Starting /dee2/code/volunteer_pipeline.sh SRR8846511 current disk space = 1515370729472 free memory = 1598131568 SRR8846511 SRAfilesize 5c139cdaf1f69984dc9326acf12d18b3 SRR8846511.sra SRR8846511.sra file validated SRR8846511 is paired end SRR8846511 is conventional basespace SRR8846511 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846511_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.47375 25.0 18.0 32.0 18.0 33.0 2 29.214 30.0 27.0 33.0 25.0 33.0 3 31.88 33.0 32.0 33.0 28.0 33.0 4 30.44425 31.0 31.0 33.0 28.0 33.0 5 31.716 33.0 32.0 33.0 30.0 33.0 6 36.08875 38.0 36.0 38.0 33.0 38.0 7 36.723 38.0 37.0 38.0 34.0 38.0 8 37.07275 38.0 38.0 38.0 36.0 38.0 9 37.2955 38.0 38.0 38.0 37.0 38.0 10-14 37.1939 38.0 38.0 38.0 36.0 38.0 15-19 37.1447 38.0 38.0 38.0 36.0 38.0 20-24 37.193599999999996 38.0 38.0 38.0 36.4 38.0 25-29 37.28735 38.0 38.0 38.0 36.8 38.0 30-34 37.26645 38.0 38.0 38.0 37.0 38.0 35-39 37.13765 38.0 38.0 38.0 36.2 38.0 40-44 36.9437 38.0 38.0 38.0 35.6 38.0 45-49 36.895050000000005 38.0 38.0 38.0 35.4 38.0 50-54 36.9667 38.0 38.0 38.0 35.6 38.0 55-59 36.826 38.0 38.0 38.0 34.8 38.0 60-64 36.635650000000005 38.0 38.0 38.0 34.2 38.0 65-69 36.55245 38.0 38.0 38.0 34.0 38.0 70-74 36.45055 38.0 37.6 38.0 33.6 38.0 75-79 36.349599999999995 38.0 37.0 38.0 33.4 38.0 80-84 36.185 38.0 37.0 38.0 33.0 38.0 85-89 35.73094999999999 38.0 36.8 38.0 30.6 38.0 90-94 35.37975 38.0 36.0 38.0 29.0 38.0 95-99 35.26155 38.0 36.0 38.0 29.0 38.0 100-104 35.255 38.0 35.4 38.0 28.8 38.0 105-109 35.129850000000005 38.0 35.2 38.0 28.6 38.0 110-114 34.229499999999994 38.0 34.2 38.0 23.8 38.0 115-119 33.54255 37.6 33.4 38.0 17.8 38.0 120-124 33.6791 37.8 34.0 38.0 22.2 38.0 125-129 33.200599999999994 37.0 33.2 38.0 17.4 38.0 130-134 32.4288 36.2 31.4 38.0 15.0 38.0 135-139 31.251500000000004 35.4 28.4 38.0 14.0 38.0 140-144 30.467600000000004 35.0 27.2 38.0 13.8 38.0 145-149 29.098249999999997 33.8 25.2 38.0 6.4 38.0 150-151 24.258000000000003 31.0 12.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 6.0 19 1.0 20 1.0 21 6.0 22 7.0 23 17.0 24 13.0 25 30.0 26 36.0 27 31.0 28 59.0 29 84.0 30 96.0 31 129.0 32 163.0 33 253.0 34 394.0 35 626.0 36 1244.0 37 802.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.661514683153015 21.251931993817617 7.2642967542503865 44.822256568778975 2 22.95 21.25 33.825 21.975 3 19.55 28.849999999999998 25.324999999999996 26.275 4 24.025 30.85 21.575 23.549999999999997 5 23.7 32.225 24.099999999999998 19.975 6 19.25 32.65 23.849999999999998 24.25 7 15.075 19.85 42.375 22.7 8 18.8 21.224999999999998 28.95 31.025000000000002 9 19.2 19.45 31.775 29.575000000000003 10-14 23.105 25.14 24.6 27.155 15-19 22.56 25.705 26.479999999999997 25.255 20-24 22.25 26.545 26.135 25.069999999999997 25-29 22.205 26.32 26.46 25.014999999999997 30-34 22.58 25.82 26.555 25.045 35-39 22.38 26.150000000000002 26.355 25.115 40-44 22.535 26.314999999999998 26.465 24.685000000000002 45-49 22.285 26.305 25.6 25.81 50-54 22.185 25.94 26.26 25.615 55-59 22.41 25.82 26.21 25.56 60-64 22.35 25.790000000000003 26.76 25.1 65-69 22.415 26.064999999999998 26.38 25.14 70-74 22.650000000000002 26.125 26.064999999999998 25.16 75-79 22.770000000000003 25.669999999999998 26.345000000000002 25.215 80-84 23.07 26.085 26.150000000000002 24.695 85-89 22.43 25.71 26.365 25.495 90-94 22.685 25.97 26.224999999999998 25.119999999999997 95-99 23.075000000000003 24.905 26.66 25.36 100-104 22.95 25.71 25.865 25.474999999999998 105-109 23.185 25.345000000000002 26.415 25.055 110-114 22.78 26.215 25.895000000000003 25.11 115-119 23.125 25.915 25.790000000000003 25.169999999999998 120-124 22.85 25.91 25.91 25.330000000000002 125-129 23.119999999999997 25.324999999999996 26.58 24.975 130-134 23.07 25.564999999999998 26.32 25.045 135-139 23.43 25.615 26.02 24.935 140-144 22.814999999999998 25.28 26.11 25.795 145-149 23.435 25.155 26.035000000000004 25.374999999999996 150-151 23.5125 24.575 26.55 25.362499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 1.5 27 0.5 28 2.0 29 6.5 30 10.5 31 10.5 32 16.0 33 20.5 34 28.0 35 37.0 36 53.5 37 76.5 38 99.5 39 126.5 40 150.5 41 177.5 42 195.5 43 206.0 44 220.0 45 219.5 46 214.5 47 209.0 48 195.0 49 187.0 50 173.5 51 146.0 52 129.0 53 111.5 54 97.0 55 97.0 56 82.5 57 71.5 58 70.0 59 67.5 60 64.5 61 58.0 62 53.0 63 52.5 64 51.0 65 42.5 66 33.0 67 30.0 68 24.0 69 18.0 70 15.0 71 12.5 72 13.0 73 10.0 74 6.0 75 3.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0125 0.0 0.0 0.0 0.025 86-87 0.05 0.0 0.0 0.0 0.025 88-89 0.05 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.05 0.0 0.0 0.0 0.025 96-97 0.05 0.0 0.0 0.0 0.025 98-99 0.05 0.0 0.0 0.0 0.025 100-101 0.05 0.0 0.0 0.0 0.025 102-103 0.0625 0.0 0.0 0.0 0.025 104-105 0.1125 0.0 0.0 0.0 0.025 106-107 0.2 0.0 0.0 0.0 0.025 108-109 0.21250000000000002 0.0 0.0 0.0 0.025 110-111 0.3125 0.0 0.0 0.0 0.025 112-113 0.4125 0.0 0.0 0.0 0.025 114-115 0.4875 0.0 0.0 0.0 0.025 116-117 0.6 0.0 0.0 0.0 0.025 118-119 0.7 0.0 0.0 0.0 0.025 120-121 0.7625 0.0 0.0 0.0 0.025 122-123 0.8875 0.0 0.0 0.0 0.025 124-125 1.025 0.0 0.0 0.0 0.025 126-127 1.1375000000000002 0.0 0.0 0.0 0.025 128-129 1.275 0.0 0.0 0.0 0.025 130-131 1.5375 0.0 0.0 0.0 0.025 132-133 1.6375 0.0 0.0 0.0 0.025 134-135 1.7374999999999998 0.0 0.0 0.0 0.025 136-137 1.8624999999999998 0.0 0.0 0.0 0.025 138-139 1.975 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8846511 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846511_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68425 33.0 33.0 34.0 32.0 34.0 2 32.66575 33.0 33.0 34.0 32.0 34.0 3 32.521 33.0 33.0 34.0 31.0 34.0 4 32.75 33.0 33.0 34.0 32.0 34.0 5 32.66625 33.0 33.0 34.0 32.0 34.0 6 36.88825 38.0 38.0 38.0 35.0 38.0 7 36.8115 38.0 38.0 38.0 35.0 38.0 8 36.9955 38.0 38.0 38.0 36.0 38.0 9 36.82375 38.0 38.0 38.0 35.0 38.0 10-14 36.8551 38.0 38.0 38.0 35.6 38.0 15-19 36.87675 38.0 38.0 38.0 35.6 38.0 20-24 36.814550000000004 38.0 38.0 38.0 35.4 38.0 25-29 36.7616 38.0 38.0 38.0 35.0 38.0 30-34 36.650150000000004 38.0 38.0 38.0 34.6 38.0 35-39 36.56665 38.0 38.0 38.0 34.2 38.0 40-44 36.608050000000006 38.0 38.0 38.0 34.6 38.0 45-49 36.5521 38.0 38.0 38.0 34.2 38.0 50-54 36.4031 38.0 38.0 38.0 33.4 38.0 55-59 36.066199999999995 38.0 37.4 38.0 32.2 38.0 60-64 36.24785 38.0 38.0 38.0 33.2 38.0 65-69 36.3 38.0 38.0 38.0 33.8 38.0 70-74 36.23565 38.0 37.6 38.0 33.2 38.0 75-79 35.8512 38.0 37.0 38.0 31.4 38.0 80-84 35.73235 38.0 37.0 38.0 31.0 38.0 85-89 35.58825 38.0 36.6 38.0 30.2 38.0 90-94 35.4525 38.0 36.2 38.0 29.6 38.0 95-99 35.158100000000005 38.0 35.8 38.0 28.4 38.0 100-104 34.756150000000005 38.0 35.0 38.0 26.4 38.0 105-109 34.5181 38.0 34.6 38.0 25.6 38.0 110-114 34.066050000000004 38.0 34.4 38.0 23.8 38.0 115-119 33.6125 38.0 34.0 38.0 19.0 38.0 120-124 33.116099999999996 37.6 33.2 38.0 16.2 38.0 125-129 32.45465 36.4 31.8 38.0 15.0 38.0 130-134 32.02485 36.2 31.0 38.0 14.6 38.0 135-139 30.708500000000004 35.4 28.6 38.0 13.2 38.0 140-144 29.547050000000002 33.8 26.0 38.0 10.4 38.0 145-149 27.817 33.0 21.2 38.0 2.0 38.0 150-151 20.7405 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 1.0 13 2.0 14 3.0 15 3.0 16 6.0 17 7.0 18 7.0 19 8.0 20 10.0 21 16.0 22 20.0 23 25.0 24 28.0 25 37.0 26 45.0 27 49.0 28 62.0 29 78.0 30 98.0 31 134.0 32 158.0 33 225.0 34 317.0 35 533.0 36 1086.0 37 1031.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.949999999999996 14.35 12.425 37.275000000000006 2 29.95 19.625 31.4 19.025 3 22.175 22.375 30.825000000000003 24.625 4 26.55 31.924999999999997 18.9 22.625 5 26.825 34.225 19.25 19.7 6 21.025 36.075 20.8 22.1 7 21.0 15.675 38.5 24.825 8 21.575 20.3 25.15 32.975 9 22.125 21.475 28.249999999999996 28.15 10-14 26.38 24.37 23.665 25.585 15-19 25.835 25.47 24.605 24.09 20-24 25.515 26.13 24.169999999999998 24.185000000000002 25-29 24.965 25.915 24.695 24.425 30-34 25.074999999999996 26.05 25.0 23.875 35-39 25.645 25.979999999999997 24.47 23.905 40-44 26.484999999999996 26.064999999999998 24.145 23.305 45-49 25.480000000000004 25.535000000000004 24.965 24.02 50-54 25.405 25.715 25.035 23.845 55-59 25.965 25.71 24.404999999999998 23.919999999999998 60-64 25.34 25.759999999999998 25.480000000000004 23.419999999999998 65-69 25.540000000000003 25.045 25.509999999999998 23.905 70-74 25.09 25.564999999999998 25.21 24.135 75-79 25.665 25.46 25.224999999999998 23.65 80-84 25.525 26.22 25.0 23.255 85-89 26.08 25.919999999999998 24.685000000000002 23.315 90-94 25.205 25.424999999999997 25.629999999999995 23.74 95-99 25.974999999999998 25.575 25.074999999999996 23.375 100-104 25.885 26.02 25.009999999999998 23.085 105-109 25.4 26.095000000000002 25.03 23.474999999999998 110-114 25.465 26.135 25.145 23.255 115-119 25.77 25.855 25.085 23.29 120-124 25.845000000000002 26.11 24.55 23.494999999999997 125-129 25.729999999999997 26.305 24.959999999999997 23.005 130-134 25.585 26.305 25.009999999999998 23.1 135-139 26.1 25.629999999999995 25.295 22.975 140-144 25.845000000000002 26.090000000000003 25.515 22.55 145-149 25.724999999999998 26.43 25.255 22.59 150-151 26.025 25.074999999999996 26.8375 22.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.5 27 2.0 28 2.0 29 4.0 30 9.0 31 8.0 32 7.5 33 17.0 34 26.5 35 33.5 36 39.5 37 55.0 38 76.5 39 98.0 40 119.5 41 136.0 42 168.5 43 184.5 44 199.5 45 208.0 46 196.0 47 208.5 48 200.5 49 177.5 50 167.0 51 145.0 52 125.0 53 111.0 54 97.5 55 93.5 56 91.5 57 95.0 58 96.5 59 96.0 60 79.5 61 62.0 62 66.5 63 72.5 64 64.5 65 52.5 66 54.5 67 56.0 68 49.0 69 41.5 70 31.5 71 18.0 72 17.0 73 16.5 74 8.5 75 4.0 76 2.0 77 2.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5284348263714143 1.05 3 0.025163563160543533 0.075 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.1124999999999998 0.0 0.0 0.0 0.0 128-129 1.2375 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.5625 0.0 0.0 0.0 0.0 134-135 1.675 0.0 0.0 0.0 0.0 136-137 1.825 0.0 0.0 0.0 0.0 138-139 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010786 spots for SRR8846511.sra Written 1010786 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra Read 1010776 spots for SRR8846511.sra Written 1010776 spots for SRR8846511.sra SRR ids: ['SRR8846511.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_phgt1kzn SRR8846511.sra spots: 20215530 blocks: [[1, 1010776], [1010777, 2021552], [2021553, 3032328], [3032329, 4043104], [4043105, 5053880], [5053881, 6064656], [6064657, 7075432], [7075433, 8086208], [8086209, 9096984], [9096985, 10107760], [10107761, 11118536], [11118537, 12129312], [12129313, 13140088], [13140089, 14150864], [14150865, 15161640], [15161641, 16172416], [16172417, 17183192], [17183193, 18193968], [18193969, 19204744], [19204745, 20215530]] SRR8846511 file size 6828679 SRR8846511 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846511 SRR8846511_1.fastq SRR8846511_2.fastq Input file: SRR8846511_1.fastq Paired file: SRR8846511_2.fastq trimmed: SRR8846511-trimmed-pair1.fastq, SRR8846511-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:51:52 2024 >> started Thu Dec 12 02:52:16 2024 >> done (23.827s) 20215530 read pairs processed; of these: 14026 ( 0.07%) short read pairs filtered out after trimming by size control 10252 ( 0.05%) empty read pairs filtered out after trimming by size control 20191252 (99.88%) read pairs available; of these: 11359877 (56.26%) trimmed read pairs available after processing 8831375 (43.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 5 0.00% 21 10 0.00% 22 12 0.00% 23 8 0.00% 24 18 0.00% 25 14 0.00% 26 5 0.00% 27 8 0.00% 28 9 0.00% 29 11 0.00% 30 14 0.00% 31 14 0.00% 32 8 0.00% 33 14 0.00% 34 19 0.00% 35 11 0.00% 36 12 0.00% 37 22 0.00% 38 6 0.00% 39 15 0.00% 40 18 0.00% 41 22 0.00% 42 25 0.00% 43 22 0.00% 44 16 0.00% 45 20 0.00% 46 27 0.00% 47 26 0.00% 48 23 0.00% 49 31 0.00% 50 37 0.00% 51 29 0.00% 52 40 0.00% 53 41 0.00% 54 62 0.00% 55 53 0.00% 56 57 0.00% 57 70 0.00% 58 80 0.00% 59 86 0.00% 60 110 0.00% 61 117 0.00% 62 124 0.00% 63 129 0.00% 64 162 0.00% 65 160 0.00% 66 187 0.00% 67 209 0.00% 68 209 0.00% 69 271 0.00% 70 326 0.00% 71 307 0.00% 72 413 0.00% 73 442 0.00% 74 501 0.00% 75 505 0.00% 76 623 0.00% 77 634 0.00% 78 682 0.00% 79 786 0.00% 80 889 0.00% 81 1033 0.01% 82 1212 0.01% 83 1386 0.01% 84 2022 0.01% 85 2396 0.01% 86 2434 0.01% 87 2563 0.01% 88 2783 0.01% 89 2901 0.01% 90 3114 0.02% 91 3251 0.02% 92 3454 0.02% 93 3782 0.02% 94 4145 0.02% 95 4427 0.02% 96 4584 0.02% 97 5125 0.03% 98 5330 0.03% 99 5747 0.03% 100 6080 0.03% 101 6728 0.03% 102 7137 0.04% 103 7498 0.04% 104 8274 0.04% 105 8741 0.04% 106 9673 0.05% 107 10068 0.05% 108 10843 0.05% 109 11485 0.06% 110 12313 0.06% 111 13094 0.06% 112 13850 0.07% 113 15019 0.07% 114 16063 0.08% 115 16925 0.08% 116 18049 0.09% 117 19059 0.09% 118 20434 0.10% 119 21869 0.11% 120 23315 0.12% 121 24890 0.12% 122 26205 0.13% 123 28225 0.14% 124 30130 0.15% 125 32247 0.16% 126 33768 0.17% 127 36434 0.18% 128 38978 0.19% 129 42271 0.21% 130 45790 0.23% 131 49204 0.24% 132 53230 0.26% 133 57697 0.29% 134 62943 0.31% 135 69207 0.34% 136 76101 0.38% 137 83477 0.41% 138 93509 0.46% 139 105301 0.52% 140 119180 0.59% 141 135579 0.67% 142 159795 0.79% 143 190201 0.94% 144 230097 1.14% 145 292516 1.45% 146 390714 1.94% 147 554290 2.75% 148 807878 4.00% 149 1495736 7.41% 150 5647261 27.97% 151 8831375 43.74% 20191252 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=8 prefix-density=0.86 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=11.87 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=2.8 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=11 prefix-density=0.78 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=185.01 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=11.8 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR8846511 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:52:56 Started mapping on | Dec 12 02:52:56 Finished on | Dec 12 02:54:49 Mapping speed, Million of reads per hour | 643.26 Number of input reads | 20191252 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19739629 Uniquely mapped reads % | 97.76% Average mapped length | 296.26 Number of splices: Total | 22742796 Number of splices: Annotated (sjdb) | 21521635 Number of splices: GT/AG | 22453494 Number of splices: GC/AG | 262803 Number of splices: AT/AC | 10902 Number of splices: Non-canonical | 15597 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 159841 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 11122 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 301240 301240 301240 N_multimapping 159841 159841 159841 N_noFeature 683005 19181758 841658 N_ambiguous 466696 2693 68360 UnstrandedReadsAssigned:18589928 PositiveStrandReadsAssigned:555178 NegativeStrandReadsAssigned:18829611 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846511 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846511-trimmed-pair1.fastq SRR8846511-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,191,252 reads, 18,880,012 reads pseudoaligned [quant] estimated average fragment length: 280.616 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52973 SRR8846511.ke.tsv 35125 SRR8846511.se.tsv 88098 total ==> SRR8846511.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.873 0 0 PNS24247 1044 764.384 57.9149 5.76398 PNS24249 1928 1648.38 28.3051 1.30632 PNS24246 1044 764.384 57.9149 5.76398 PNS24248 1044 764.384 57.9149 5.76398 PNS24244 1471 1191.38 19.9501 1.27391 PNS24243 293 74.3231 0 0 KQK14069 1603 1323.38 2114.13 121.532 KQK14071 474 211.219 56.7289 20.4322 ==> SRR8846511.se.tsv <== BRADI_1g14170v3 2861 BRADI_1g53295v3 78 BRADI_1g59795v3 812 BRADI_1g07683v3 0 BRADI_1g00485v3 77 BRADI_1g20270v3 3576 BRADI_1g74790v3 52 BRADI_1g09890v3 1 BRADI_1g77505v3 263 BRADI_1g48960v3 0 SRR8846511 completed mapping pipeline successfully