Starting /dee2/code/volunteer_pipeline.sh SRR8846522 current disk space = 1505540808704 free memory = 1536893824 SRR8846522 SRAfilesize bfcdfe6f39ad1991d221543ed179ad0c SRR8846522.sra SRR8846522.sra file validated SRR8846522 is paired end SRR8846522 is conventional basespace SRR8846522 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846522_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.25625 25.0 18.0 33.0 18.0 33.0 2 26.64675 27.0 25.0 31.0 18.0 33.0 3 26.737 28.0 25.0 31.0 18.0 33.0 4 30.215 31.0 29.0 33.0 27.0 33.0 5 31.92225 33.0 32.0 33.0 31.0 33.0 6 35.94025 38.0 36.0 38.0 33.0 38.0 7 36.93075 38.0 38.0 38.0 35.0 38.0 8 36.92575 38.0 38.0 38.0 35.0 38.0 9 37.27325 38.0 38.0 38.0 36.0 38.0 10-14 37.16355 38.0 38.0 38.0 36.2 38.0 15-19 37.4008 38.0 38.0 38.0 37.2 38.0 20-24 37.469899999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.4422 38.0 38.0 38.0 37.0 38.0 30-34 37.23885 38.0 38.0 38.0 36.8 38.0 35-39 37.2137 38.0 38.0 38.0 36.4 38.0 40-44 37.282 38.0 38.0 38.0 36.6 38.0 45-49 37.2943 38.0 38.0 38.0 36.6 38.0 50-54 37.1506 38.0 38.0 38.0 36.0 38.0 55-59 37.0824 38.0 38.0 38.0 36.0 38.0 60-64 36.9946 38.0 38.0 38.0 35.6 38.0 65-69 37.008 38.0 38.0 38.0 35.8 38.0 70-74 36.860150000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.82385000000001 38.0 38.0 38.0 35.0 38.0 80-84 36.420899999999996 38.0 37.6 38.0 33.8 38.0 85-89 36.35555000000001 38.0 37.2 38.0 33.4 38.0 90-94 36.2495 38.0 37.2 38.0 33.0 38.0 95-99 36.392849999999996 38.0 37.2 38.0 34.0 38.0 100-104 36.18755 38.0 37.2 38.0 33.2 38.0 105-109 35.44635 38.0 36.2 38.0 29.4 38.0 110-114 35.478300000000004 38.0 36.0 38.0 29.4 38.0 115-119 35.505649999999996 38.0 35.8 38.0 30.2 38.0 120-124 35.43735 38.0 35.8 38.0 30.2 38.0 125-129 34.796749999999996 38.0 35.0 38.0 27.0 38.0 130-134 33.949149999999996 38.0 34.0 38.0 22.6 38.0 135-139 34.12985 38.0 34.0 38.0 23.4 38.0 140-144 33.546099999999996 38.0 33.8 38.0 20.6 38.0 145-149 33.15505 38.0 33.8 38.0 18.6 38.0 150-151 28.395249999999997 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 1.0 20 1.0 21 5.0 22 3.0 23 7.0 24 8.0 25 13.0 26 16.0 27 23.0 28 22.0 29 32.0 30 57.0 31 77.0 32 135.0 33 172.0 34 257.0 35 464.0 36 1109.0 37 1592.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.699999999999996 10.875 8.35 38.074999999999996 2 29.299999999999997 16.525000000000002 34.849999999999994 19.325 3 20.625 23.875 24.099999999999998 31.4 4 23.967975981986488 33.600200150112585 21.09081811358519 21.341005754315738 5 25.45 32.1 23.474999999999998 18.975 6 20.161087339541908 32.09161842436446 24.71683866096149 23.03045557513214 7 15.725 19.775000000000002 42.3 22.2 8 19.950000000000003 19.525000000000002 28.000000000000004 32.525 9 18.9 19.400000000000002 31.95 29.75 10-14 23.3 25.665 24.005000000000003 27.029999999999998 15-19 22.264999999999997 26.365 25.25 26.119999999999997 20-24 22.02 26.125 26.085 25.77 25-29 22.836141807090353 25.946297314865742 26.64633231661583 24.57122856142807 30-34 22.5 25.795 26.090000000000003 25.615 35-39 22.835 26.245 25.83 25.09 40-44 23.215 25.995 25.755 25.035 45-49 22.71 26.11 25.585 25.595000000000002 50-54 22.98614930746537 25.65128256412821 25.661283064153206 25.701285064253216 55-59 22.830000000000002 25.924999999999997 25.6 25.645 60-64 22.705000000000002 25.64 25.564999999999998 26.090000000000003 65-69 23.555 25.759999999999998 25.455 25.230000000000004 70-74 23.435 25.895000000000003 25.490000000000002 25.180000000000003 75-79 22.855 25.45 26.07 25.624999999999996 80-84 22.78841826273941 25.388808321248185 25.82887433114967 25.993899084862733 85-89 22.845711427856966 25.621405351337835 25.886471617904476 25.646411602900727 90-94 22.954590918183637 25.33506701340268 26.130226045209042 25.580116023204642 95-99 23.541177058852945 24.98624931246562 25.91629581479074 25.556277813890695 100-104 23.745 25.47 25.840000000000003 24.945 105-109 23.32 25.674999999999997 25.869999999999997 25.135 110-114 23.26 25.515 25.795 25.430000000000003 115-119 23.345 25.374999999999996 25.685000000000002 25.595000000000002 120-124 23.815 25.474999999999998 25.3 25.41 125-129 23.345 25.69 25.924999999999997 25.040000000000003 130-134 23.61972394478896 25.845169033806766 25.160032006401277 25.375075015003002 135-139 23.875968992248062 25.111277819454862 25.0112528132033 26.001500375093773 140-144 23.48087021755439 25.311327831957993 25.74643660915229 25.461365341335334 145-149 22.887288728872885 25.112511251125113 25.91259125912591 26.087608760876087 150-151 23.910866299449175 24.361542313470206 25.43815723585378 26.289434151226843 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 2.0 28 2.5 29 5.0 30 8.5 31 11.5 32 14.5 33 21.0 34 30.5 35 46.5 36 58.0 37 69.5 38 84.5 39 97.0 40 121.0 41 141.0 42 170.0 43 187.5 44 184.5 45 198.5 46 219.0 47 213.0 48 191.5 49 191.5 50 182.5 51 153.0 52 143.0 53 135.5 54 125.0 55 113.0 56 98.0 57 84.0 58 73.0 59 80.5 60 77.0 61 60.5 62 55.5 63 54.0 64 53.0 65 47.0 66 36.5 67 32.0 68 26.5 69 20.5 70 21.0 71 22.0 72 14.5 73 8.5 74 6.0 75 3.0 76 1.0 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.0 6 0.675 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.015 85-89 0.025 90-94 0.02 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.025 140-144 0.025 145-149 0.01 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.6625 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.125 0.0 0.0 0.0 0.0 132-133 2.3375 0.0 0.0 0.0 0.0 134-135 2.5875000000000004 0.0 0.0 0.0 0.0 136-137 2.9000000000000004 0.0 0.0 0.0 0.0 138-139 3.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCATTC 10 0.006585701 146.75949 1 >>END_MODULE SRR8846522 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846522_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.786 33.0 33.0 34.0 32.0 34.0 2 32.6955 33.0 33.0 34.0 32.0 34.0 3 32.92575 34.0 33.0 34.0 32.0 34.0 4 32.9435 34.0 33.0 34.0 32.0 34.0 5 32.96975 34.0 33.0 34.0 32.0 34.0 6 37.23225 38.0 38.0 38.0 37.0 38.0 7 37.15525 38.0 38.0 38.0 37.0 38.0 8 37.2445 38.0 38.0 38.0 37.0 38.0 9 37.27675 38.0 38.0 38.0 37.0 38.0 10-14 37.229400000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.118700000000004 38.0 38.0 38.0 36.4 38.0 20-24 36.99285 38.0 38.0 38.0 36.0 38.0 25-29 36.88365 38.0 38.0 38.0 35.8 38.0 30-34 37.016600000000004 38.0 38.0 38.0 36.2 38.0 35-39 37.041399999999996 38.0 38.0 38.0 36.2 38.0 40-44 36.867399999999996 38.0 38.0 38.0 35.6 38.0 45-49 36.67790000000001 38.0 38.0 38.0 34.6 38.0 50-54 36.68945 38.0 38.0 38.0 35.0 38.0 55-59 36.7817 38.0 38.0 38.0 35.2 38.0 60-64 36.556650000000005 38.0 38.0 38.0 34.4 38.0 65-69 36.59805 38.0 38.0 38.0 34.4 38.0 70-74 36.77915 38.0 38.0 38.0 35.0 38.0 75-79 36.7858 38.0 38.0 38.0 35.0 38.0 80-84 36.707950000000004 38.0 38.0 38.0 34.6 38.0 85-89 36.524249999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.27735 38.0 37.8 38.0 33.8 38.0 95-99 36.069250000000004 38.0 37.2 38.0 33.2 38.0 100-104 36.12035 38.0 38.0 38.0 33.2 38.0 105-109 35.7846 38.0 37.0 38.0 31.8 38.0 110-114 35.48285 38.0 36.2 38.0 30.2 38.0 115-119 35.406150000000004 38.0 36.0 38.0 30.2 38.0 120-124 35.370799999999996 38.0 36.0 38.0 29.8 38.0 125-129 35.355599999999995 38.0 36.0 38.0 30.0 38.0 130-134 34.8547 38.0 35.0 38.0 27.8 38.0 135-139 34.4083 38.0 35.0 38.0 25.2 38.0 140-144 34.1616 38.0 34.6 38.0 24.4 38.0 145-149 33.513099999999994 38.0 33.0 38.0 23.0 38.0 150-151 29.151375 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 0.0 5 0.0 6 1.0 7 0.0 8 3.0 9 0.0 10 1.0 11 0.0 12 2.0 13 0.0 14 1.0 15 4.0 16 4.0 17 1.0 18 1.0 19 5.0 20 7.0 21 1.0 22 5.0 23 10.0 24 11.0 25 18.0 26 18.0 27 26.0 28 36.0 29 41.0 30 53.0 31 71.0 32 102.0 33 129.0 34 189.0 35 290.0 36 697.0 37 2266.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.7 13.125 12.125 37.05 2 27.825 17.95 34.0 20.225 3 22.650000000000002 22.5 28.475 26.375 4 26.025 31.15 18.975 23.849999999999998 5 25.85 33.575 21.075 19.5 6 21.2 36.15 21.099999999999998 21.55 7 21.65 16.025 37.5 24.825 8 21.075 21.025 24.275 33.625 9 22.975 21.575 27.55 27.900000000000002 10-14 25.722572257225725 24.66246624662466 22.782278227822783 26.832683268326836 15-19 25.081254062703135 25.221261063053152 24.88624431221561 24.8112405620281 20-24 25.915 24.990000000000002 24.975 24.12 25-29 25.45 25.06 24.775 24.715 30-34 25.5 24.98 24.65 24.87 35-39 25.014999999999997 25.130000000000003 25.165 24.69 40-44 25.924999999999997 25.345000000000002 24.085 24.645 45-49 25.746287314365716 25.36626831341567 24.616230811540575 24.271213560678035 50-54 25.53627681384069 25.226261313065653 24.8012400620031 24.436221811090554 55-59 25.74386157923689 25.66885032754913 24.978746812021804 23.60854128119218 60-64 25.432543254325434 25.18751875187519 25.397539753975394 23.982398239823983 65-69 25.25 25.22 25.130000000000003 24.4 70-74 25.919999999999998 25.0 24.959999999999997 24.12 75-79 25.064999999999998 25.855 24.85 24.23 80-84 25.83 25.34 24.695 24.135 85-89 25.415 25.119999999999997 25.415 24.05 90-94 25.722572257225725 25.292529252925295 25.232523252325233 23.75237523752375 95-99 25.870174034806958 25.45509101820364 25.09501900380076 23.579715943188635 100-104 25.86534613845538 25.770308123249297 24.814925970388156 23.54941976790716 105-109 26.023011505752873 25.097548774387196 25.62281140570285 23.25662831415708 110-114 26.310524209683873 25.625250100040013 24.759903961584634 23.304321728691477 115-119 25.967790337101132 25.91777533259978 25.152545763729115 22.96188856656997 120-124 26.048907336100413 25.198779816972543 24.893734060109015 23.858578786818022 125-129 25.417541754175417 26.237623762376238 24.58745874587459 23.757375737573756 130-134 26.07151787946987 25.771442860715176 24.491122780695175 23.66591647911978 135-139 26.21524304860972 25.875175035007004 25.145029005801163 22.76455291058212 140-144 26.418962844426662 25.948892333850075 24.868730309546432 22.763414512176826 145-149 26.21417496123643 25.734006902415846 25.15380383134097 22.898014305006754 150-151 26.641651031894938 25.61601000625391 26.19136960600375 21.550969355847403 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 2.5 29 5.5 30 6.0 31 7.0 32 13.5 33 22.0 34 26.5 35 27.0 36 39.5 37 58.5 38 71.5 39 92.0 40 110.5 41 125.0 42 145.0 43 167.0 44 179.0 45 190.0 46 196.5 47 192.5 48 198.5 49 200.0 50 170.0 51 148.0 52 135.5 53 124.5 54 119.0 55 102.5 56 101.5 57 99.5 58 99.5 59 92.0 60 77.0 61 71.0 62 74.5 63 68.0 64 57.5 65 61.0 66 51.0 67 45.0 68 44.0 69 44.5 70 41.0 71 30.5 72 22.5 73 14.0 74 9.0 75 10.0 76 7.0 77 1.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.005 55-59 0.015 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.02 100-104 0.04 105-109 0.05 110-114 0.04 115-119 0.03 120-124 0.015 125-129 0.01 130-134 0.025 135-139 0.02 140-144 0.015 145-149 0.034999999999999996 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21677614957048 98.175 2 0.631632137443153 1.25 3 0.07579585649317837 0.22499999999999998 4 0.05053057099545225 0.2 5 0.0 0.0 6 0.025265285497726126 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.8625 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.6624999999999996 0.0 0.0 0.0 0.0 136-137 2.95 0.0 0.0 0.0 0.0 138-139 3.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641988 spots for SRR8846522.sra Written 641988 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra Read 641976 spots for SRR8846522.sra Written 641976 spots for SRR8846522.sra SRR ids: ['SRR8846522.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a96qxfcn SRR8846522.sra spots: 12839532 blocks: [[1, 641976], [641977, 1283952], [1283953, 1925928], [1925929, 2567904], [2567905, 3209880], [3209881, 3851856], [3851857, 4493832], [4493833, 5135808], [5135809, 5777784], [5777785, 6419760], [6419761, 7061736], [7061737, 7703712], [7703713, 8345688], [8345689, 8987664], [8987665, 9629640], [9629641, 10271616], [10271617, 10913592], [10913593, 11555568], [11555569, 12197544], [12197545, 12839532]] SRR8846522 file size 4329195 SRR8846522 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846522 SRR8846522_1.fastq SRR8846522_2.fastq Input file: SRR8846522_1.fastq Paired file: SRR8846522_2.fastq trimmed: SRR8846522-trimmed-pair1.fastq, SRR8846522-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 06:22:39 2024 >> started Mon Dec 9 06:24:10 2024 >> done (90.806s) 12839532 read pairs processed; of these: 5685 ( 0.04%) short read pairs filtered out after trimming by size control 4309 ( 0.03%) empty read pairs filtered out after trimming by size control 12829538 (99.92%) read pairs available; of these: 5146293 (40.11%) trimmed read pairs available after processing 7683245 (59.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 4 0.00% 21 5 0.00% 22 9 0.00% 23 12 0.00% 24 9 0.00% 25 7 0.00% 26 7 0.00% 27 6 0.00% 28 9 0.00% 29 7 0.00% 30 6 0.00% 31 3 0.00% 32 4 0.00% 33 6 0.00% 34 9 0.00% 35 8 0.00% 36 7 0.00% 37 9 0.00% 38 9 0.00% 39 12 0.00% 40 6 0.00% 41 15 0.00% 42 10 0.00% 43 8 0.00% 44 13 0.00% 45 11 0.00% 46 16 0.00% 47 24 0.00% 48 13 0.00% 49 17 0.00% 50 23 0.00% 51 20 0.00% 52 25 0.00% 53 32 0.00% 54 30 0.00% 55 43 0.00% 56 35 0.00% 57 37 0.00% 58 38 0.00% 59 49 0.00% 60 51 0.00% 61 65 0.00% 62 50 0.00% 63 81 0.00% 64 76 0.00% 65 77 0.00% 66 87 0.00% 67 100 0.00% 68 119 0.00% 69 151 0.00% 70 140 0.00% 71 173 0.00% 72 203 0.00% 73 210 0.00% 74 274 0.00% 75 277 0.00% 76 325 0.00% 77 359 0.00% 78 377 0.00% 79 427 0.00% 80 470 0.00% 81 508 0.00% 82 656 0.01% 83 705 0.01% 84 1016 0.01% 85 1255 0.01% 86 1311 0.01% 87 1417 0.01% 88 1612 0.01% 89 1658 0.01% 90 1766 0.01% 91 1818 0.01% 92 2007 0.02% 93 2062 0.02% 94 2317 0.02% 95 2617 0.02% 96 2813 0.02% 97 3045 0.02% 98 3275 0.03% 99 3455 0.03% 100 3715 0.03% 101 4046 0.03% 102 4396 0.03% 103 4588 0.04% 104 4837 0.04% 105 5215 0.04% 106 5761 0.04% 107 6046 0.05% 108 6809 0.05% 109 7013 0.05% 110 7329 0.06% 111 7733 0.06% 112 8053 0.06% 113 8690 0.07% 114 9090 0.07% 115 9887 0.08% 116 10287 0.08% 117 10740 0.08% 118 11366 0.09% 119 12070 0.09% 120 12629 0.10% 121 13409 0.10% 122 13863 0.11% 123 14576 0.11% 124 15227 0.12% 125 15965 0.12% 126 16903 0.13% 127 17926 0.14% 128 18714 0.15% 129 20172 0.16% 130 21237 0.17% 131 22406 0.17% 132 24013 0.19% 133 25383 0.20% 134 27459 0.21% 135 29314 0.23% 136 31518 0.25% 137 33748 0.26% 138 37260 0.29% 139 40541 0.32% 140 44577 0.35% 141 49470 0.39% 142 56300 0.44% 143 64728 0.50% 144 75655 0.59% 145 98162 0.77% 146 132354 1.03% 147 193404 1.51% 148 269979 2.10% 149 598155 4.66% 150 2923547 22.79% 151 7683245 59.89% 12829538 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.77 prefix-fanout=2.0 sequence=GGGTACTCCTTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=37.01 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.1 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=17 prefix-density=0.78 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=634.03 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=19.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846522 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 06:29:12 Started mapping on | Dec 09 06:29:13 Finished on | Dec 09 06:41:07 Mapping speed, Million of reads per hour | 64.69 Number of input reads | 12829538 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12465151 Uniquely mapped reads % | 97.16% Average mapped length | 297.45 Number of splices: Total | 14434517 Number of splices: Annotated (sjdb) | 13636305 Number of splices: GT/AG | 14256589 Number of splices: GC/AG | 159651 Number of splices: AT/AC | 7394 Number of splices: Non-canonical | 10883 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 118211 % of reads mapped to multiple loci | 0.92% Number of reads mapped to too many loci | 7237 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 249774 249774 249774 N_multimapping 118211 118211 118211 N_noFeature 444603 12151736 539835 N_ambiguous 252116 1799 34448 UnstrandedReadsAssigned:11768432 PositiveStrandReadsAssigned:311616 NegativeStrandReadsAssigned:11890868 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR8846522 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846522-trimmed-pair1.fastq SRR8846522-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,829,538 reads, 11,945,666 reads pseudoaligned [quant] estimated average fragment length: 281.916 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR8846522.ke.tsv 35125 SRR8846522.se.tsv 88098 total ==> SRR8846522.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 655.759 9.68063 1.78213 PNS24247 1044 763.084 35.3302 5.58924 PNS24249 1928 1647.08 29.5418 2.16521 PNS24246 1044 763.084 35.3302 5.58924 PNS24248 1044 763.084 35.3302 5.58924 PNS24244 1471 1190.08 40.7869 4.13735 PNS24243 293 78.1685 0 0 KQK14069 1603 1322.08 263.266 24.0389 KQK14071 474 214.03 2.71128 1.52925 ==> SRR8846522.se.tsv <== BRADI_1g14170v3 291 BRADI_1g53295v3 16 BRADI_1g59795v3 198 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 1610 BRADI_1g74790v3 131 BRADI_1g09890v3 2 BRADI_1g77505v3 129 BRADI_1g48960v3 0 SRR8846522 completed mapping pipeline successfully