Starting /dee2/code/volunteer_pipeline.sh SRR8846504 current disk space = 1504281112576 free memory = 1364193036 SRR8846504 SRAfilesize be646c8c700216f154ca52aebc9c0770 SRR8846504.sra SRR8846504.sra file validated SRR8846504 is single end SRR8846504 is conventional basespace SRR8846504 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846504_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 41 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54775 33.0 32.0 33.0 32.0 34.0 2 32.77325 33.0 32.0 34.0 32.0 34.0 3 32.706 33.0 32.0 34.0 32.0 34.0 4 32.6725 33.0 32.0 34.0 32.0 34.0 5 32.51125 33.0 32.0 34.0 32.0 34.0 6 35.0485 37.0 33.0 37.0 32.0 37.0 7 34.92225 37.0 33.0 37.0 32.0 37.0 8 34.92075 37.0 33.0 37.0 32.0 37.0 9 35.0495 37.0 33.0 37.0 32.0 37.0 10 35.038 37.0 33.0 37.0 32.0 37.0 11 35.153 37.0 34.0 37.0 32.0 37.0 12 35.20875 37.0 34.0 37.0 32.0 37.0 13 37.014 38.0 38.0 38.0 36.0 38.0 14 37.04 38.0 38.0 38.0 36.0 38.0 15 36.99575 38.0 38.0 38.0 36.0 38.0 16 37.10925 38.0 38.0 38.0 37.0 38.0 17 36.988 38.0 38.0 38.0 36.0 38.0 18 37.0315 38.0 38.0 38.0 36.0 38.0 19 37.05675 38.0 38.0 38.0 36.0 38.0 20 37.01475 38.0 38.0 38.0 36.0 38.0 21 36.91775 38.0 38.0 38.0 36.0 38.0 22 36.886 38.0 38.0 38.0 36.0 38.0 23 37.41475 39.0 38.0 39.0 36.0 39.0 24 37.636 39.0 38.0 39.0 36.0 39.0 25 37.5365 39.0 38.0 39.0 36.0 39.0 26 37.462 39.0 38.0 39.0 36.0 39.0 27 37.29475 39.0 38.0 39.0 35.0 39.0 28 37.4165 39.0 38.0 39.0 36.0 39.0 29 37.58375 39.0 38.0 39.0 36.0 39.0 30 37.571 39.0 38.0 39.0 36.0 39.0 31 37.44675 39.0 38.0 39.0 36.0 39.0 32 37.37275 39.0 38.0 39.0 36.0 39.0 33 37.4895 39.0 38.0 39.0 36.0 39.0 34 37.59325 39.0 38.0 39.0 36.0 39.0 35 37.4505 39.0 38.0 39.0 36.0 39.0 36 37.404 39.0 38.0 39.0 35.0 39.0 37 37.37325 39.0 38.0 39.0 36.0 39.0 38 37.46425 39.0 38.0 39.0 36.0 39.0 39 37.494 39.0 38.0 39.0 36.0 39.0 40 37.424 39.0 38.0 39.0 36.0 39.0 41 37.34875 39.0 38.0 39.0 35.0 39.0 42 37.35725 39.0 38.0 39.0 36.0 39.0 43 37.198 39.0 38.0 39.0 35.0 39.0 44 37.38475 39.0 38.0 39.0 36.0 39.0 45 37.368 39.0 38.0 39.0 36.0 39.0 46 37.564 39.0 38.0 39.0 36.0 39.0 47 37.2665 39.0 38.0 39.0 36.0 39.0 48 37.57 39.0 38.0 39.0 36.0 39.0 49 37.41875 39.0 38.0 39.0 36.0 39.0 50 37.34025 39.0 38.0 39.0 36.0 39.0 51 37.05975 39.0 38.0 39.0 36.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 3.0 26 9.0 27 14.0 28 27.0 29 31.0 30 50.0 31 54.0 32 93.0 33 105.0 34 159.0 35 265.0 36 589.0 37 2547.0 38 47.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.325000000000003 17.299999999999997 39.7 13.675 2 33.525 16.275000000000002 36.325 13.875000000000002 3 34.725 17.05 35.075 13.15 4 34.75 17.875 35.125 12.25 5 35.375 16.875 34.949999999999996 12.8 6 35.325 15.525 36.199999999999996 12.950000000000001 7 34.075 14.674999999999999 37.55 13.700000000000001 8 33.025 14.825 38.05 14.099999999999998 9 32.5 15.0 37.175000000000004 15.325 10 30.175 16.325 37.025000000000006 16.475 11 27.900000000000002 17.724999999999998 39.0 15.375 12 28.525 20.575 35.475 15.425 13 23.35 23.3 38.824999999999996 14.524999999999999 14 23.275000000000002 25.424999999999997 36.8 14.499999999999998 15 23.65 24.95 36.075 15.325 16 23.474999999999998 26.174999999999997 35.099999999999994 15.25 17 24.25 25.05 35.55 15.15 18 23.75 25.3 36.025 14.924999999999999 19 23.825 24.9 34.775 16.5 20 23.400000000000002 26.150000000000002 34.775 15.675 21 23.575 24.275 34.2 17.95 22 22.8 25.6 34.425 17.175 23 22.900000000000002 24.325 35.075 17.7 24 24.2 25.224999999999998 34.55 16.025 25 23.599999999999998 24.875 34.775 16.75 26 24.4 25.4 32.375 17.825 27 22.725 26.75 32.574999999999996 17.95 28 23.825 25.174999999999997 33.225 17.775 29 23.1 26.0 34.075 16.825000000000003 30 23.375 25.6 33.775 17.25 31 22.55 26.0 33.7 17.75 32 24.0 25.8 33.15 17.05 33 23.400000000000002 26.150000000000002 33.175 17.275 34 23.425 25.75 33.825 17.0 35 21.75 27.3 34.175 16.775000000000002 36 22.325 27.025 32.85 17.8 37 21.8 27.800000000000004 32.975 17.424999999999997 38 21.875 26.575 34.2 17.349999999999998 39 22.225 26.55 33.825 17.4 40 22.3 27.175 32.85 17.675 41 21.8 27.950000000000003 32.574999999999996 17.675 42 21.7 28.1 32.875 17.325 43 20.825 27.05 34.525 17.599999999999998 44 21.5 28.299999999999997 33.625 16.575 45 21.975 27.525 33.650000000000006 16.85 46 21.4 27.575 33.300000000000004 17.724999999999998 47 21.45 29.675 31.924999999999997 16.950000000000003 48 20.625 27.625 34.25 17.5 49 21.025 29.175 33.550000000000004 16.25 50 21.6 29.75 31.85 16.8 51 21.85 28.65 32.775 16.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 5.5 2 2.0 3 4.0 4 6.0 5 3.0 6 0.0 7 5.0 8 10.0 9 9.5 10 9.0 11 9.0 12 9.0 13 7.0 14 5.0 15 7.0 16 9.0 17 9.0 18 9.0 19 8.5 20 8.0 21 14.5 22 21.0 23 28.5 24 36.0 25 41.5 26 57.0 27 67.0 28 73.5 29 80.0 30 123.5 31 167.0 32 210.5 33 254.0 34 274.0 35 294.0 36 333.5 37 373.0 38 384.5 39 396.0 40 398.0 41 400.0 42 403.0 43 406.0 44 384.5 45 363.0 46 304.0 47 245.0 48 230.0 49 215.0 50 188.5 51 162.0 52 132.5 53 103.0 54 93.5 55 84.0 56 73.0 57 62.0 58 52.5 59 43.0 60 41.5 61 40.0 62 30.5 63 21.0 64 15.5 65 10.0 66 9.5 67 9.0 68 9.0 69 9.0 70 7.5 71 6.0 72 5.0 73 4.0 74 3.5 75 2.5 76 2.0 77 2.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47116595316041 98.75 2 0.4784688995215311 0.95 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02518257365902795 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.125 0.0 0.0 0.0 0.0 29 0.125 0.0 0.0 0.0 0.0 30 0.125 0.0 0.0 0.0 0.0 31 0.175 0.0 0.0 0.0 0.0 32 0.225 0.0 0.0 0.0 0.0 33 0.3 0.0 0.0 0.0 0.0 34 0.375 0.0 0.0 0.0 0.0 35 0.375 0.0 0.0 0.0 0.0 36 0.375 0.0 0.0 0.0 0.0 37 0.375 0.0 0.0 0.0 0.0 38 0.375 0.0 0.0 0.0 0.0 39 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343560 READS because READLEN < 1 Read 343560 spots for SRR8846504.sra Written 343560 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra Rejected 343547 READS because READLEN < 1 Read 343547 spots for SRR8846504.sra Written 343547 spots for SRR8846504.sra SRR ids: ['SRR8846504.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dltyi7co SRR8846504.sra spots: 6870953 blocks: [[1, 343547], [343548, 687094], [687095, 1030641], [1030642, 1374188], [1374189, 1717735], [1717736, 2061282], [2061283, 2404829], [2404830, 2748376], [2748377, 3091923], [3091924, 3435470], [3435471, 3779017], [3779018, 4122564], [4122565, 4466111], [4466112, 4809658], [4809659, 5153205], [5153206, 5496752], [5496753, 5840299], [5840300, 6183846], [6183847, 6527393], [6527394, 6870953]] SRR8846504 file size 964058 SRR8846504 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846504 SRR8846504_1.fastq Input file: SRR8846504_1.fastq trimmed: SRR8846504-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 02:28:28 2024 >> started Mon Dec 9 02:28:43 2024 >> done (15.484s) 6870953 reads processed; of these: 570 ( 0.01%) short reads filtered out after trimming by size control 213 ( 0.00%) empty reads filtered out after trimming by size control 6870170 (99.99%) reads available; of these: 100505 ( 1.46%) trimmed reads available after processing 6769665 (98.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 233 0.00% 19 324 0.00% 20 49 0.00% 21 65 0.00% 22 77 0.00% 23 123 0.00% 24 162 0.00% 25 194 0.00% 26 202 0.00% 27 250 0.00% 28 289 0.00% 29 388 0.01% 30 520 0.01% 31 597 0.01% 32 681 0.01% 33 740 0.01% 34 834 0.01% 35 1036 0.02% 36 1167 0.02% 37 1250 0.02% 38 1556 0.02% 39 1615 0.02% 40 1784 0.03% 41 2185 0.03% 42 2471 0.04% 43 2916 0.04% 44 3341 0.05% 45 4017 0.06% 46 5579 0.08% 47 7153 0.10% 48 9476 0.14% 49 16880 0.25% 50 32351 0.47% 51 6769665 98.54% 6870170 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=10.25 fanout-score-rank=17 prefix-density=0.21 prefix-fanout=10.2 sequence=TTGTTGTTGTGTATCGATGTGTGTTTGTTTGAATGTTCCTGTTTTCCGTTAAATTTGGCTCTCCTTTTTGAAGGAGACACGTCATGTGCTACACATCTCTTGATATTTATCTACCACATGTTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=7 fanout-score=106.73 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=12.9 sequence=TGTTGTTGTGTGTAGCAACCTGGCTCTCGATCGAGGAGCTAGCTTGCATATGTGAATTCC Started job on | Dec 09 02:30:11 Started mapping on | Dec 09 02:30:11 Finished on | Dec 09 02:31:28 Mapping speed, Million of reads per hour | 321.20 Number of input reads | 6870170 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 6290429 Uniquely mapped reads % | 91.56% Average mapped length | 49.31 Number of splices: Total | 91855 Number of splices: Annotated (sjdb) | 66052 Number of splices: GT/AG | 83245 Number of splices: GC/AG | 1940 Number of splices: AT/AC | 34 Number of splices: Non-canonical | 6636 Mismatch rate per base, % | 0.66% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 400722 % of reads mapped to multiple loci | 5.83% Number of reads mapped to too many loci | 26696 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 179019 179019 179019 N_multimapping 400722 400722 400722 N_noFeature 316805 400022 6076678 N_ambiguous 140233 9518 760 UnstrandedReadsAssigned:5833391 PositiveStrandReadsAssigned:5880889 NegativeStrandReadsAssigned:212991 Dataset is classified positive stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR8846504 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8846504-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,870,170 reads, 5,646,369 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR8846504.ke.tsv 35125 SRR8846504.se.tsv 88098 total ==> SRR8846504.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 114 18.7005 PNS24243 293 194 0 0 KQK14069 1603 1504 2394.96 358.388 KQK14071 474 375 1.03638 0.622001 ==> SRR8846504.se.tsv <== BRADI_1g14170v3 2404 BRADI_1g53295v3 14 BRADI_1g59795v3 30 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 284 BRADI_1g74790v3 29 BRADI_1g09890v3 3 BRADI_1g77505v3 92 BRADI_1g48960v3 0 SRR8846504 completed mapping pipeline successfully