Starting /dee2/code/volunteer_pipeline.sh SRR8846517 current disk space = 1506109198336 free memory = 1417962896 SRR8846517 SRAfilesize c795a46c8fdc8523a97c814065b58380 SRR8846517.sra SRR8846517.sra file validated SRR8846517 is paired end SRR8846517 is conventional basespace SRR8846517 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846517_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.08675 27.0 18.0 32.0 18.0 33.0 2 29.55 31.0 27.0 33.0 25.0 33.0 3 31.96125 33.0 32.0 33.0 28.0 33.0 4 30.63975 33.0 31.0 33.0 28.0 33.0 5 31.81 33.0 32.0 33.0 30.0 33.0 6 36.9005 38.0 37.0 38.0 35.0 38.0 7 37.12725 38.0 38.0 38.0 36.0 38.0 8 37.137 38.0 38.0 38.0 36.0 38.0 9 37.31975 38.0 38.0 38.0 37.0 38.0 10-14 37.325750000000006 38.0 38.0 38.0 36.8 38.0 15-19 37.26855 38.0 38.0 38.0 37.0 38.0 20-24 37.251850000000005 38.0 38.0 38.0 36.4 38.0 25-29 37.28615 38.0 38.0 38.0 36.6 38.0 30-34 37.3384 38.0 38.0 38.0 37.0 38.0 35-39 37.26765 38.0 38.0 38.0 36.6 38.0 40-44 36.96795 38.0 38.0 38.0 35.6 38.0 45-49 36.892250000000004 38.0 38.0 38.0 35.0 38.0 50-54 36.982 38.0 38.0 38.0 35.4 38.0 55-59 36.7639 38.0 38.0 38.0 34.6 38.0 60-64 36.7445 38.0 38.0 38.0 34.4 38.0 65-69 36.63119999999999 38.0 38.0 38.0 34.2 38.0 70-74 36.4472 38.0 37.6 38.0 33.8 38.0 75-79 36.40195 38.0 37.4 38.0 33.8 38.0 80-84 36.110800000000005 38.0 37.0 38.0 32.6 38.0 85-89 35.83975 38.0 36.6 38.0 31.4 38.0 90-94 35.4003 38.0 36.0 38.0 29.0 38.0 95-99 35.3831 38.0 36.0 38.0 29.0 38.0 100-104 35.1963 38.0 35.4 38.0 28.4 38.0 105-109 35.04195 38.0 35.0 38.0 27.8 38.0 110-114 34.33015 38.0 34.2 38.0 24.4 38.0 115-119 33.714 38.0 33.8 38.0 21.8 38.0 120-124 33.5784 37.8 33.8 38.0 20.6 38.0 125-129 33.209199999999996 37.0 33.0 38.0 18.6 38.0 130-134 32.5534 36.4 31.8 38.0 14.8 38.0 135-139 31.313049999999997 35.6 29.4 38.0 14.0 38.0 140-144 30.38885 35.0 27.0 38.0 13.4 38.0 145-149 29.080750000000002 33.8 25.4 38.0 6.4 38.0 150-151 23.936374999999998 30.5 11.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 1.0 17 2.0 18 1.0 19 2.0 20 2.0 21 3.0 22 10.0 23 11.0 24 20.0 25 27.0 26 34.0 27 40.0 28 54.0 29 65.0 30 75.0 31 127.0 32 156.0 33 257.0 34 394.0 35 676.0 36 1212.0 37 825.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.045431342521695 18.83614088820827 8.44818785094436 43.67023991832568 2 23.35 21.6 33.875 21.175 3 19.075 29.15 24.224999999999998 27.55 4 25.2 33.074999999999996 20.05 21.675 5 23.43671835917959 34.017008504252125 21.68584292146073 20.860430215107552 6 19.1 33.125 23.599999999999998 24.175 7 17.1 19.025 41.55 22.325 8 19.675 21.85 27.425 31.05 9 19.025 20.45 32.375 28.15 10-14 22.82 25.935000000000002 24.27 26.974999999999998 15-19 22.675 25.795 25.81 25.72 20-24 21.93 26.419999999999998 25.41 26.240000000000002 25-29 22.765 26.215 25.615 25.405 30-34 22.720000000000002 25.86 26.185000000000002 25.235000000000003 35-39 22.62 26.245 26.05 25.085 40-44 22.58 26.97 25.740000000000002 24.709999999999997 45-49 22.57 25.874999999999996 25.380000000000003 26.174999999999997 50-54 22.54 25.424999999999997 26.355 25.679999999999996 55-59 22.66 26.619999999999997 25.729999999999997 24.990000000000002 60-64 22.82 26.35 25.695 25.135 65-69 22.8 26.165 26.005 25.03 70-74 22.99 26.095000000000002 25.47 25.445 75-79 22.945 26.51 25.71 24.834999999999997 80-84 22.720000000000002 25.945 25.835 25.5 85-89 23.435 25.665 25.679999999999996 25.22 90-94 23.169999999999998 25.45 25.929999999999996 25.45 95-99 23.169999999999998 25.09 26.265 25.474999999999998 100-104 23.5 25.775 25.5 25.224999999999998 105-109 22.900000000000002 26.165 26.075 24.86 110-114 23.015 26.07 26.229999999999997 24.685000000000002 115-119 23.73 26.240000000000002 25.435000000000002 24.595 120-124 23.22 25.740000000000002 25.77 25.27 125-129 23.51 25.924999999999997 25.435000000000002 25.130000000000003 130-134 23.369999999999997 25.785000000000004 25.674999999999997 25.169999999999998 135-139 23.630000000000003 25.755 25.215 25.4 140-144 23.21 25.295 26.029999999999998 25.465 145-149 23.535 24.91 25.88 25.674999999999997 150-151 23.549999999999997 24.5125 26.125 25.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 2.5 27 3.5 28 2.5 29 2.0 30 7.0 31 15.5 32 21.5 33 25.5 34 32.0 35 36.5 36 49.0 37 70.0 38 92.5 39 119.0 40 140.0 41 167.0 42 197.5 43 207.5 44 201.5 45 206.0 46 213.0 47 213.0 48 204.5 49 191.0 50 181.5 51 160.5 52 123.5 53 103.0 54 97.5 55 93.0 56 83.0 57 69.5 58 63.0 59 65.0 60 62.5 61 53.5 62 54.5 63 52.0 64 47.0 65 42.0 66 36.5 67 32.5 68 28.5 69 26.5 70 27.0 71 23.0 72 15.5 73 11.5 74 10.0 75 7.0 76 5.0 77 2.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21815889029004 98.35000000000001 2 0.6809583858764187 1.35 3 0.1008827238335435 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.2000000000000002 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.95 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.2625 0.0 0.0 0.0 0.0 136-137 2.375 0.0 0.0 0.0 0.0 138-139 2.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8846517 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846517_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7445 33.0 33.0 34.0 32.0 34.0 2 32.784 33.0 33.0 34.0 32.0 34.0 3 32.60475 33.0 33.0 34.0 31.0 34.0 4 32.747 33.0 33.0 34.0 32.0 34.0 5 32.82025 33.0 33.0 34.0 32.0 34.0 6 37.008 38.0 38.0 38.0 36.0 38.0 7 36.988 38.0 38.0 38.0 36.0 38.0 8 37.04175 38.0 38.0 38.0 36.0 38.0 9 37.0325 38.0 38.0 38.0 36.0 38.0 10-14 37.014450000000004 38.0 38.0 38.0 36.2 38.0 15-19 37.0031 38.0 38.0 38.0 36.0 38.0 20-24 36.98795 38.0 38.0 38.0 35.8 38.0 25-29 36.935249999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.8712 38.0 38.0 38.0 35.6 38.0 35-39 36.6789 38.0 38.0 38.0 34.6 38.0 40-44 36.71829999999999 38.0 38.0 38.0 34.8 38.0 45-49 36.7284 38.0 38.0 38.0 34.8 38.0 50-54 36.524 38.0 38.0 38.0 34.2 38.0 55-59 36.32835 38.0 38.0 38.0 33.6 38.0 60-64 36.3427 38.0 38.0 38.0 33.8 38.0 65-69 36.461850000000005 38.0 38.0 38.0 34.0 38.0 70-74 36.423249999999996 38.0 38.0 38.0 33.8 38.0 75-79 36.01675 38.0 37.0 38.0 32.4 38.0 80-84 35.932300000000005 38.0 37.0 38.0 32.0 38.0 85-89 35.6993 38.0 36.6 38.0 30.6 38.0 90-94 35.590250000000005 38.0 36.4 38.0 30.4 38.0 95-99 35.28855 38.0 36.0 38.0 29.0 38.0 100-104 35.02615 38.0 35.4 38.0 28.2 38.0 105-109 34.47835 38.0 34.6 38.0 25.6 38.0 110-114 34.061350000000004 38.0 34.2 38.0 23.0 38.0 115-119 33.7527 38.0 34.0 38.0 22.2 38.0 120-124 33.1081 37.4 33.2 38.0 16.2 38.0 125-129 32.503699999999995 36.6 31.8 38.0 15.0 38.0 130-134 32.1368 36.2 31.2 38.0 14.0 38.0 135-139 30.96295 35.8 29.2 38.0 13.2 38.0 140-144 29.778700000000004 34.4 27.0 38.0 12.2 38.0 145-149 27.9538 33.2 22.4 38.0 2.0 38.0 150-151 20.416874999999997 25.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 1.0 6 0.0 7 2.0 8 0.0 9 1.0 10 1.0 11 1.0 12 2.0 13 0.0 14 2.0 15 1.0 16 5.0 17 6.0 18 9.0 19 7.0 20 12.0 21 9.0 22 13.0 23 16.0 24 31.0 25 26.0 26 40.0 27 52.0 28 58.0 29 82.0 30 87.0 31 124.0 32 140.0 33 227.0 34 327.0 35 616.0 36 1089.0 37 1007.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.325 14.025000000000002 12.049999999999999 37.6 2 27.950000000000003 18.75 33.925 19.375 3 22.75 22.1 30.4 24.75 4 25.074999999999996 32.25 19.025 23.65 5 27.425 33.4 20.5 18.675 6 21.099999999999998 34.699999999999996 20.674999999999997 23.525 7 20.4 14.6 38.800000000000004 26.200000000000003 8 21.425 20.9 24.85 32.824999999999996 9 23.225 21.125 27.200000000000003 28.449999999999996 10-14 26.22 24.37 23.32 26.090000000000003 15-19 25.505 25.155 24.42 24.92 20-24 24.94 25.28 25.374999999999996 24.404999999999998 25-29 25.83 24.765 24.72 24.685000000000002 30-34 24.715 25.66 24.759999999999998 24.865000000000002 35-39 25.56 25.5 24.72 24.22 40-44 25.629999999999995 25.380000000000003 24.605 24.385 45-49 25.4 25.319999999999997 25.074999999999996 24.205 50-54 25.21 25.669999999999998 24.91 24.21 55-59 25.55 25.19 24.985 24.275 60-64 25.740000000000002 25.835 24.565 23.86 65-69 25.740000000000002 25.22 25.145 23.895 70-74 25.645 25.2 25.255 23.9 75-79 25.715 25.185000000000002 24.93 24.169999999999998 80-84 25.825 25.255 24.8 24.12 85-89 25.380000000000003 25.295 25.259999999999998 24.065 90-94 25.64 25.424999999999997 25.05 23.885 95-99 26.05 25.569999999999997 24.67 23.71 100-104 25.900000000000002 24.975 25.605 23.52 105-109 25.755 25.080000000000002 25.6 23.565 110-114 25.46 25.900000000000002 24.765 23.875 115-119 26.015 24.73 25.424999999999997 23.830000000000002 120-124 25.81 25.905 25.255 23.03 125-129 26.075 25.89 25.56 22.475 130-134 25.88 25.75 25.53 22.84 135-139 25.285000000000004 25.979999999999997 25.369999999999997 23.365 140-144 26.029999999999998 25.755 25.295 22.919999999999998 145-149 26.105 25.4 25.52 22.975 150-151 26.3 26.200000000000003 25.7375 21.762500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 1.0 25 2.5 26 2.5 27 2.5 28 3.5 29 4.0 30 5.0 31 7.0 32 12.5 33 19.5 34 25.5 35 30.5 36 41.0 37 47.5 38 57.5 39 83.5 40 114.0 41 145.5 42 158.0 43 176.5 44 200.0 45 205.0 46 204.5 47 196.0 48 189.0 49 177.5 50 162.0 51 147.0 52 137.0 53 126.5 54 111.0 55 99.0 56 85.0 57 76.0 58 77.5 59 90.0 60 86.0 61 74.0 62 73.0 63 74.5 64 69.5 65 60.0 66 57.0 67 50.0 68 47.5 69 46.0 70 37.0 71 28.5 72 21.0 73 17.0 74 13.0 75 8.0 76 5.5 77 3.5 78 1.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.5794910556815319 1.15 3 0.10078105316200556 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.2000000000000002 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.2625 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATA 10 0.006830828 145.0 2 CGGGCCC 10 0.006830828 145.0 8 TCGGGCC 10 0.006830828 145.0 7 GGGCCCG 10 0.006830828 145.0 9 >>END_MODULE Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726630 spots for SRR8846517.sra Written 726630 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra Read 726618 spots for SRR8846517.sra Written 726618 spots for SRR8846517.sra SRR ids: ['SRR8846517.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wes57o67 SRR8846517.sra spots: 14532372 blocks: [[1, 726618], [726619, 1453236], [1453237, 2179854], [2179855, 2906472], [2906473, 3633090], [3633091, 4359708], [4359709, 5086326], [5086327, 5812944], [5812945, 6539562], [6539563, 7266180], [7266181, 7992798], [7992799, 8719416], [8719417, 9446034], [9446035, 10172652], [10172653, 10899270], [10899271, 11625888], [11625889, 12352506], [12352507, 13079124], [13079125, 13805742], [13805743, 14532372]] SRR8846517 file size 4902843 SRR8846517 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846517 SRR8846517_1.fastq SRR8846517_2.fastq Input file: SRR8846517_1.fastq Paired file: SRR8846517_2.fastq trimmed: SRR8846517-trimmed-pair1.fastq, SRR8846517-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 05:14:32 2024 >> started Mon Dec 9 05:16:21 2024 >> done (108.924s) 14532372 read pairs processed; of these: 9908 ( 0.07%) short read pairs filtered out after trimming by size control 7949 ( 0.05%) empty read pairs filtered out after trimming by size control 14514515 (99.88%) read pairs available; of these: 8138428 (56.07%) trimmed read pairs available after processing 6376087 (43.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 3 0.00% 21 11 0.00% 22 7 0.00% 23 3 0.00% 24 8 0.00% 25 6 0.00% 26 7 0.00% 27 8 0.00% 28 5 0.00% 29 12 0.00% 30 2 0.00% 31 7 0.00% 32 9 0.00% 33 12 0.00% 34 7 0.00% 35 8 0.00% 36 11 0.00% 37 6 0.00% 38 10 0.00% 39 7 0.00% 40 13 0.00% 41 17 0.00% 42 17 0.00% 43 18 0.00% 44 10 0.00% 45 19 0.00% 46 25 0.00% 47 27 0.00% 48 27 0.00% 49 13 0.00% 50 17 0.00% 51 31 0.00% 52 32 0.00% 53 25 0.00% 54 37 0.00% 55 45 0.00% 56 45 0.00% 57 48 0.00% 58 54 0.00% 59 60 0.00% 60 73 0.00% 61 92 0.00% 62 83 0.00% 63 101 0.00% 64 103 0.00% 65 127 0.00% 66 136 0.00% 67 128 0.00% 68 144 0.00% 69 196 0.00% 70 209 0.00% 71 216 0.00% 72 282 0.00% 73 309 0.00% 74 338 0.00% 75 397 0.00% 76 421 0.00% 77 475 0.00% 78 498 0.00% 79 557 0.00% 80 636 0.00% 81 695 0.00% 82 853 0.01% 83 1001 0.01% 84 1441 0.01% 85 1640 0.01% 86 1749 0.01% 87 1856 0.01% 88 2001 0.01% 89 2057 0.01% 90 2223 0.02% 91 2319 0.02% 92 2553 0.02% 93 2621 0.02% 94 2941 0.02% 95 3150 0.02% 96 3568 0.02% 97 3707 0.03% 98 3937 0.03% 99 4235 0.03% 100 4513 0.03% 101 4902 0.03% 102 5172 0.04% 103 5585 0.04% 104 6066 0.04% 105 6491 0.04% 106 6955 0.05% 107 7617 0.05% 108 7968 0.05% 109 8716 0.06% 110 9099 0.06% 111 9711 0.07% 112 10226 0.07% 113 11060 0.08% 114 11893 0.08% 115 12693 0.09% 116 13505 0.09% 117 14385 0.10% 118 15197 0.10% 119 16269 0.11% 120 17251 0.12% 121 18549 0.13% 122 19473 0.13% 123 20841 0.14% 124 22045 0.15% 125 23680 0.16% 126 25174 0.17% 127 27267 0.19% 128 28536 0.20% 129 31079 0.21% 130 33162 0.23% 131 36030 0.25% 132 39168 0.27% 133 42504 0.29% 134 46037 0.32% 135 49893 0.34% 136 55772 0.38% 137 60985 0.42% 138 67552 0.47% 139 75955 0.52% 140 85622 0.59% 141 97420 0.67% 142 114671 0.79% 143 135558 0.93% 144 163448 1.13% 145 206740 1.42% 146 275988 1.90% 147 389457 2.68% 148 570394 3.93% 149 1060893 7.31% 150 4058452 27.96% 151 6376087 43.93% 14514515 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=9 prefix-density=0.93 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=12.93 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=2.8 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAG criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=12 prefix-density=0.84 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=144.06 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.7 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR8846517 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 05:20:25 Started mapping on | Dec 09 05:20:26 Finished on | Dec 09 05:28:35 Mapping speed, Million of reads per hour | 106.86 Number of input reads | 14514515 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14239809 Uniquely mapped reads % | 98.11% Average mapped length | 296.23 Number of splices: Total | 16288462 Number of splices: Annotated (sjdb) | 15400790 Number of splices: GT/AG | 16079889 Number of splices: GC/AG | 188860 Number of splices: AT/AC | 7770 Number of splices: Non-canonical | 11943 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 125011 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 14890 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 156314 156314 156314 N_multimapping 125011 125011 125011 N_noFeature 498047 13843713 608907 N_ambiguous 334332 1984 49659 UnstrandedReadsAssigned:13407430 PositiveStrandReadsAssigned:394112 NegativeStrandReadsAssigned:13581243 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846517 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846517-trimmed-pair1.fastq SRR8846517-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,514,515 reads, 13,619,782 reads pseudoaligned [quant] estimated average fragment length: 279.777 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR8846517.ke.tsv 35125 SRR8846517.se.tsv 88098 total ==> SRR8846517.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 657.77 5.32201e-07 8.46649e-08 PNS24247 1044 765.223 44.3336 6.06242 PNS24249 1928 1649.22 38.033 2.41314 PNS24246 1044 765.223 44.3336 6.06242 PNS24248 1044 765.223 44.3336 6.06242 PNS24244 1471 1192.22 31.9663 2.80567 PNS24243 293 77.1917 0 0 KQK14069 1603 1324.22 1347.01 106.442 KQK14071 474 213.553 49.0437 24.0314 ==> SRR8846517.se.tsv <== BRADI_1g14170v3 1898 BRADI_1g53295v3 55 BRADI_1g59795v3 561 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 2600 BRADI_1g74790v3 38 BRADI_1g09890v3 0 BRADI_1g77505v3 214 BRADI_1g48960v3 0 SRR8846517 completed mapping pipeline successfully