Starting /dee2/code/volunteer_pipeline.sh SRR8846512 current disk space = 1515363643392 free memory = 1598127728 SRR8846512 SRAfilesize 541a26ce3717db13cad018f80334e9af SRR8846512.sra SRR8846512.sra file validated SRR8846512 is paired end SRR8846512 is conventional basespace SRR8846512 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846512_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.3665 25.0 18.0 32.0 18.0 33.0 2 29.6135 31.0 27.0 33.0 25.0 33.0 3 31.899 33.0 32.0 33.0 28.0 33.0 4 32.26025 33.0 33.0 33.0 31.0 34.0 5 32.6515 33.0 33.0 34.0 32.0 34.0 6 36.89325 38.0 38.0 38.0 35.0 38.0 7 36.93275 38.0 38.0 38.0 35.0 38.0 8 37.11425 38.0 38.0 38.0 36.0 38.0 9 37.40075 38.0 38.0 38.0 37.0 38.0 10-14 37.30120000000001 38.0 38.0 38.0 36.8 38.0 15-19 37.192099999999996 38.0 38.0 38.0 36.0 38.0 20-24 37.244299999999996 38.0 38.0 38.0 36.4 38.0 25-29 37.42815 38.0 38.0 38.0 37.0 38.0 30-34 37.36305 38.0 38.0 38.0 37.0 38.0 35-39 37.2528 38.0 38.0 38.0 36.6 38.0 40-44 36.94350000000001 38.0 38.0 38.0 35.6 38.0 45-49 36.91709999999999 38.0 38.0 38.0 35.4 38.0 50-54 37.093450000000004 38.0 38.0 38.0 35.8 38.0 55-59 36.866949999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.72925 38.0 38.0 38.0 34.2 38.0 65-69 36.62785 38.0 38.0 38.0 34.0 38.0 70-74 36.50705000000001 38.0 37.6 38.0 33.8 38.0 75-79 36.49465 38.0 37.2 38.0 34.0 38.0 80-84 36.2379 38.0 37.0 38.0 33.2 38.0 85-89 35.87725 38.0 36.6 38.0 31.6 38.0 90-94 35.3408 38.0 35.8 38.0 28.8 38.0 95-99 35.45975 38.0 36.0 38.0 29.4 38.0 100-104 35.474149999999995 38.0 35.8 38.0 29.4 38.0 105-109 34.9797 38.0 35.0 38.0 27.8 38.0 110-114 34.04845 38.0 33.8 38.0 22.0 38.0 115-119 33.5317 37.4 33.4 38.0 19.0 38.0 120-124 33.919650000000004 38.0 34.0 38.0 23.0 38.0 125-129 33.365449999999996 37.0 33.4 38.0 19.8 38.0 130-134 32.268449999999994 36.2 30.8 38.0 15.0 38.0 135-139 31.200850000000003 35.2 28.6 38.0 14.0 38.0 140-144 30.407899999999994 35.0 27.2 38.0 13.8 38.0 145-149 28.932949999999998 33.8 24.2 38.0 6.4 38.0 150-151 23.958 30.5 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 2.0 18 0.0 19 3.0 20 4.0 21 4.0 22 5.0 23 11.0 24 9.0 25 23.0 26 30.0 27 37.0 28 56.0 29 61.0 30 83.0 31 119.0 32 179.0 33 277.0 34 407.0 35 739.0 36 1154.0 37 794.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.296920242168994 19.505132929718346 8.212687549355094 43.98525927875757 2 21.825 21.15 35.4 21.625 3 19.225 26.974999999999998 25.224999999999998 28.575 4 25.074999999999996 31.55 21.2 22.175 5 23.075000000000003 35.125 22.875 18.925 6 17.45 34.375 25.074999999999996 23.1 7 15.35 20.775 41.925000000000004 21.95 8 19.7 23.599999999999998 27.35 29.349999999999998 9 18.099999999999998 20.8 32.625 28.475 10-14 21.86 26.99 24.615000000000002 26.534999999999997 15-19 21.495 26.82 26.229999999999997 25.455 20-24 21.72 27.405 26.484999999999996 24.39 25-29 21.490000000000002 27.3 26.595000000000002 24.615000000000002 30-34 22.09 27.22 25.95 24.740000000000002 35-39 21.525 26.889999999999997 26.705000000000002 24.88 40-44 21.345 27.445000000000004 26.44 24.77 45-49 22.02 27.025 26.265 24.69 50-54 21.78 27.339999999999996 26.419999999999998 24.46 55-59 22.405 27.29 25.590000000000003 24.715 60-64 21.529999999999998 27.12 25.77 25.580000000000002 65-69 21.224999999999998 26.935 26.784999999999997 25.055 70-74 22.375 26.669999999999998 26.5 24.455 75-79 21.715 26.87 26.169999999999998 25.245 80-84 22.07 27.075 26.02 24.834999999999997 85-89 21.6 27.169999999999998 26.145000000000003 25.085 90-94 22.23 26.275 26.275 25.22 95-99 22.335 27.07 25.985000000000003 24.610000000000003 100-104 22.43 26.995 26.040000000000003 24.535 105-109 22.5 26.424999999999997 26.31 24.765 110-114 22.42 26.245 26.215 25.119999999999997 115-119 21.94 27.07 26.669999999999998 24.32 120-124 22.705000000000002 26.56 26.395000000000003 24.34 125-129 22.445 26.505000000000003 26.224999999999998 24.825 130-134 22.715 25.619999999999997 26.19 25.474999999999998 135-139 22.025 25.95 26.455000000000002 25.569999999999997 140-144 22.555 26.14 26.105 25.2 145-149 22.23 26.595000000000002 26.365 24.81 150-151 22.35 26.5125 26.125 25.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.0 27 5.5 28 9.5 29 9.0 30 11.5 31 16.0 32 22.5 33 30.0 34 46.0 35 55.0 36 69.0 37 88.0 38 96.5 39 131.5 40 165.5 41 188.0 42 194.5 43 212.0 44 226.0 45 232.0 46 252.0 47 232.0 48 208.0 49 182.5 50 154.0 51 139.5 52 122.0 53 109.5 54 94.5 55 77.5 56 62.5 57 63.5 58 68.0 59 55.0 60 49.0 61 46.0 62 36.0 63 32.0 64 36.5 65 31.5 66 24.5 67 24.5 68 22.0 69 18.5 70 15.5 71 12.5 72 8.0 73 5.5 74 4.0 75 1.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.8375 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.475 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTCA 40 0.005627093 54.360935 4 >>END_MODULE SRR8846512 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846512_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71175 33.0 33.0 34.0 32.0 34.0 2 32.83625 33.0 33.0 34.0 32.0 34.0 3 32.6095 33.0 33.0 34.0 31.0 34.0 4 32.859 34.0 33.0 34.0 32.0 34.0 5 32.8275 34.0 33.0 34.0 32.0 34.0 6 37.047 38.0 38.0 38.0 36.0 38.0 7 36.959 38.0 38.0 38.0 36.0 38.0 8 37.133 38.0 38.0 38.0 36.0 38.0 9 36.972 38.0 38.0 38.0 36.0 38.0 10-14 37.0505 38.0 38.0 38.0 36.0 38.0 15-19 37.08890000000001 38.0 38.0 38.0 36.0 38.0 20-24 37.006 38.0 38.0 38.0 35.8 38.0 25-29 36.96065 38.0 38.0 38.0 36.0 38.0 30-34 36.9103 38.0 38.0 38.0 35.8 38.0 35-39 36.7638 38.0 38.0 38.0 34.8 38.0 40-44 36.79995 38.0 38.0 38.0 35.0 38.0 45-49 36.765100000000004 38.0 38.0 38.0 34.8 38.0 50-54 36.49855 38.0 38.0 38.0 34.4 38.0 55-59 36.2606 38.0 37.6 38.0 33.4 38.0 60-64 36.45275 38.0 38.0 38.0 34.0 38.0 65-69 36.477999999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.403600000000004 38.0 38.0 38.0 34.0 38.0 75-79 35.98115 38.0 37.0 38.0 32.2 38.0 80-84 35.9747 38.0 37.0 38.0 32.4 38.0 85-89 35.81645 38.0 36.8 38.0 31.8 38.0 90-94 35.5591 38.0 36.6 38.0 30.0 38.0 95-99 35.36395 38.0 36.0 38.0 29.4 38.0 100-104 35.0781 38.0 35.4 38.0 28.4 38.0 105-109 34.667899999999996 38.0 34.8 38.0 26.2 38.0 110-114 34.1905 38.0 34.2 38.0 24.2 38.0 115-119 33.821299999999994 38.0 34.0 38.0 22.2 38.0 120-124 33.21665 37.6 33.4 38.0 17.4 38.0 125-129 32.5064 36.6 31.8 38.0 14.8 38.0 130-134 32.12975 36.4 31.4 38.0 14.6 38.0 135-139 30.76215 35.2 28.6 38.0 13.2 38.0 140-144 29.596600000000002 33.6 26.0 38.0 12.4 38.0 145-149 27.65335 33.0 20.8 38.0 2.0 38.0 150-151 20.076625 25.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 2.0 5 1.0 6 2.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 4.0 17 3.0 18 10.0 19 8.0 20 11.0 21 10.0 22 15.0 23 12.0 24 21.0 25 30.0 26 42.0 27 42.0 28 63.0 29 77.0 30 93.0 31 127.0 32 145.0 33 251.0 34 369.0 35 565.0 36 1112.0 37 975.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.35 13.725000000000001 12.45 38.475 2 28.199999999999996 18.875 34.25 18.675 3 22.525000000000002 23.35 30.85 23.275000000000002 4 25.924999999999997 30.9 20.349999999999998 22.825 5 25.8 33.875 20.275000000000002 20.05 6 20.175 35.375 21.975 22.475 7 19.6 16.8 39.775 23.825 8 21.3 21.675 26.1 30.925000000000004 9 22.525000000000002 21.775 28.7 27.0 10-14 26.06 25.03 24.060000000000002 24.85 15-19 25.195 25.605 25.324999999999996 23.875 20-24 25.424999999999997 26.229999999999997 25.105 23.24 25-29 25.145 26.155 25.835 22.865 30-34 25.22 25.790000000000003 25.94 23.05 35-39 24.94 26.119999999999997 25.485000000000003 23.455000000000002 40-44 25.245 26.11 25.525 23.119999999999997 45-49 24.825 25.869999999999997 26.07 23.235 50-54 24.625 26.555 25.03 23.79 55-59 24.990000000000002 26.275 25.655 23.080000000000002 60-64 24.915000000000003 25.874999999999996 26.075 23.135 65-69 25.009999999999998 26.174999999999997 26.009999999999998 22.805 70-74 24.975 25.85 26.095000000000002 23.080000000000002 75-79 25.180000000000003 26.56 25.945 22.314999999999998 80-84 25.45 26.44 25.795 22.314999999999998 85-89 25.275 25.305 26.125 23.294999999999998 90-94 25.305 25.96 26.090000000000003 22.645 95-99 24.995 26.855 25.595000000000002 22.555 100-104 25.35 25.905 26.125 22.62 105-109 24.93 26.334999999999997 26.405 22.33 110-114 24.985 26.529999999999998 25.955000000000002 22.53 115-119 25.885 25.555 26.605 21.955 120-124 24.975 25.755 26.615 22.655 125-129 25.21 26.055 26.255 22.48 130-134 25.105 26.21 26.215 22.470000000000002 135-139 25.435000000000002 26.365 26.015 22.185 140-144 25.324999999999996 26.665 26.495 21.515 145-149 25.34 26.314999999999998 26.895000000000003 21.45 150-151 26.825 24.962500000000002 26.125 22.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.5 25 0.5 26 0.5 27 2.5 28 5.0 29 7.5 30 8.5 31 10.5 32 15.0 33 22.0 34 30.0 35 38.5 36 56.5 37 75.0 38 86.5 39 116.0 40 145.0 41 163.0 42 179.0 43 203.0 44 211.5 45 197.0 46 201.5 47 198.0 48 193.5 49 205.0 50 173.5 51 140.5 52 129.5 53 108.5 54 99.5 55 85.5 56 77.0 57 79.0 58 81.0 59 81.5 60 76.0 61 62.0 62 55.0 63 60.5 64 53.0 65 44.5 66 40.5 67 34.5 68 30.5 69 31.5 70 26.5 71 14.5 72 12.0 73 12.5 74 8.0 75 2.0 76 1.0 77 2.0 78 1.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5032712632108707 1.0 3 0.0754906894816306 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1625 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.5249999999999999 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.7124999999999999 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.8875 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.2125 0.0 0.0 0.0 0.0 134-135 1.3125 0.0 0.0 0.0 0.0 136-137 1.4875 0.0 0.0 0.0 0.0 138-139 1.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCAC 10 0.006830828 145.0 8 ATCATTT 10 0.006830828 145.0 6 TCATTTT 10 0.006830828 145.0 7 >>END_MODULE Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453756 spots for SRR8846512.sra Written 1453756 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra Read 1453751 spots for SRR8846512.sra Written 1453751 spots for SRR8846512.sra SRR ids: ['SRR8846512.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jocswt_i SRR8846512.sra spots: 29075025 blocks: [[1, 1453751], [1453752, 2907502], [2907503, 4361253], [4361254, 5815004], [5815005, 7268755], [7268756, 8722506], [8722507, 10176257], [10176258, 11630008], [11630009, 13083759], [13083760, 14537510], [14537511, 15991261], [15991262, 17445012], [17445013, 18898763], [18898764, 20352514], [20352515, 21806265], [21806266, 23260016], [23260017, 24713767], [24713768, 26167518], [26167519, 27621269], [27621270, 29075025]] SRR8846512 file size 9830871 SRR8846512 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846512 SRR8846512_1.fastq SRR8846512_2.fastq Input file: SRR8846512_1.fastq Paired file: SRR8846512_2.fastq trimmed: SRR8846512-trimmed-pair1.fastq, SRR8846512-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:56:09 2024 >> started Thu Dec 12 02:56:42 2024 >> done (33.317s) 29075025 read pairs processed; of these: 16877 ( 0.06%) short read pairs filtered out after trimming by size control 12650 ( 0.04%) empty read pairs filtered out after trimming by size control 29045498 (99.90%) read pairs available; of these: 16381071 (56.40%) trimmed read pairs available after processing 12664427 (43.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 5 0.00% 20 5 0.00% 21 9 0.00% 22 9 0.00% 23 18 0.00% 24 8 0.00% 25 9 0.00% 26 16 0.00% 27 15 0.00% 28 8 0.00% 29 12 0.00% 30 14 0.00% 31 13 0.00% 32 7 0.00% 33 14 0.00% 34 13 0.00% 35 15 0.00% 36 18 0.00% 37 14 0.00% 38 14 0.00% 39 18 0.00% 40 20 0.00% 41 21 0.00% 42 22 0.00% 43 19 0.00% 44 27 0.00% 45 25 0.00% 46 27 0.00% 47 28 0.00% 48 29 0.00% 49 37 0.00% 50 42 0.00% 51 54 0.00% 52 48 0.00% 53 49 0.00% 54 65 0.00% 55 54 0.00% 56 82 0.00% 57 66 0.00% 58 74 0.00% 59 100 0.00% 60 130 0.00% 61 114 0.00% 62 133 0.00% 63 163 0.00% 64 160 0.00% 65 151 0.00% 66 193 0.00% 67 221 0.00% 68 245 0.00% 69 254 0.00% 70 295 0.00% 71 366 0.00% 72 407 0.00% 73 419 0.00% 74 496 0.00% 75 545 0.00% 76 619 0.00% 77 703 0.00% 78 724 0.00% 79 863 0.00% 80 943 0.00% 81 1060 0.00% 82 1224 0.00% 83 1553 0.01% 84 2199 0.01% 85 2662 0.01% 86 2796 0.01% 87 2966 0.01% 88 3134 0.01% 89 3273 0.01% 90 3484 0.01% 91 3707 0.01% 92 3901 0.01% 93 4332 0.01% 94 4649 0.02% 95 5081 0.02% 96 5423 0.02% 97 5904 0.02% 98 6126 0.02% 99 6781 0.02% 100 7044 0.02% 101 7906 0.03% 102 8327 0.03% 103 8983 0.03% 104 9920 0.03% 105 10616 0.04% 106 11665 0.04% 107 12492 0.04% 108 13311 0.05% 109 14534 0.05% 110 15352 0.05% 111 16558 0.06% 112 17867 0.06% 113 18900 0.07% 114 20711 0.07% 115 22032 0.08% 116 23548 0.08% 117 25087 0.09% 118 26745 0.09% 119 28802 0.10% 120 30811 0.11% 121 32954 0.11% 122 35246 0.12% 123 37905 0.13% 124 40341 0.14% 125 43317 0.15% 126 46102 0.16% 127 50122 0.17% 128 53696 0.18% 129 58507 0.20% 130 63207 0.22% 131 68741 0.24% 132 74944 0.26% 133 81915 0.28% 134 89156 0.31% 135 97469 0.34% 136 108716 0.37% 137 120152 0.41% 138 133803 0.46% 139 152371 0.52% 140 172844 0.60% 141 197350 0.68% 142 231736 0.80% 143 277597 0.96% 144 334610 1.15% 145 425227 1.46% 146 570623 1.96% 147 811418 2.79% 148 1189236 4.09% 149 2195004 7.56% 150 8155999 28.08% 151 12664427 43.60% 29045498 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=37 prefix-density=0.13 prefix-fanout=2.2 sequence=ACGAAGTTGGTGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=243.78 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=21.0 sequence=ATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=33 prefix-density=0.32 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=632.57 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=19.7 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846512 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:57:24 Started mapping on | Dec 12 02:57:24 Finished on | Dec 12 03:00:00 Mapping speed, Million of reads per hour | 670.28 Number of input reads | 29045498 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 28398396 Uniquely mapped reads % | 97.77% Average mapped length | 296.54 Number of splices: Total | 32739168 Number of splices: Annotated (sjdb) | 30825132 Number of splices: GT/AG | 32318963 Number of splices: GC/AG | 379692 Number of splices: AT/AC | 17364 Number of splices: Non-canonical | 23149 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223833 % of reads mapped to multiple loci | 0.77% Number of reads mapped to too many loci | 16430 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.05% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 435082 435082 435082 N_multimapping 223833 223833 223833 N_noFeature 1299364 27620967 1522696 N_ambiguous 640973 4050 87517 UnstrandedReadsAssigned:26458059 PositiveStrandReadsAssigned:773379 NegativeStrandReadsAssigned:26788183 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846512 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846512-trimmed-pair1.fastq SRR8846512-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,045,498 reads, 26,831,507 reads pseudoaligned [quant] estimated average fragment length: 283.122 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52973 SRR8846512.ke.tsv 35125 SRR8846512.se.tsv 88098 total ==> SRR8846512.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.497 0 0 PNS24247 1044 761.878 107.783 7.96928 PNS24249 1928 1645.88 63.4561 2.17184 PNS24246 1044 761.878 107.783 7.96928 PNS24248 1044 761.878 107.783 7.96928 PNS24244 1471 1188.88 106.194 5.0317 PNS24243 293 74.2588 0 0 KQK14069 1603 1320.88 6266.3 267.24 KQK14071 474 210.027 18.7471 5.0282 ==> SRR8846512.se.tsv <== BRADI_1g14170v3 6665 BRADI_1g53295v3 195 BRADI_1g59795v3 491 BRADI_1g07683v3 0 BRADI_1g00485v3 67 BRADI_1g20270v3 3230 BRADI_1g74790v3 338 BRADI_1g09890v3 0 BRADI_1g77505v3 492 BRADI_1g48960v3 0 SRR8846512 completed mapping pipeline successfully