801704], [13801705, 14787540], [14787541, 15773376], [15773377, 16759212], [16759213, 17745048], [17745049, 18730884], [18730885, 19716720]] SRR8846502 file size 6659649 SRR8846502 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846502 SRR8846502_1.fastq SRR8846502_2.fastq Input file: SRR8846502_1.fastq Paired file: SRR8846502_2.fastq trimmed: SRR8846502-trimmed-pair1.fastq, SRR8846502-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 01:32:40 2024 >> started Mon Dec 9 01:35:10 2024 >> done (150.632s) 19716720 read pairs processed; of these: 14440 ( 0.07%) short read pairs filtered out after trimming by size control 13216 ( 0.07%) empty read pairs filtered out after trimming by size control 19689064 (99.86%) read pairs available; of these: 11563585 (58.73%) trimmed read pairs available after processing 8125479 (41.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 12 0.00% 20 7 0.00% 21 8 0.00% 22 9 0.00% 23 10 0.00% 24 17 0.00% 25 17 0.00% 26 11 0.00% 27 17 0.00% 28 14 0.00% 29 7 0.00% 30 13 0.00% 31 13 0.00% 32 11 0.00% 33 21 0.00% 34 14 0.00% 35 14 0.00% 36 10 0.00% 37 12 0.00% 38 17 0.00% 39 13 0.00% 40 15 0.00% 41 22 0.00% 42 21 0.00% 43 16 0.00% 44 19 0.00% 45 19 0.00% 46 21 0.00% 47 22 0.00% 48 22 0.00% 49 27 0.00% 50 27 0.00% 51 35 0.00% 52 39 0.00% 53 43 0.00% 54 53 0.00% 55 49 0.00% 56 58 0.00% 57 63 0.00% 58 70 0.00% 59 84 0.00% 60 110 0.00% 61 103 0.00% 62 102 0.00% 63 129 0.00% 64 132 0.00% 65 140 0.00% 66 179 0.00% 67 186 0.00% 68 214 0.00% 69 217 0.00% 70 255 0.00% 71 296 0.00% 72 330 0.00% 73 350 0.00% 74 452 0.00% 75 488 0.00% 76 541 0.00% 77 601 0.00% 78 680 0.00% 79 750 0.00% 80 890 0.00% 81 948 0.00% 82 1087 0.01% 83 1274 0.01% 84 1819 0.01% 85 2301 0.01% 86 2312 0.01% 87 2486 0.01% 88 2747 0.01% 89 2887 0.01% 90 2887 0.01% 91 3209 0.02% 92 3402 0.02% 93 3673 0.02% 94 4061 0.02% 95 4296 0.02% 96 4646 0.02% 97 4983 0.03% 98 5370 0.03% 99 6037 0.03% 100 6268 0.03% 101 6639 0.03% 102 7243 0.04% 103 7883 0.04% 104 8312 0.04% 105 9090 0.05% 106 9886 0.05% 107 10735 0.05% 108 11347 0.06% 109 12378 0.06% 110 13155 0.07% 111 13844 0.07% 112 14699 0.07% 113 15897 0.08% 114 17147 0.09% 115 18373 0.09% 116 19204 0.10% 117 20628 0.10% 118 22134 0.11% 119 24043 0.12% 120 25406 0.13% 121 27038 0.14% 122 28914 0.15% 123 30624 0.16% 124 32558 0.17% 125 35363 0.18% 126 37072 0.19% 127 40167 0.20% 128 43279 0.22% 129 46651 0.24% 130 50263 0.26% 131 54291 0.28% 132 59196 0.30% 133 64044 0.33% 134 70196 0.36% 135 76662 0.39% 136 84569 0.43% 137 92944 0.47% 138 104198 0.53% 139 117480 0.60% 140 132265 0.67% 141 151503 0.77% 142 176297 0.90% 143 208373 1.06% 144 253056 1.29% 145 320282 1.63% 146 426360 2.17% 147 596060 3.03% 148 863472 4.39% 149 1560923 7.93% 150 5416602 27.51% 151 8125479 41.27% 19689064 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=7.16 fanout-score-rank=14 prefix-density=0.85 prefix-fanout=1.8 sequence=TCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=37.35 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.9 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=5.69 fanout-score-rank=18 prefix-density=0.67 prefix-fanout=4.0 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=687.81 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=21.2 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846502 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 01:39:35 Started mapping on | Dec 09 01:39:35 Finished on | Dec 09 01:56:24 Mapping speed, Million of reads per hour | 70.25 Number of input reads | 19689064 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19155463 Uniquely mapped reads % | 97.29% Average mapped length | 295.74 Number of splices: Total | 22517012 Number of splices: Annotated (sjdb) | 21234498 Number of splices: GT/AG | 22224301 Number of splices: GC/AG | 265124 Number of splices: AT/AC | 11452 Number of splices: Non-canonical | 16135 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 155755 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 12113 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 387379 387379 387379 N_multimapping 155755 155755 155755 N_noFeature 793903 18631881 951694 N_ambiguous 426364 2789 61126 UnstrandedReadsAssigned:17935196 PositiveStrandReadsAssigned:520793 NegativeStrandReadsAssigned:18142643 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846502 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846502-trimmed-pair1.fastq SRR8846502-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,689,064 reads, 18,193,537 reads pseudoaligned [quant] estimated average fragment length: 279.581 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR8846502.ke.tsv 35125 SRR8846502.se.tsv 88098 total ==> SRR8846502.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 657.955 0 0 PNS24247 1044 765.419 72.74 7.68501 PNS24249 1928 1649.42 23.5808 1.1561 PNS24246 1044 765.419 72.74 7.68501 PNS24248 1044 765.419 72.74 7.68501 PNS24244 1471 1192.42 84.1991 5.71016 PNS24243 293 78.1626 0 0 KQK14069 1603 1324.42 4644.72 283.598 KQK14071 474 214.383 50.5951 19.0848 ==> SRR8846502.se.tsv <== BRADI_1g14170v3 5251 BRADI_1g53295v3 107 BRADI_1g59795v3 342 BRADI_1g07683v3 0 BRADI_1g00485v3 58 BRADI_1g20270v3 2640 BRADI_1g74790v3 126 BRADI_1g09890v3 0 BRADI_1g77505v3 365 BRADI_1g48960v3 0 SRR8846502 completed mapping pipeline successfully