Starting /dee2/code/volunteer_pipeline.sh SRR8846516 current disk space = 1515381858304 free memory = 1570803704 SRR8846516 SRAfilesize 7bd6a50d7514eeb8d33ed231f25cd1b9 SRR8846516.sra SRR8846516.sra file validated SRR8846516 is paired end SRR8846516 is conventional basespace SRR8846516 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846516_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.84 32.0 27.0 33.0 18.0 33.0 2 27.4125 30.0 18.0 32.0 18.0 33.0 3 30.33025 31.0 29.0 33.0 27.0 33.0 4 29.89225 31.0 29.0 33.0 25.0 33.0 5 31.69325 33.0 32.0 33.0 30.0 33.0 6 36.594 38.0 37.0 38.0 34.0 38.0 7 36.97725 38.0 38.0 38.0 35.0 38.0 8 37.34825 38.0 38.0 38.0 36.0 38.0 9 37.3485 38.0 38.0 38.0 37.0 38.0 10-14 37.28505 38.0 38.0 38.0 36.6 38.0 15-19 37.20025 38.0 38.0 38.0 36.2 38.0 20-24 37.135600000000004 38.0 38.0 38.0 36.2 38.0 25-29 37.1971 38.0 38.0 38.0 36.0 38.0 30-34 37.07625 38.0 38.0 38.0 36.0 38.0 35-39 36.9612 38.0 38.0 38.0 35.8 38.0 40-44 36.73965 38.0 38.0 38.0 34.6 38.0 45-49 36.62775 38.0 38.0 38.0 34.2 38.0 50-54 36.7457 38.0 38.0 38.0 34.4 38.0 55-59 36.58395 38.0 38.0 38.0 34.2 38.0 60-64 36.35625 38.0 37.6 38.0 33.2 38.0 65-69 36.16865 38.0 37.0 38.0 32.2 38.0 70-74 35.9599 38.0 36.8 38.0 31.4 38.0 75-79 36.0501 38.0 36.8 38.0 32.0 38.0 80-84 36.01475 38.0 36.8 38.0 31.8 38.0 85-89 35.77965 38.0 36.4 38.0 30.8 38.0 90-94 35.1084 38.0 35.6 38.0 28.2 38.0 95-99 34.879949999999994 38.0 35.0 38.0 27.2 38.0 100-104 35.1134 38.0 35.0 38.0 28.8 38.0 105-109 34.6427 38.0 34.6 38.0 26.6 38.0 110-114 33.4734 37.4 33.2 38.0 18.2 38.0 115-119 32.79965 37.0 31.6 38.0 15.0 38.0 120-124 32.731399999999994 36.6 31.6 38.0 15.0 38.0 125-129 32.50595 36.6 32.2 38.0 15.0 38.0 130-134 31.219100000000005 35.4 28.4 38.0 14.4 38.0 135-139 30.182350000000003 35.0 25.6 38.0 13.6 38.0 140-144 29.16615 34.0 23.2 38.0 13.0 38.0 145-149 27.88115 33.8 19.6 38.0 4.2 38.0 150-151 22.330875 28.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 1.0 19 5.0 20 6.0 21 10.0 22 11.0 23 12.0 24 21.0 25 26.0 26 38.0 27 49.0 28 54.0 29 84.0 30 113.0 31 143.0 32 233.0 33 316.0 34 523.0 35 783.0 36 1059.0 37 510.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.1771925338788 14.293019688059319 10.841217080030683 37.68857069803119 2 28.199999999999996 19.725 33.175 18.9 3 21.925 26.025 25.1 26.950000000000003 4 26.224999999999998 31.85 21.3 20.625 5 24.756189047261813 31.90797699424856 23.40585146286572 19.929982495623904 6 19.950000000000003 31.3 24.4 24.349999999999998 7 16.35 19.55 42.699999999999996 21.4 8 21.099999999999998 18.65 28.050000000000004 32.2 9 19.2 19.15 32.125 29.525000000000002 10-14 23.11 24.9 25.145 26.845000000000002 15-19 22.814999999999998 25.82 26.38 24.985 20-24 22.24 26.369999999999997 25.900000000000002 25.490000000000002 25-29 22.869999999999997 25.82 26.275 25.035 30-34 22.49 26.450000000000003 26.1 24.959999999999997 35-39 22.689999999999998 25.75 25.380000000000003 26.179999999999996 40-44 22.64 26.06 25.480000000000004 25.82 45-49 22.919999999999998 26.090000000000003 25.825 25.165 50-54 22.919999999999998 25.095 26.284999999999997 25.7 55-59 23.44 26.06 25.355 25.145 60-64 22.97 26.169999999999998 25.215 25.645 65-69 22.895 26.14 25.705 25.259999999999998 70-74 23.275000000000002 25.569999999999997 25.619999999999997 25.535000000000004 75-79 23.535 25.509999999999998 25.740000000000002 25.215 80-84 22.96 25.924999999999997 25.395 25.72 85-89 23.865 25.53 25.34 25.264999999999997 90-94 22.965 25.52 26.095000000000002 25.419999999999998 95-99 23.685000000000002 25.53 25.540000000000003 25.245 100-104 23.605 25.755 25.330000000000002 25.31 105-109 23.044999999999998 25.66 25.66 25.635 110-114 23.54 25.6 25.715 25.145 115-119 23.724999999999998 25.575 25.580000000000002 25.119999999999997 120-124 23.18 26.055 25.005 25.759999999999998 125-129 23.315 25.080000000000002 26.08 25.525 130-134 23.815 25.580000000000002 25.185000000000002 25.419999999999998 135-139 23.78 25.085 25.729999999999997 25.405 140-144 23.575 25.775 25.019999999999996 25.629999999999995 145-149 23.525 25.14 25.480000000000004 25.855 150-151 23.5125 25.6125 25.662499999999998 25.2125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 2.0 27 4.0 28 4.5 29 3.5 30 8.0 31 14.0 32 19.5 33 31.0 34 35.5 35 42.0 36 62.0 37 71.5 38 77.0 39 105.5 40 131.0 41 162.5 42 181.5 43 198.5 44 205.0 45 189.0 46 196.0 47 196.5 48 193.0 49 187.5 50 162.0 51 154.5 52 145.0 53 117.5 54 103.0 55 92.0 56 89.0 57 79.0 58 72.5 59 70.5 60 74.0 61 75.0 62 57.5 63 49.5 64 49.5 65 47.5 66 47.5 67 38.0 68 29.5 69 32.0 70 26.0 71 15.5 72 17.0 73 15.0 74 7.5 75 4.0 76 2.5 77 2.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2125 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.7 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.1625 0.0 0.0 0.0 0.0 134-135 2.4875 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 2.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCACT 10 0.006832588 144.9875 6 >>END_MODULE SRR8846516 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846516_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.794 33.0 33.0 34.0 32.0 34.0 2 32.771 33.0 33.0 34.0 32.0 34.0 3 32.89925 33.0 33.0 34.0 32.0 34.0 4 32.868 33.0 33.0 34.0 32.0 34.0 5 32.757 33.0 33.0 34.0 32.0 34.0 6 36.98525 38.0 38.0 38.0 36.0 38.0 7 37.01425 38.0 38.0 38.0 36.0 38.0 8 37.02525 38.0 38.0 38.0 36.0 38.0 9 36.9685 38.0 38.0 38.0 36.0 38.0 10-14 37.012299999999996 38.0 38.0 38.0 36.0 38.0 15-19 37.0656 38.0 38.0 38.0 36.0 38.0 20-24 36.9673 38.0 38.0 38.0 36.0 38.0 25-29 36.8922 38.0 38.0 38.0 35.4 38.0 30-34 36.74145 38.0 38.0 38.0 34.8 38.0 35-39 36.82515 38.0 38.0 38.0 35.4 38.0 40-44 36.7535 38.0 38.0 38.0 34.8 38.0 45-49 36.6315 38.0 38.0 38.0 34.4 38.0 50-54 36.4309 38.0 38.0 38.0 33.8 38.0 55-59 36.2784 38.0 37.8 38.0 33.2 38.0 60-64 36.376400000000004 38.0 38.0 38.0 33.4 38.0 65-69 36.44285000000001 38.0 38.0 38.0 34.0 38.0 70-74 36.2121 38.0 37.2 38.0 32.8 38.0 75-79 35.90475 38.0 37.0 38.0 31.2 38.0 80-84 35.882400000000004 38.0 37.0 38.0 32.0 38.0 85-89 35.8642 38.0 37.0 38.0 31.6 38.0 90-94 35.4394 38.0 36.2 38.0 29.4 38.0 95-99 35.01405 38.0 35.4 38.0 27.8 38.0 100-104 34.705650000000006 38.0 35.0 38.0 26.4 38.0 105-109 34.63105 38.0 35.0 38.0 26.2 38.0 110-114 34.22265 38.0 34.0 38.0 23.4 38.0 115-119 33.74805 38.0 34.0 38.0 22.2 38.0 120-124 33.23225 37.6 33.4 38.0 17.4 38.0 125-129 32.78190000000001 37.0 33.0 38.0 15.0 38.0 130-134 31.8988 36.0 31.0 38.0 13.8 38.0 135-139 31.105150000000002 35.6 29.8 38.0 13.2 38.0 140-144 29.3966 33.2 25.4 38.0 10.8 38.0 145-149 27.734500000000004 33.0 21.0 38.0 2.0 38.0 150-151 20.787 26.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 1.0 5 1.0 6 2.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 4.0 14 2.0 15 2.0 16 2.0 17 1.0 18 5.0 19 10.0 20 9.0 21 13.0 22 17.0 23 21.0 24 32.0 25 28.0 26 32.0 27 40.0 28 61.0 29 88.0 30 88.0 31 121.0 32 185.0 33 237.0 34 372.0 35 538.0 36 1112.0 37 971.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.675000000000004 12.1 13.8 38.425 2 28.749999999999996 19.8 32.85 18.6 3 22.2 22.125 29.7 25.974999999999998 4 26.0 30.5 19.375 24.125 5 26.55 33.625 20.8 19.025 6 20.175 35.4 20.95 23.474999999999998 7 21.2 14.799999999999999 38.85 25.15 8 22.6 19.775000000000002 25.85 31.775 9 22.875 21.8 26.5 28.825 10-14 25.895000000000003 24.185000000000002 23.305 26.615 15-19 25.27 25.074999999999996 25.064999999999998 24.59 20-24 25.6 25.124999999999996 24.98 24.295 25-29 25.66 25.435000000000002 24.3 24.605 30-34 26.095000000000002 25.5 24.315 24.09 35-39 26.21 25.235000000000003 24.41 24.145 40-44 25.900000000000002 25.455 24.815 23.830000000000002 45-49 26.284999999999997 24.86 24.59 24.265 50-54 25.655 25.669999999999998 25.069999999999997 23.605 55-59 25.86 25.115 24.815 24.21 60-64 26.215 25.365 24.635 23.785 65-69 25.89 25.915 24.605 23.59 70-74 26.0 24.795 25.4 23.805 75-79 26.245 25.525 24.3 23.93 80-84 25.650000000000002 25.775 24.855 23.72 85-89 26.1 24.68 25.255 23.965 90-94 26.07 25.11 24.93 23.89 95-99 25.7 26.1 24.515 23.685000000000002 100-104 25.77 25.355 24.62 24.255 105-109 25.295 25.874999999999996 24.975 23.855 110-114 25.424999999999997 25.965 24.685000000000002 23.925 115-119 25.635 25.974999999999998 25.055 23.335 120-124 25.650000000000002 25.435000000000002 25.380000000000003 23.535 125-129 26.11 25.615 25.074999999999996 23.200000000000003 130-134 26.02 25.735000000000003 25.330000000000002 22.915 135-139 26.11 25.905 24.985 23.0 140-144 26.615 26.105 24.83 22.45 145-149 27.02 25.374999999999996 24.855 22.75 150-151 27.0125 25.5125 25.575 21.9 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 2.0 25 0.5 26 0.0 27 0.5 28 1.5 29 6.5 30 9.5 31 8.5 32 12.5 33 18.0 34 22.5 35 36.0 36 45.5 37 54.0 38 66.0 39 91.5 40 122.0 41 140.5 42 157.5 43 162.0 44 181.0 45 212.0 46 194.5 47 172.5 48 194.5 49 178.0 50 143.5 51 142.0 52 139.5 53 124.5 54 101.5 55 95.5 56 94.5 57 83.0 58 80.0 59 86.0 60 83.5 61 81.5 62 84.0 63 70.0 64 67.5 65 73.5 66 64.0 67 59.0 68 57.5 69 50.5 70 35.5 71 22.0 72 21.0 73 17.5 74 10.5 75 6.0 76 3.5 77 4.5 78 3.0 79 1.0 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11593836827481 98.1 2 0.7577671129072998 1.5 3 0.10103561505430665 0.3 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.23750000000000002 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.8 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.9 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751183 spots for SRR8846516.sra Written 751183 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra Read 751178 spots for SRR8846516.sra Written 751178 spots for SRR8846516.sra SRR ids: ['SRR8846516.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_30vj41hn SRR8846516.sra spots: 15023565 blocks: [[1, 751178], [751179, 1502356], [1502357, 2253534], [2253535, 3004712], [3004713, 3755890], [3755891, 4507068], [4507069, 5258246], [5258247, 6009424], [6009425, 6760602], [6760603, 7511780], [7511781, 8262958], [8262959, 9014136], [9014137, 9765314], [9765315, 10516492], [10516493, 11267670], [11267671, 12018848], [12018849, 12770026], [12770027, 13521204], [13521205, 14272382], [14272383, 15023565]] SRR8846516 file size 5069292 SRR8846516 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846516 SRR8846516_1.fastq SRR8846516_2.fastq Input file: SRR8846516_1.fastq Paired file: SRR8846516_2.fastq trimmed: SRR8846516-trimmed-pair1.fastq, SRR8846516-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:57:05 2024 >> started Thu Dec 12 02:57:23 2024 >> done (17.959s) 15023565 read pairs processed; of these: 8920 ( 0.06%) short read pairs filtered out after trimming by size control 6132 ( 0.04%) empty read pairs filtered out after trimming by size control 15008513 (99.90%) read pairs available; of these: 8526277 (56.81%) trimmed read pairs available after processing 6482236 (43.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 8 0.00% 21 7 0.00% 22 11 0.00% 23 12 0.00% 24 8 0.00% 25 7 0.00% 26 11 0.00% 27 5 0.00% 28 7 0.00% 29 14 0.00% 30 8 0.00% 31 9 0.00% 32 10 0.00% 33 14 0.00% 34 9 0.00% 35 9 0.00% 36 14 0.00% 37 4 0.00% 38 13 0.00% 39 14 0.00% 40 7 0.00% 41 14 0.00% 42 11 0.00% 43 21 0.00% 44 12 0.00% 45 20 0.00% 46 30 0.00% 47 27 0.00% 48 28 0.00% 49 31 0.00% 50 38 0.00% 51 40 0.00% 52 40 0.00% 53 53 0.00% 54 56 0.00% 55 51 0.00% 56 45 0.00% 57 54 0.00% 58 66 0.00% 59 74 0.00% 60 82 0.00% 61 91 0.00% 62 106 0.00% 63 129 0.00% 64 105 0.00% 65 114 0.00% 66 136 0.00% 67 152 0.00% 68 208 0.00% 69 200 0.00% 70 211 0.00% 71 264 0.00% 72 303 0.00% 73 301 0.00% 74 397 0.00% 75 411 0.00% 76 465 0.00% 77 530 0.00% 78 609 0.00% 79 634 0.00% 80 734 0.00% 81 786 0.01% 82 985 0.01% 83 1063 0.01% 84 1523 0.01% 85 1801 0.01% 86 1870 0.01% 87 2022 0.01% 88 2173 0.01% 89 2331 0.02% 90 2336 0.02% 91 2566 0.02% 92 2815 0.02% 93 2869 0.02% 94 3300 0.02% 95 3510 0.02% 96 3686 0.02% 97 4053 0.03% 98 4265 0.03% 99 4623 0.03% 100 5036 0.03% 101 5390 0.04% 102 5883 0.04% 103 6108 0.04% 104 6619 0.04% 105 6987 0.05% 106 7693 0.05% 107 8280 0.06% 108 8612 0.06% 109 9259 0.06% 110 9991 0.07% 111 10815 0.07% 112 11340 0.08% 113 12090 0.08% 114 12937 0.09% 115 13736 0.09% 116 14632 0.10% 117 15623 0.10% 118 16358 0.11% 119 17608 0.12% 120 18515 0.12% 121 19972 0.13% 122 21312 0.14% 123 22691 0.15% 124 23829 0.16% 125 25540 0.17% 126 26855 0.18% 127 28932 0.19% 128 30902 0.21% 129 33075 0.22% 130 36124 0.24% 131 38658 0.26% 132 41762 0.28% 133 45348 0.30% 134 49189 0.33% 135 53781 0.36% 136 58531 0.39% 137 64843 0.43% 138 72088 0.48% 139 81243 0.54% 140 91256 0.61% 141 103294 0.69% 142 120075 0.80% 143 142183 0.95% 144 171792 1.14% 145 214955 1.43% 146 281844 1.88% 147 399665 2.66% 148 586983 3.91% 149 1125276 7.50% 150 4235082 28.22% 151 6482236 43.19% 15008513 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=18 prefix-density=0.76 prefix-fanout=2.1 sequence=AGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=43.72 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=12 prefix-density=0.76 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=126.81 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.5 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR8846516 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:58:17 Started mapping on | Dec 12 02:58:18 Finished on | Dec 12 02:59:45 Mapping speed, Million of reads per hour | 621.04 Number of input reads | 15008513 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14565297 Uniquely mapped reads % | 97.05% Average mapped length | 296.06 Number of splices: Total | 16412686 Number of splices: Annotated (sjdb) | 15501682 Number of splices: GT/AG | 16202186 Number of splices: GC/AG | 189597 Number of splices: AT/AC | 7890 Number of splices: Non-canonical | 13013 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 125194 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 20117 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.26% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 324620 324620 324620 N_multimapping 125194 125194 125194 N_noFeature 515250 14145300 638128 N_ambiguous 346622 1951 49828 UnstrandedReadsAssigned:13703425 PositiveStrandReadsAssigned:418046 NegativeStrandReadsAssigned:13877341 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR8846516 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846516-trimmed-pair1.fastq SRR8846516-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,008,513 reads, 13,902,909 reads pseudoaligned [quant] estimated average fragment length: 273.205 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52973 SRR8846516.ke.tsv 35125 SRR8846516.se.tsv 88098 total ==> SRR8846516.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.294 0 0 PNS24247 1044 771.795 45.6434 5.93966 PNS24249 1928 1655.79 44.2064 2.68141 PNS24246 1044 771.795 45.6434 5.93966 PNS24248 1044 771.795 45.6434 5.93966 PNS24244 1471 1198.79 22.8633 1.91549 PNS24243 293 79.557 0 0 KQK14069 1603 1330.79 1755.67 132.501 KQK14071 474 218.996 44.7851 20.5391 ==> SRR8846516.se.tsv <== BRADI_1g14170v3 2228 BRADI_1g53295v3 63 BRADI_1g59795v3 560 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2468 BRADI_1g74790v3 47 BRADI_1g09890v3 1 BRADI_1g77505v3 212 BRADI_1g48960v3 0 SRR8846516 completed mapping pipeline successfully