Starting /dee2/code/volunteer_pipeline.sh SRR8846515 current disk space = 1506163134464 free memory = 1346739236 SRR8846515 SRAfilesize 053ca81dc4e9dc6895c4502142cefaf3 SRR8846515.sra SRR8846515.sra file validated SRR8846515 is paired end SRR8846515 is conventional basespace SRR8846515 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846515_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.79 25.0 18.0 32.0 18.0 33.0 2 23.63175 25.0 18.0 29.0 18.0 33.0 3 27.719 30.0 25.0 32.0 18.0 33.0 4 30.26625 31.0 29.0 33.0 27.0 33.0 5 31.2765 33.0 32.0 33.0 28.0 33.0 6 36.21075 38.0 36.0 38.0 33.0 38.0 7 37.0965 38.0 38.0 38.0 36.0 38.0 8 37.047 38.0 38.0 38.0 36.0 38.0 9 37.27275 38.0 38.0 38.0 36.0 38.0 10-14 37.233999999999995 38.0 38.0 38.0 36.2 38.0 15-19 37.1712 38.0 38.0 38.0 36.0 38.0 20-24 37.208200000000005 38.0 38.0 38.0 36.2 38.0 25-29 37.29325 38.0 38.0 38.0 36.8 38.0 30-34 37.356849999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.17095 38.0 38.0 38.0 36.4 38.0 40-44 36.906549999999996 38.0 38.0 38.0 35.6 38.0 45-49 36.808749999999996 38.0 38.0 38.0 34.8 38.0 50-54 36.97115 38.0 38.0 38.0 35.4 38.0 55-59 36.7488 38.0 38.0 38.0 34.6 38.0 60-64 36.62095000000001 38.0 38.0 38.0 34.2 38.0 65-69 36.45975 38.0 37.6 38.0 34.0 38.0 70-74 36.31415 38.0 37.0 38.0 33.4 38.0 75-79 36.2743 38.0 37.0 38.0 33.0 38.0 80-84 36.0819 38.0 37.0 38.0 32.8 38.0 85-89 35.67535 38.0 36.2 38.0 30.4 38.0 90-94 35.102000000000004 38.0 35.4 38.0 28.4 38.0 95-99 35.1255 38.0 35.2 38.0 28.6 38.0 100-104 35.1982 38.0 35.4 38.0 28.8 38.0 105-109 34.7569 38.0 34.6 38.0 27.2 38.0 110-114 33.90345 37.8 33.8 38.0 22.4 38.0 115-119 33.1632 37.0 32.8 38.0 15.0 38.0 120-124 33.33275 37.0 33.0 38.0 18.6 38.0 125-129 32.842200000000005 36.8 32.2 38.0 15.0 38.0 130-134 31.766 35.8 29.8 38.0 14.6 38.0 135-139 30.4766 35.0 26.6 38.0 14.0 38.0 140-144 29.59185 35.0 23.8 38.0 13.0 38.0 145-149 28.28925 33.6 22.8 38.0 4.2 38.0 150-151 23.138624999999998 29.0 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 4.0 20 3.0 21 5.0 22 13.0 23 16.0 24 18.0 25 26.0 26 31.0 27 47.0 28 55.0 29 62.0 30 93.0 31 162.0 32 206.0 33 310.0 34 483.0 35 785.0 36 1170.0 37 506.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.513639906469212 19.927253832164197 8.625617043387892 43.933489217978696 2 21.725 23.974999999999998 35.65 18.65 3 18.425 28.075 28.375 25.124999999999996 4 24.95 31.1 22.475 21.475 5 25.081270317579396 32.38309577394349 23.25581395348837 19.279819954988746 6 19.025 34.275 24.125 22.575 7 15.225 20.5 41.425 22.85 8 19.75 21.85 28.125 30.275000000000002 9 18.75 20.05 32.800000000000004 28.4 10-14 23.1 26.195 24.33 26.375 15-19 22.715 26.455000000000002 26.165 24.665 20-24 21.995 26.334999999999997 26.46 25.21 25-29 22.425 26.405 26.674999999999997 24.495 30-34 21.88 26.340000000000003 26.884999999999998 24.895 35-39 22.145 26.68 25.965 25.21 40-44 22.53 26.195 26.705000000000002 24.57 45-49 22.634999999999998 26.450000000000003 25.990000000000002 24.925 50-54 22.16 26.279999999999998 26.765 24.795 55-59 22.505 26.875 25.935000000000002 24.685000000000002 60-64 22.655 26.125 25.974999999999998 25.245 65-69 22.425 26.35 25.795 25.430000000000003 70-74 22.55 27.089999999999996 25.71 24.65 75-79 22.755 26.375 26.150000000000002 24.72 80-84 22.49 26.32 26.334999999999997 24.855 85-89 23.015 26.200000000000003 25.900000000000002 24.884999999999998 90-94 23.095 26.064999999999998 25.655 25.185000000000002 95-99 22.830000000000002 26.179999999999996 26.545 24.445 100-104 22.52 26.465 25.96 25.055 105-109 22.84 26.355 26.055 24.75 110-114 22.905 26.365 26.16 24.57 115-119 23.09 26.35 25.64 24.92 120-124 23.064999999999998 25.66 26.474999999999998 24.8 125-129 23.39 26.26 25.779999999999998 24.57 130-134 22.79 26.290000000000003 25.509999999999998 25.41 135-139 22.935 25.905 25.990000000000002 25.169999999999998 140-144 23.25 26.115 25.669999999999998 24.965 145-149 23.080000000000002 25.590000000000003 25.8 25.53 150-151 22.787499999999998 25.525 26.474999999999998 25.2125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 3.0 27 5.0 28 5.5 29 6.5 30 7.5 31 14.0 32 20.5 33 24.5 34 29.5 35 49.5 36 64.5 37 75.0 38 112.0 39 140.0 40 154.0 41 174.5 42 194.5 43 205.0 44 220.0 45 224.5 46 219.5 47 215.5 48 198.5 49 179.0 50 171.0 51 148.5 52 122.0 53 112.5 54 96.0 55 90.0 56 87.5 57 76.5 58 67.0 59 58.0 60 52.0 61 53.5 62 47.5 63 41.0 64 36.5 65 31.5 66 33.5 67 30.5 68 21.0 69 19.0 70 20.0 71 13.5 72 6.0 73 3.5 74 4.0 75 5.0 76 3.5 77 1.5 78 1.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.8374999999999999 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.3875 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.8250000000000002 0.0 0.0 0.0 0.0 130-131 1.9874999999999998 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.3499999999999996 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8846515 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846515_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7265 33.0 33.0 34.0 32.0 34.0 2 32.7475 33.0 33.0 34.0 32.0 34.0 3 32.5285 33.0 33.0 34.0 31.0 34.0 4 32.77275 33.0 33.0 34.0 32.0 34.0 5 32.71775 33.0 33.0 34.0 32.0 34.0 6 36.88175 38.0 38.0 38.0 35.0 38.0 7 36.89025 38.0 38.0 38.0 36.0 38.0 8 36.9705 38.0 38.0 38.0 36.0 38.0 9 36.8765 38.0 38.0 38.0 35.0 38.0 10-14 36.94265 38.0 38.0 38.0 35.4 38.0 15-19 36.91225 38.0 38.0 38.0 35.8 38.0 20-24 36.857749999999996 38.0 38.0 38.0 35.4 38.0 25-29 36.8602 38.0 38.0 38.0 35.2 38.0 30-34 36.829350000000005 38.0 38.0 38.0 35.2 38.0 35-39 36.726850000000006 38.0 38.0 38.0 34.8 38.0 40-44 36.6914 38.0 38.0 38.0 34.6 38.0 45-49 36.61765 38.0 38.0 38.0 34.6 38.0 50-54 36.33485 38.0 38.0 38.0 33.4 38.0 55-59 36.129650000000005 38.0 37.6 38.0 32.8 38.0 60-64 36.2457 38.0 37.8 38.0 33.2 38.0 65-69 36.344 38.0 37.6 38.0 33.6 38.0 70-74 36.21509999999999 38.0 37.2 38.0 33.4 38.0 75-79 35.8096 38.0 37.0 38.0 31.4 38.0 80-84 35.821400000000004 38.0 37.0 38.0 31.2 38.0 85-89 35.6048 38.0 36.4 38.0 30.6 38.0 90-94 35.38715 38.0 36.0 38.0 29.8 38.0 95-99 35.0166 38.0 35.8 38.0 28.0 38.0 100-104 34.709900000000005 38.0 35.0 38.0 26.6 38.0 105-109 34.333800000000004 38.0 34.2 38.0 25.0 38.0 110-114 33.752399999999994 38.0 34.0 38.0 21.2 38.0 115-119 33.1653 37.6 33.2 38.0 16.2 38.0 120-124 32.68865 37.2 32.4 38.0 15.0 38.0 125-129 31.94615 36.4 30.4 38.0 14.6 38.0 130-134 31.5282 36.0 30.4 38.0 13.8 38.0 135-139 30.04815 34.0 26.2 38.0 13.0 38.0 140-144 28.937900000000003 33.0 24.0 38.0 8.2 38.0 145-149 26.79735 33.0 15.4 38.0 2.0 38.0 150-151 19.30875 17.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 3.0 5 0.0 6 1.0 7 2.0 8 0.0 9 1.0 10 2.0 11 3.0 12 1.0 13 2.0 14 0.0 15 4.0 16 1.0 17 5.0 18 5.0 19 4.0 20 12.0 21 13.0 22 10.0 23 18.0 24 33.0 25 38.0 26 36.0 27 58.0 28 70.0 29 79.0 30 118.0 31 150.0 32 197.0 33 239.0 34 358.0 35 623.0 36 1110.0 37 797.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.8 13.125 12.925 37.15 2 28.575 20.075000000000003 32.05 19.3 3 21.075 24.0 29.975 24.95 4 25.4 32.7 19.625 22.275 5 27.224999999999998 34.425 18.95 19.400000000000002 6 20.775 35.225 21.15 22.85 7 19.900000000000002 15.25 39.225 25.624999999999996 8 22.85 20.825 25.674999999999997 30.65 9 22.625 21.025 28.299999999999997 28.050000000000004 10-14 26.19 24.565 23.494999999999997 25.75 15-19 25.124999999999996 25.180000000000003 25.55 24.145 20-24 24.665 26.284999999999997 24.815 24.235 25-29 25.025 25.669999999999998 25.185000000000002 24.12 30-34 24.759999999999998 26.06 25.455 23.724999999999998 35-39 24.779999999999998 26.02 24.97 24.23 40-44 25.285000000000004 25.835 25.31 23.57 45-49 25.790000000000003 25.629999999999995 25.009999999999998 23.57 50-54 25.44 25.935000000000002 25.169999999999998 23.455000000000002 55-59 25.77 24.795 25.814999999999998 23.62 60-64 24.7 25.535000000000004 26.090000000000003 23.674999999999997 65-69 24.97 25.66 25.585 23.785 70-74 25.83 25.575 25.11 23.485 75-79 25.535000000000004 25.09 25.935000000000002 23.44 80-84 25.685000000000002 26.355 25.240000000000002 22.720000000000002 85-89 24.755 26.009999999999998 25.650000000000002 23.585 90-94 25.25 26.11 25.45 23.189999999999998 95-99 25.035 26.33 25.290000000000003 23.345 100-104 25.355 25.745 26.040000000000003 22.86 105-109 25.509999999999998 26.665 25.09 22.735 110-114 25.019999999999996 26.325 25.405 23.25 115-119 25.485000000000003 25.885 25.41 23.22 120-124 26.040000000000003 25.564999999999998 26.115 22.28 125-129 25.580000000000002 26.415 25.05 22.955000000000002 130-134 25.735000000000003 26.290000000000003 25.85 22.125 135-139 25.779999999999998 25.705 25.715 22.8 140-144 26.02 25.765 25.915 22.3 145-149 26.450000000000003 25.95 25.240000000000002 22.36 150-151 25.162499999999998 25.8125 26.05 22.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 3.0 27 3.5 28 2.0 29 4.5 30 7.5 31 10.0 32 14.0 33 17.5 34 21.0 35 30.0 36 41.0 37 60.0 38 86.5 39 98.5 40 116.5 41 157.5 42 191.5 43 203.5 44 196.5 45 204.0 46 218.0 47 217.0 48 197.0 49 168.0 50 158.0 51 143.5 52 136.0 53 126.5 54 105.0 55 88.5 56 78.0 57 78.0 58 83.0 59 82.5 60 81.5 61 70.5 62 58.5 63 57.0 64 50.5 65 50.0 66 44.5 67 38.5 68 42.5 69 44.5 70 36.5 71 26.0 72 16.5 73 11.0 74 9.5 75 4.5 76 2.0 77 2.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.395008822788 98.575 2 0.5293672800604992 1.05 3 0.0 0.0 4 0.050415931434333254 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025207965717166627 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2125 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.7999999999999998 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.15 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTTGT 10 0.006830828 145.0 3 GAAGCAG 10 0.006830828 145.0 7 AAGAGCG 10 0.006830828 145.0 145 >>END_MODULE Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129294 spots for SRR8846515.sra Written 1129294 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra Read 1129281 spots for SRR8846515.sra Written 1129281 spots for SRR8846515.sra SRR ids: ['SRR8846515.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i6x3rlv6 SRR8846515.sra spots: 22585633 blocks: [[1, 1129281], [1129282, 2258562], [2258563, 3387843], [3387844, 4517124], [4517125, 5646405], [5646406, 6775686], [6775687, 7904967], [7904968, 9034248], [9034249, 10163529], [10163530, 11292810], [11292811, 12422091], [12422092, 13551372], [13551373, 14680653], [14680654, 15809934], [15809935, 16939215], [16939216, 18068496], [18068497, 19197777], [19197778, 20327058], [20327059, 21456339], [21456340, 22585633]] SRR8846515 file size 7631829 SRR8846515 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846515 SRR8846515_1.fastq SRR8846515_2.fastq Input file: SRR8846515_1.fastq Paired file: SRR8846515_2.fastq trimmed: SRR8846515-trimmed-pair1.fastq, SRR8846515-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 05:08:30 2024 >> started Mon Dec 9 05:10:35 2024 >> done (125.624s) 22585633 read pairs processed; of these: 17136 ( 0.08%) short read pairs filtered out after trimming by size control 14046 ( 0.06%) empty read pairs filtered out after trimming by size control 22554451 (99.86%) read pairs available; of these: 13577363 (60.20%) trimmed read pairs available after processing 8977088 (39.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 10 0.00% 21 4 0.00% 22 7 0.00% 23 7 0.00% 24 9 0.00% 25 8 0.00% 26 7 0.00% 27 10 0.00% 28 8 0.00% 29 8 0.00% 30 10 0.00% 31 8 0.00% 32 15 0.00% 33 12 0.00% 34 14 0.00% 35 18 0.00% 36 13 0.00% 37 16 0.00% 38 15 0.00% 39 13 0.00% 40 15 0.00% 41 22 0.00% 42 20 0.00% 43 25 0.00% 44 26 0.00% 45 24 0.00% 46 35 0.00% 47 34 0.00% 48 47 0.00% 49 32 0.00% 50 53 0.00% 51 56 0.00% 52 57 0.00% 53 57 0.00% 54 73 0.00% 55 74 0.00% 56 77 0.00% 57 73 0.00% 58 98 0.00% 59 104 0.00% 60 121 0.00% 61 126 0.00% 62 141 0.00% 63 192 0.00% 64 173 0.00% 65 225 0.00% 66 224 0.00% 67 264 0.00% 68 287 0.00% 69 323 0.00% 70 381 0.00% 71 410 0.00% 72 476 0.00% 73 526 0.00% 74 576 0.00% 75 728 0.00% 76 741 0.00% 77 820 0.00% 78 887 0.00% 79 1000 0.00% 80 1168 0.01% 81 1322 0.01% 82 1501 0.01% 83 1739 0.01% 84 2486 0.01% 85 2960 0.01% 86 3105 0.01% 87 3336 0.01% 88 3382 0.01% 89 3596 0.02% 90 3901 0.02% 91 4155 0.02% 92 4409 0.02% 93 4826 0.02% 94 5302 0.02% 95 5549 0.02% 96 6037 0.03% 97 6560 0.03% 98 7184 0.03% 99 7594 0.03% 100 8161 0.04% 101 8618 0.04% 102 9429 0.04% 103 10189 0.05% 104 10894 0.05% 105 11899 0.05% 106 12849 0.06% 107 13525 0.06% 108 14472 0.06% 109 15550 0.07% 110 16729 0.07% 111 17546 0.08% 112 18977 0.08% 113 20414 0.09% 114 21588 0.10% 115 23215 0.10% 116 24788 0.11% 117 26097 0.12% 118 27896 0.12% 119 29939 0.13% 120 31927 0.14% 121 34325 0.15% 122 36355 0.16% 123 38405 0.17% 124 41244 0.18% 125 44428 0.20% 126 46813 0.21% 127 50425 0.22% 128 53825 0.24% 129 58181 0.26% 130 62746 0.28% 131 67523 0.30% 132 74151 0.33% 133 80046 0.35% 134 86987 0.39% 135 95068 0.42% 136 105304 0.47% 137 115045 0.51% 138 128547 0.57% 139 144586 0.64% 140 162349 0.72% 141 185358 0.82% 142 216285 0.96% 143 256000 1.14% 144 308483 1.37% 145 387973 1.72% 146 510161 2.26% 147 710106 3.15% 148 1020615 4.53% 149 1823818 8.09% 150 6167550 27.35% 151 8977088 39.80% 22554451 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=11.00 fanout-score-rank=10 prefix-density=0.78 prefix-fanout=1.9 sequence=TCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=301.71 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=20.8 sequence=ATCATCATCGTGGTAGTACAAGTGAAACCAGCTACACACACTTGGTCGCGAGCATAGTCGATTTGCATATACACATGTGCCTCTCATTGACACCTTACTTGCCGGGAAC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=36 prefix-density=0.37 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=320.69 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=16.5 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846515 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 05:14:32 Started mapping on | Dec 09 05:14:32 Finished on | Dec 09 05:21:10 Mapping speed, Million of reads per hour | 204.01 Number of input reads | 22554451 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 22185859 Uniquely mapped reads % | 98.37% Average mapped length | 295.26 Number of splices: Total | 25853152 Number of splices: Annotated (sjdb) | 24395565 Number of splices: GT/AG | 25527136 Number of splices: GC/AG | 293500 Number of splices: AT/AC | 14141 Number of splices: Non-canonical | 18375 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 194461 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 14025 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.38% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 185581 185581 185581 N_multimapping 194461 194461 194461 N_noFeature 855868 21569613 1070412 N_ambiguous 464432 3131 63434 UnstrandedReadsAssigned:20865559 PositiveStrandReadsAssigned:613115 NegativeStrandReadsAssigned:21052013 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR8846515 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846515-trimmed-pair1.fastq SRR8846515-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,554,451 reads, 21,119,061 reads pseudoaligned [quant] estimated average fragment length: 271.314 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR8846515.ke.tsv 35125 SRR8846515.se.tsv 88098 total ==> SRR8846515.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.107 0.00208113 0.000216196 PNS24247 1044 773.686 76.765 6.86578 PNS24249 1928 1657.69 49.9076 2.08332 PNS24246 1044 773.686 76.765 6.86578 PNS24248 1044 773.686 76.765 6.86578 PNS24244 1471 1200.69 65.7954 3.7919 PNS24243 293 79.7461 0 0 KQK14069 1603 1332.69 1899.29 98.6178 KQK14071 474 219.318 11.8027 3.72391 ==> SRR8846515.se.tsv <== BRADI_1g14170v3 2051 BRADI_1g53295v3 66 BRADI_1g59795v3 310 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 3186 BRADI_1g74790v3 135 BRADI_1g09890v3 1 BRADI_1g77505v3 335 BRADI_1g48960v3 0 SRR8846515 completed mapping pipeline successfully