Starting /dee2/code/volunteer_pipeline.sh SRR8846527 current disk space = 1508875325440 free memory = 1391906004 SRR8846527 SRAfilesize 160f9744fdb5ae5bbf14b36c11ccbfc0 SRR8846527.sra SRR8846527.sra file validated SRR8846527 is single end SRR8846527 is conventional basespace SRR8846527 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846527_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 41 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4375 33.0 32.0 34.0 32.0 34.0 2 33.0045 33.0 33.0 34.0 32.0 34.0 3 33.07375 33.0 33.0 34.0 32.0 34.0 4 33.07425 33.0 33.0 34.0 32.0 34.0 5 32.92225 33.0 33.0 34.0 32.0 34.0 6 35.3035 37.0 34.0 37.0 33.0 37.0 7 35.32025 37.0 34.0 37.0 33.0 37.0 8 35.31175 37.0 34.0 37.0 33.0 37.0 9 35.33225 37.0 34.0 37.0 33.0 37.0 10 35.44075 37.0 34.0 37.0 33.0 37.0 11 35.5095 37.0 34.0 37.0 33.0 37.0 12 35.587 37.0 34.0 37.0 33.0 37.0 13 37.562 38.0 38.0 38.0 37.0 38.0 14 37.5385 38.0 38.0 38.0 37.0 38.0 15 37.6125 38.0 38.0 38.0 37.0 38.0 16 37.54275 38.0 38.0 38.0 37.0 38.0 17 37.478 38.0 38.0 38.0 37.0 38.0 18 37.51725 38.0 38.0 38.0 37.0 38.0 19 37.5325 38.0 38.0 38.0 37.0 38.0 20 37.4515 38.0 38.0 38.0 37.0 38.0 21 37.38 38.0 38.0 38.0 37.0 38.0 22 37.41 38.0 38.0 38.0 37.0 38.0 23 38.007 39.0 38.0 39.0 37.0 39.0 24 38.117 39.0 38.0 39.0 37.0 39.0 25 38.1465 39.0 38.0 39.0 37.0 39.0 26 38.08025 39.0 38.0 39.0 37.0 39.0 27 38.119 39.0 38.0 39.0 37.0 39.0 28 38.07425 39.0 38.0 39.0 37.0 39.0 29 38.07175 39.0 38.0 39.0 37.0 39.0 30 38.1115 39.0 38.0 39.0 37.0 39.0 31 38.10725 39.0 38.0 39.0 37.0 39.0 32 38.097 39.0 38.0 39.0 37.0 39.0 33 38.0285 39.0 38.0 39.0 37.0 39.0 34 37.9005 39.0 38.0 39.0 37.0 39.0 35 37.9505 39.0 38.0 39.0 37.0 39.0 36 37.992 39.0 38.0 39.0 37.0 39.0 37 38.00675 39.0 38.0 39.0 37.0 39.0 38 37.881 39.0 38.0 39.0 37.0 39.0 39 37.8905 39.0 38.0 39.0 37.0 39.0 40 37.89525 39.0 38.0 39.0 37.0 39.0 41 37.90425 39.0 38.0 39.0 37.0 39.0 42 37.714 39.0 38.0 39.0 37.0 39.0 43 37.85325 39.0 38.0 39.0 37.0 39.0 44 37.85925 39.0 38.0 39.0 37.0 39.0 45 37.77425 39.0 38.0 39.0 37.0 39.0 46 37.82425 39.0 38.0 39.0 37.0 39.0 47 37.743 39.0 38.0 39.0 37.0 39.0 48 37.697 39.0 38.0 39.0 37.0 39.0 49 37.77325 39.0 38.0 39.0 37.0 39.0 50 37.71575 39.0 38.0 39.0 37.0 39.0 51 37.43625 39.0 38.0 39.0 37.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 1.0 25 5.0 26 0.0 27 4.0 28 15.0 29 23.0 30 24.0 31 41.0 32 52.0 33 63.0 34 101.0 35 156.0 36 402.0 37 2975.0 38 134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.624999999999996 14.45 41.825 12.1 2 33.875 16.05 37.95 12.125 3 35.075 17.075000000000003 36.775000000000006 11.075 4 36.175000000000004 16.875 33.650000000000006 13.3 5 36.525 15.625 35.449999999999996 12.4 6 37.05 14.325 36.25 12.375 7 35.925000000000004 13.925 36.6 13.55 8 34.599999999999994 13.575000000000001 37.75 14.075 9 32.675 13.925 38.875 14.524999999999999 10 30.975 15.1 38.800000000000004 15.125 11 29.525000000000002 16.925 38.75 14.799999999999999 12 28.1 19.8 37.574999999999996 14.524999999999999 13 25.4 22.55 38.925 13.125 14 22.7 24.4 39.825 13.075000000000001 15 23.674999999999997 25.825 36.975 13.525 16 24.625 24.725 36.3 14.35 17 24.25 25.8 35.05 14.899999999999999 18 23.125 25.974999999999998 36.275 14.625 19 24.65 25.974999999999998 32.875 16.5 20 23.9 26.275 34.275 15.55 21 24.175 23.674999999999997 35.375 16.775000000000002 22 24.175 25.6 33.35 16.875 23 24.099999999999998 24.275 34.025 17.599999999999998 24 24.325 25.95 33.45 16.275000000000002 25 23.525 25.775 33.95 16.75 26 23.275000000000002 25.4 34.35 16.975 27 22.875 25.7 34.25 17.175 28 22.225 27.05 33.425 17.299999999999997 29 22.425 26.224999999999998 33.324999999999996 18.025 30 22.85 25.174999999999997 34.125 17.849999999999998 31 23.525 25.674999999999997 34.525 16.275000000000002 32 22.650000000000002 26.474999999999998 33.475 17.4 33 22.625 26.075 33.575 17.724999999999998 34 22.2 26.650000000000002 33.775 17.375 35 23.35 27.375 33.15 16.125 36 22.95 25.674999999999997 34.849999999999994 16.525000000000002 37 22.575 26.625 33.45 17.349999999999998 38 22.35 26.924999999999997 33.825 16.900000000000002 39 23.025000000000002 27.500000000000004 31.474999999999998 18.0 40 22.125 26.674999999999997 34.125 17.075000000000003 41 23.400000000000002 27.500000000000004 31.8 17.299999999999997 42 21.575 27.1 33.95 17.375 43 22.55 27.675 32.574999999999996 17.2 44 22.2 27.950000000000003 32.425 17.424999999999997 45 20.325 28.775000000000002 33.5 17.4 46 20.825 29.475 32.875 16.825000000000003 47 21.4 27.650000000000002 33.525 17.424999999999997 48 22.0 28.025 33.2 16.775000000000002 49 21.349999999999998 28.575 32.4 17.675 50 20.925 29.125 31.6 18.35 51 21.349999999999998 29.175 32.800000000000004 16.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 5.0 1 2.5 2 0.0 3 1.0 4 2.0 5 1.5 6 1.0 7 2.0 8 3.0 9 3.5 10 4.0 11 3.5 12 3.0 13 2.5 14 2.0 15 2.5 16 3.0 17 6.0 18 9.0 19 10.0 20 11.0 21 15.0 22 19.0 23 26.5 24 34.0 25 40.0 26 69.0 27 92.0 28 105.0 29 118.0 30 132.0 31 146.0 32 190.0 33 234.0 34 270.5 35 307.0 36 330.5 37 354.0 38 388.5 39 423.0 40 426.5 41 430.0 42 417.0 43 404.0 44 369.5 45 335.0 46 305.5 47 276.0 48 238.0 49 200.0 50 183.5 51 167.0 52 135.5 53 104.0 54 91.5 55 79.0 56 66.5 57 54.0 58 47.5 59 41.0 60 36.5 61 32.0 62 27.0 63 22.0 64 16.5 65 11.0 66 12.0 67 13.0 68 8.0 69 3.0 70 4.0 71 5.0 72 4.0 73 3.0 74 2.5 75 1.5 76 1.0 77 1.0 78 1.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21815889029004 98.35000000000001 2 0.7061790668348046 1.4000000000000001 3 0.05044136191677175 0.15 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.125 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.15 0.0 0.0 0.0 0.0 26 0.15 0.0 0.0 0.0 0.0 27 0.175 0.0 0.0 0.0 0.0 28 0.225 0.0 0.0 0.0 0.0 29 0.25 0.0 0.0 0.0 0.0 30 0.325 0.0 0.0 0.0 0.0 31 0.325 0.0 0.0 0.0 0.0 32 0.325 0.0 0.0 0.0 0.0 33 0.375 0.0 0.0 0.0 0.0 34 0.425 0.0 0.0 0.0 0.0 35 0.45 0.0 0.0 0.0 0.0 36 0.5 0.0 0.0 0.0 0.0 37 0.6 0.0 0.0 0.0 0.0 38 0.675 0.0 0.0 0.0 0.0 39 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra Rejected 159609 READS because READLEN < 1 Read 159609 spots for SRR8846527.sra Written 159609 spots for SRR8846527.sra Rejected 159608 READS because READLEN < 1 Read 159608 spots for SRR8846527.sra Written 159608 spots for SRR8846527.sra SRR ids: ['SRR8846527.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a6xhfx_v SRR8846527.sra spots: 3192161 blocks: [[1, 159608], [159609, 319216], [319217, 478824], [478825, 638432], [638433, 798040], [798041, 957648], [957649, 1117256], [1117257, 1276864], [1276865, 1436472], [1436473, 1596080], [1596081, 1755688], [1755689, 1915296], [1915297, 2074904], [2074905, 2234512], [2234513, 2394120], [2394121, 2553728], [2553729, 2713336], [2713337, 2872944], [2872945, 3032552], [3032553, 3192161]] SRR8846527 file size 446728 SRR8846527 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846527 SRR8846527_1.fastq Input file: SRR8846527_1.fastq trimmed: SRR8846527-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 06:59:42 2024 >> started Mon Dec 9 06:59:50 2024 >> done (7.228s) 3192161 reads processed; of these: 922 ( 0.03%) short reads filtered out after trimming by size control 88 ( 0.00%) empty reads filtered out after trimming by size control 3191151 (99.97%) reads available; of these: 49693 ( 1.56%) trimmed reads available after processing 3141458 (98.44%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 285 0.01% 19 498 0.02% 20 24 0.00% 21 37 0.00% 22 46 0.00% 23 57 0.00% 24 103 0.00% 25 101 0.00% 26 109 0.00% 27 135 0.00% 28 188 0.01% 29 271 0.01% 30 315 0.01% 31 380 0.01% 32 397 0.01% 33 415 0.01% 34 523 0.02% 35 591 0.02% 36 628 0.02% 37 771 0.02% 38 871 0.03% 39 1001 0.03% 40 1151 0.04% 41 1299 0.04% 42 1480 0.05% 43 1699 0.05% 44 1903 0.06% 45 2424 0.08% 46 2976 0.09% 47 3640 0.11% 48 4767 0.15% 49 7666 0.24% 50 12942 0.41% 51 3141458 98.44% 3191151 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=11.17 fanout-score-rank=19 prefix-density=0.21 prefix-fanout=10.8 sequence=TTGTTGTTGTGTATCGATGTGTGTTTGTTTGAATGTTCCTGTTTTCCGTTAAATTTGGCTCTCCTTTTTGAAGGAGACACGTCATGTGCTACACATCTCTTGATATTTATCTACCACATGTTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=108.80 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=4.5 sequence=TGTACTTGTACGCCGTAGATCAACTTGTACCTTTGTCTAGTTATGTGTTGATTTGTACCATGGTGGAGTGAACCCCGCGCAATGTAATTAAGCATGAGGTGCACGAGTGAATGAATGACGGAAGAATCGTGAATCGTGTG Started job on | Dec 09 07:01:06 Started mapping on | Dec 09 07:01:07 Finished on | Dec 09 07:01:49 Mapping speed, Million of reads per hour | 273.53 Number of input reads | 3191151 Average input read length | 46 UNIQUE READS: Uniquely mapped reads number | 2865537 Uniquely mapped reads % | 89.80% Average mapped length | 46.29 Number of splices: Total | 31932 Number of splices: Annotated (sjdb) | 21634 Number of splices: GT/AG | 26343 Number of splices: GC/AG | 697 Number of splices: AT/AC | 25 Number of splices: Non-canonical | 4867 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.00% Deletion average length | 1.29 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 189279 % of reads mapped to multiple loci | 5.93% Number of reads mapped to too many loci | 21931 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.54% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 136335 136335 136335 N_multimapping 189279 189279 189279 N_noFeature 152491 186820 2772971 N_ambiguous 62339 4189 172 UnstrandedReadsAssigned:2650707 PositiveStrandReadsAssigned:2674528 NegativeStrandReadsAssigned:92394 Dataset is classified positive stranded MeadianReadLen=47 20thPercentileLength=47 echo kmer=43 SRR8846527 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8846527-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,191,151 reads, 2,536,891 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 967 rounds 52973 SRR8846527.ke.tsv 35125 SRR8846527.se.tsv 88098 total ==> SRR8846527.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 58 21.2653 PNS24243 293 194 0 0 KQK14069 1603 1504 936.157 313.112 KQK14071 474 375 0 0 ==> SRR8846527.se.tsv <== BRADI_1g14170v3 949 BRADI_1g53295v3 11 BRADI_1g59795v3 15 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 129 BRADI_1g74790v3 7 BRADI_1g09890v3 0 BRADI_1g77505v3 45 BRADI_1g48960v3 0 SRR8846527 completed mapping pipeline successfully