Starting /dee2/code/volunteer_pipeline.sh SRR8846519 current disk space = 1515382239232 free memory = 1590376740 SRR8846519 SRAfilesize 61c211994ee8b99f7a3025d9441ecabd SRR8846519.sra SRR8846519.sra file validated SRR8846519 is paired end SRR8846519 is conventional basespace SRR8846519 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846519_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.55825 18.0 18.0 31.0 18.0 33.0 2 28.05525 29.0 27.0 31.0 18.0 33.0 3 28.33325 29.0 27.0 31.0 18.0 33.0 4 28.94225 31.0 29.0 33.0 15.0 33.0 5 31.83725 33.0 32.0 33.0 31.0 33.0 6 36.09875 38.0 37.0 38.0 33.0 38.0 7 36.92775 38.0 38.0 38.0 35.0 38.0 8 37.09875 38.0 38.0 38.0 36.0 38.0 9 37.187 38.0 38.0 38.0 36.0 38.0 10-14 37.11685 38.0 38.0 38.0 35.8 38.0 15-19 37.4534 38.0 38.0 38.0 37.2 38.0 20-24 37.49305 38.0 38.0 38.0 37.4 38.0 25-29 37.3718 38.0 38.0 38.0 37.0 38.0 30-34 37.16495 38.0 38.0 38.0 36.6 38.0 35-39 37.11645 38.0 38.0 38.0 36.0 38.0 40-44 37.25725 38.0 38.0 38.0 36.4 38.0 45-49 37.19935 38.0 38.0 38.0 36.2 38.0 50-54 37.1125 38.0 38.0 38.0 36.0 38.0 55-59 36.965500000000006 38.0 38.0 38.0 35.8 38.0 60-64 36.87665 38.0 38.0 38.0 35.2 38.0 65-69 36.960300000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.86385 38.0 38.0 38.0 35.0 38.0 75-79 36.790800000000004 38.0 38.0 38.0 34.6 38.0 80-84 36.27804999999999 38.0 37.4 38.0 33.0 38.0 85-89 36.09105 38.0 37.0 38.0 32.6 38.0 90-94 36.1626 38.0 37.0 38.0 33.0 38.0 95-99 36.36415 38.0 37.4 38.0 33.8 38.0 100-104 36.05035 38.0 37.0 38.0 32.6 38.0 105-109 35.01595 38.0 35.2 38.0 27.4 38.0 110-114 35.29115 38.0 35.8 38.0 28.8 38.0 115-119 35.5259 38.0 36.0 38.0 30.2 38.0 120-124 35.32305 38.0 35.6 38.0 29.4 38.0 125-129 34.287349999999996 38.0 34.4 38.0 24.4 38.0 130-134 33.55115 38.0 33.8 38.0 21.4 38.0 135-139 33.9367 38.0 34.0 38.0 22.8 38.0 140-144 33.47285 38.0 33.4 38.0 20.6 38.0 145-149 32.89185 38.0 33.4 38.0 16.8 38.0 150-151 27.947499999999998 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 0.0 17 2.0 18 2.0 19 1.0 20 5.0 21 5.0 22 7.0 23 5.0 24 8.0 25 13.0 26 20.0 27 23.0 28 25.0 29 43.0 30 54.0 31 92.0 32 120.0 33 191.0 34 276.0 35 484.0 36 1116.0 37 1504.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.6 12.225 19.625 41.55 2 25.05 18.975 36.4 19.575 3 21.625 24.9 26.6 26.875 4 25.03125781445361 31.38284571142786 21.955488872218055 21.630407601900476 5 24.125 32.824999999999996 23.325000000000003 19.725 6 18.91823899371069 33.081761006289305 24.07547169811321 23.924528301886795 7 15.5 19.6 42.125 22.775000000000002 8 20.025000000000002 20.175 28.4 31.4 9 18.875 19.425 31.424999999999997 30.275000000000002 10-14 22.645 25.81 24.665 26.88 15-19 22.36 25.85 26.13 25.66 20-24 21.925 26.115 26.55 25.41 25-29 22.497249724972498 26.46264626462646 26.37763776377638 24.66246624662466 30-34 21.725 26.565 26.31 25.4 35-39 22.975 26.325 25.924999999999997 24.775 40-44 22.264999999999997 26.125 26.11 25.5 45-49 21.975 26.275 26.979999999999997 24.77 50-54 22.31223122312231 25.962596259625965 26.542654265426542 25.18251825182518 55-59 22.23222322232223 26.27762776277628 26.68266826682668 24.80748074807481 60-64 21.855 26.424999999999997 25.779999999999998 25.94 65-69 22.35 26.455000000000002 25.82 25.374999999999996 70-74 22.99 26.325 25.635 25.05 75-79 22.59 25.82 26.31 25.28 80-84 23.07153576788394 25.512756378189096 26.033016508254125 25.382691345672836 85-89 22.44846908144887 25.99559735841505 26.345807484490695 25.21012607564539 90-94 22.821410705352676 25.332666333166582 26.468234117058532 25.377688844422213 95-99 22.812984544590606 25.71399989996499 26.024108437953288 25.44890711749112 100-104 21.85 25.324999999999996 27.125 25.7 105-109 22.595000000000002 25.555 26.419999999999998 25.430000000000003 110-114 22.900000000000002 25.705 26.224999999999998 25.169999999999998 115-119 22.665 25.88 26.314999999999998 25.14 120-124 22.46 25.85 26.51 25.180000000000003 125-129 23.074614922984598 25.55511102220444 26.430286057211443 24.93998799759952 130-134 22.6986191715029 26.105663398038825 25.55033019811887 25.645387232339406 135-139 22.914894681543004 26.182018311902738 25.28643618351929 25.616650823034977 140-144 23.106174322025417 25.813069148403883 26.34844391073752 24.732312618833184 145-149 22.915311890350658 25.6965634535541 25.62152968835976 25.76659496773548 150-151 24.163848177376927 25.115871226356006 26.13052737066266 24.58975322560441 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 1.0 26 0.0 27 2.5 28 4.0 29 6.5 30 12.5 31 15.0 32 20.5 33 26.5 34 30.5 35 44.5 36 59.5 37 70.0 38 101.0 39 127.0 40 130.5 41 158.5 42 183.0 43 195.5 44 225.0 45 240.0 46 248.0 47 231.5 48 194.0 49 172.0 50 159.0 51 136.5 52 111.5 53 105.5 54 103.0 55 99.5 56 89.0 57 77.0 58 75.5 59 70.0 60 60.5 61 57.5 62 53.5 63 48.0 64 41.0 65 34.5 66 34.0 67 28.0 68 26.0 69 24.5 70 15.5 71 11.5 72 9.0 73 7.5 74 5.5 75 5.0 76 4.0 77 2.5 78 1.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.625 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.01 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.05 85-89 0.06 90-94 0.05 95-99 0.034999999999999996 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.02 130-134 0.06 135-139 0.065 140-144 0.06999999999999999 145-149 0.045 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.42500000000000004 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.7875 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.175 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.6125 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138-139 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAATTAC 10 0.006841402 144.925 9 >>END_MODULE SRR8846519 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846519_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.726 33.0 33.0 34.0 32.0 34.0 2 32.62525 33.0 33.0 34.0 32.0 34.0 3 32.96875 34.0 33.0 34.0 32.0 34.0 4 32.9585 34.0 33.0 34.0 32.0 34.0 5 32.94975 34.0 33.0 34.0 32.0 34.0 6 37.204 38.0 38.0 38.0 37.0 38.0 7 37.1865 38.0 38.0 38.0 37.0 38.0 8 37.22125 38.0 38.0 38.0 37.0 38.0 9 37.221 38.0 38.0 38.0 37.0 38.0 10-14 37.210899999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.0433 38.0 38.0 38.0 36.4 38.0 20-24 36.914049999999996 38.0 38.0 38.0 35.8 38.0 25-29 36.794799999999995 38.0 38.0 38.0 35.0 38.0 30-34 37.00745 38.0 38.0 38.0 36.0 38.0 35-39 37.0017 38.0 38.0 38.0 36.0 38.0 40-44 36.79015 38.0 38.0 38.0 35.6 38.0 45-49 36.581500000000005 38.0 38.0 38.0 34.4 38.0 50-54 36.61805 38.0 38.0 38.0 34.6 38.0 55-59 36.71485 38.0 38.0 38.0 34.8 38.0 60-64 36.476549999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.55305 38.0 38.0 38.0 34.6 38.0 70-74 36.7301 38.0 38.0 38.0 35.0 38.0 75-79 36.7425 38.0 38.0 38.0 35.0 38.0 80-84 36.7373 38.0 38.0 38.0 34.8 38.0 85-89 36.47385 38.0 38.0 38.0 34.2 38.0 90-94 36.276500000000006 38.0 37.8 38.0 33.8 38.0 95-99 36.04205 38.0 37.4 38.0 32.8 38.0 100-104 36.07955 38.0 37.6 38.0 33.2 38.0 105-109 35.65905 38.0 36.8 38.0 31.4 38.0 110-114 35.3644 38.0 36.2 38.0 29.2 38.0 115-119 35.2269 38.0 36.0 38.0 28.6 38.0 120-124 35.3505 38.0 36.0 38.0 30.2 38.0 125-129 35.34285 38.0 36.0 38.0 31.0 38.0 130-134 34.669850000000004 38.0 35.0 38.0 26.6 38.0 135-139 34.18945000000001 38.0 34.8 38.0 23.2 38.0 140-144 34.2083 38.0 34.6 38.0 24.4 38.0 145-149 33.51855 38.0 33.0 38.0 23.0 38.0 150-151 29.118499999999997 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 2.0 13 1.0 14 5.0 15 1.0 16 1.0 17 2.0 18 2.0 19 10.0 20 2.0 21 8.0 22 6.0 23 10.0 24 10.0 25 19.0 26 25.0 27 27.0 28 29.0 29 35.0 30 53.0 31 77.0 32 103.0 33 131.0 34 198.0 35 336.0 36 661.0 37 2235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.525 13.425 13.375 37.675 2 29.099999999999998 18.925 33.475 18.5 3 23.0 22.35 29.799999999999997 24.85 4 25.575 31.825 18.85 23.75 5 27.125 33.5 20.150000000000002 19.225 6 19.775000000000002 34.675 21.0 24.55 7 20.1 15.075 40.25 24.575 8 22.225 20.525 25.1 32.15 9 21.775 22.625 27.775 27.825 10-14 25.440176070428173 24.754901960784316 23.49939975990396 26.305522208883552 15-19 25.068760314047108 25.388808321248185 25.198779816972543 24.343651547732158 20-24 25.679999999999996 25.845000000000002 24.95 23.525 25-29 24.857485748574856 25.677567756775677 25.472547254725477 23.99239923992399 30-34 25.52 26.465 24.959999999999997 23.055 35-39 25.61 25.615 25.095 23.68 40-44 25.319999999999997 26.145000000000003 24.93 23.605 45-49 25.74757475747575 25.84758475847585 24.872487248724873 23.532353235323534 50-54 25.39634908727182 26.0865216304076 25.036259064766192 23.48087021755439 55-59 25.29511804721889 25.76030412164866 25.115046018407362 23.82953181272509 60-64 25.82145536384096 25.456364091022753 25.026256564141036 23.695923980995246 65-69 25.285000000000004 25.575 25.905 23.235 70-74 25.405 25.979999999999997 25.5 23.115 75-79 25.64 25.759999999999998 25.195 23.405 80-84 25.490000000000002 25.605 25.619999999999997 23.285 85-89 25.105 26.284999999999997 25.285000000000004 23.325000000000003 90-94 25.41135283820955 25.656414103525883 25.386346586646663 23.545886471617905 95-99 25.834208814848164 26.184401420781427 25.02876582120166 22.952623943168742 100-104 26.262322974528352 25.64679977981284 25.301506280338288 22.789370965320522 105-109 25.628065258732857 25.708137323591234 25.117605845260734 23.54619157241517 110-114 25.537876513559493 25.793055138597015 25.092564795356747 23.57650355248674 115-119 25.79918955425484 26.104357396568112 24.868677772775026 23.22777527640202 120-124 25.586513931269074 26.64198889500275 25.69156120254114 22.079935971187034 125-129 25.81774532359708 26.54296288886666 25.007502250675202 22.631789536861056 130-134 25.686558951528188 26.76204291931369 24.731129008053625 22.8202691211045 135-139 25.86534613845538 26.065426170468186 25.8703481392557 22.198879551820728 140-144 25.7190016505777 26.714350022507876 25.24383534236983 22.32281298454459 145-149 26.34026805361072 25.68513702740548 25.71514302860572 22.259451890378077 150-151 25.697485299637187 26.54822970098836 25.960215188289755 21.7940698110847 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 1.5 26 0.5 27 0.5 28 3.5 29 7.5 30 7.5 31 7.5 32 15.5 33 19.5 34 23.0 35 37.5 36 53.5 37 66.0 38 77.5 39 96.0 40 120.0 41 143.5 42 163.5 43 186.5 44 209.0 45 215.5 46 210.5 47 194.5 48 190.5 49 185.5 50 157.5 51 133.0 52 124.0 53 124.5 54 114.5 55 95.5 56 88.0 57 96.0 58 95.5 59 84.5 60 72.0 61 70.5 62 69.0 63 58.0 64 50.0 65 49.5 66 52.0 67 44.0 68 41.0 69 38.0 70 25.5 71 19.0 72 20.5 73 14.5 74 5.5 75 6.0 76 6.5 77 3.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.04 15-19 0.015 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.025 55-59 0.04 60-64 0.025 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.025 95-99 0.055 100-104 0.08499999999999999 105-109 0.09 110-114 0.06999999999999999 115-119 0.055 120-124 0.045 125-129 0.03 130-134 0.045 135-139 0.04 140-144 0.034999999999999996 145-149 0.02 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2936427850656 98.4 2 0.5802219979818365 1.15 3 0.07568113017154389 0.22499999999999998 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7125 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.175 0.0 0.0 0.0 0.0 130-131 1.4500000000000002 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.6625 0.0 0.0 0.0 0.0 136-137 1.875 0.0 0.0 0.0 0.0 138-139 2.0999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACACA 10 0.006830828 145.0 5 ACACAGC 10 0.006830828 145.0 7 AAAACAC 10 0.006830828 145.0 4 CACAGCT 10 0.006830828 145.0 8 CTCAACC 10 0.006830828 145.0 7 ACAGCTG 10 0.006830828 145.0 9 >>END_MODULE Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860388 spots for SRR8846519.sra Written 860388 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra Read 860376 spots for SRR8846519.sra Written 860376 spots for SRR8846519.sra SRR ids: ['SRR8846519.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_77_38fj8 SRR8846519.sra spots: 17207532 blocks: [[1, 860376], [860377, 1720752], [1720753, 2581128], [2581129, 3441504], [3441505, 4301880], [4301881, 5162256], [5162257, 6022632], [6022633, 6883008], [6883009, 7743384], [7743385, 8603760], [8603761, 9464136], [9464137, 10324512], [10324513, 11184888], [11184889, 12045264], [12045265, 12905640], [12905641, 13766016], [13766017, 14626392], [14626393, 15486768], [15486769, 16347144], [16347145, 17207532]] SRR8846519 file size 5809367 SRR8846519 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846519 SRR8846519_1.fastq SRR8846519_2.fastq Input file: SRR8846519_1.fastq Paired file: SRR8846519_2.fastq trimmed: SRR8846519-trimmed-pair1.fastq, SRR8846519-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:59:02 2024 >> started Thu Dec 12 02:59:29 2024 >> done (26.618s) 17207532 read pairs processed; of these: 6206 ( 0.04%) short read pairs filtered out after trimming by size control 3825 ( 0.02%) empty read pairs filtered out after trimming by size control 17197501 (99.94%) read pairs available; of these: 6975472 (40.56%) trimmed read pairs available after processing 10222029 (59.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 8 0.00% 21 5 0.00% 22 5 0.00% 23 9 0.00% 24 7 0.00% 25 8 0.00% 26 4 0.00% 27 12 0.00% 28 8 0.00% 29 14 0.00% 30 7 0.00% 31 8 0.00% 32 12 0.00% 33 17 0.00% 34 14 0.00% 35 9 0.00% 36 8 0.00% 37 8 0.00% 38 10 0.00% 39 7 0.00% 40 10 0.00% 41 14 0.00% 42 11 0.00% 43 16 0.00% 44 14 0.00% 45 13 0.00% 46 17 0.00% 47 20 0.00% 48 23 0.00% 49 17 0.00% 50 32 0.00% 51 26 0.00% 52 26 0.00% 53 34 0.00% 54 33 0.00% 55 39 0.00% 56 35 0.00% 57 53 0.00% 58 42 0.00% 59 53 0.00% 60 67 0.00% 61 83 0.00% 62 77 0.00% 63 94 0.00% 64 91 0.00% 65 105 0.00% 66 95 0.00% 67 122 0.00% 68 131 0.00% 69 134 0.00% 70 169 0.00% 71 168 0.00% 72 213 0.00% 73 213 0.00% 74 270 0.00% 75 277 0.00% 76 315 0.00% 77 366 0.00% 78 398 0.00% 79 424 0.00% 80 483 0.00% 81 558 0.00% 82 675 0.00% 83 707 0.00% 84 1059 0.01% 85 1252 0.01% 86 1376 0.01% 87 1558 0.01% 88 1571 0.01% 89 1756 0.01% 90 1711 0.01% 91 1938 0.01% 92 2086 0.01% 93 2321 0.01% 94 2446 0.01% 95 2685 0.02% 96 3001 0.02% 97 3098 0.02% 98 3339 0.02% 99 3588 0.02% 100 3854 0.02% 101 4144 0.02% 102 4447 0.03% 103 4837 0.03% 104 5218 0.03% 105 5466 0.03% 106 6247 0.04% 107 6434 0.04% 108 7238 0.04% 109 7452 0.04% 110 8068 0.05% 111 8473 0.05% 112 9004 0.05% 113 9530 0.06% 114 10015 0.06% 115 10874 0.06% 116 11362 0.07% 117 12037 0.07% 118 12842 0.07% 119 13914 0.08% 120 14546 0.08% 121 15453 0.09% 122 15969 0.09% 123 16886 0.10% 124 17796 0.10% 125 19122 0.11% 126 19919 0.12% 127 21382 0.12% 128 22391 0.13% 129 23940 0.14% 130 25678 0.15% 131 27118 0.16% 132 29479 0.17% 133 31601 0.18% 134 33832 0.20% 135 36712 0.21% 136 39811 0.23% 137 42956 0.25% 138 47526 0.28% 139 53382 0.31% 140 58186 0.34% 141 65073 0.38% 142 74663 0.43% 143 86691 0.50% 144 104382 0.61% 145 136338 0.79% 146 184582 1.07% 147 267771 1.56% 148 384337 2.23% 149 847319 4.93% 150 4007439 23.30% 151 10222029 59.44% 17197501 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=36 prefix-density=0.15 prefix-fanout=2.0 sequence=ACGAAGTTGGTGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=207.99 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=13.8 sequence=TCAGCTGCAAGCCGCCGTTGATATTCATGTCAACATGTATGTAAGATATTTAGGGGAATTTTATTTAAAGTAAGAAGATGATACTATATCCGTGAAGTTACATAACGTGACTGGCCCCACCAAGTGATTGTGAGGTACACTTATAGCTTGGACGAGAACATGAGCTTCGTTACCGACTAAAGATCATCAACCTCCTGTCACGACTTTGTTG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=39 prefix-density=0.44 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=675.56 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=20.3 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846519 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:00:25 Started mapping on | Dec 12 03:00:26 Finished on | Dec 12 03:01:42 Mapping speed, Million of reads per hour | 814.62 Number of input reads | 17197501 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16902817 Uniquely mapped reads % | 98.29% Average mapped length | 297.86 Number of splices: Total | 19698887 Number of splices: Annotated (sjdb) | 18560282 Number of splices: GT/AG | 19447100 Number of splices: GC/AG | 226324 Number of splices: AT/AC | 10559 Number of splices: Non-canonical | 14904 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 146132 % of reads mapped to multiple loci | 0.85% Number of reads mapped to too many loci | 11248 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.38% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 152837 152837 152837 N_multimapping 146132 146132 146132 N_noFeature 701245 16434101 845039 N_ambiguous 374119 2467 49500 UnstrandedReadsAssigned:15827453 PositiveStrandReadsAssigned:466249 NegativeStrandReadsAssigned:16008278 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR8846519 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846519-trimmed-pair1.fastq SRR8846519-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,197,501 reads, 16,050,407 reads pseudoaligned [quant] estimated average fragment length: 288.651 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR8846519.ke.tsv 35125 SRR8846519.se.tsv 88098 total ==> SRR8846519.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 648.903 3.725e-08 5.28135e-09 PNS24247 1044 756.349 60.8141 7.39742 PNS24249 1928 1640.35 47.1697 2.64561 PNS24246 1044 756.349 60.8141 7.39742 PNS24248 1044 756.349 60.8141 7.39742 PNS24244 1471 1183.35 79.3879 6.1722 PNS24243 293 74.9877 0 0 KQK14069 1603 1315.35 3762.69 263.182 KQK14071 474 208.861 11.9745 5.27471 ==> SRR8846519.se.tsv <== BRADI_1g14170v3 4035 BRADI_1g53295v3 102 BRADI_1g59795v3 204 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 1950 BRADI_1g74790v3 184 BRADI_1g09890v3 2 BRADI_1g77505v3 268 BRADI_1g48960v3 1 SRR8846519 completed mapping pipeline successfully