Starting /dee2/code/volunteer_pipeline.sh SRR8846528 current disk space = 1509713133568 free memory = 1394819196 SRR8846528 SRAfilesize ff183ed5533799aaa19f74d27c80af5f SRR8846528.sra SRR8846528.sra file validated SRR8846528 is single end SRR8846528 is conventional basespace SRR8846528 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846528_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 41 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31875 33.0 32.0 33.0 32.0 34.0 2 32.53575 33.0 32.0 33.0 32.0 34.0 3 32.75925 33.0 32.0 34.0 32.0 34.0 4 32.70075 33.0 32.0 34.0 32.0 34.0 5 32.5755 33.0 32.0 34.0 32.0 34.0 6 35.005 37.0 33.0 37.0 32.0 37.0 7 34.7955 37.0 33.0 37.0 32.0 37.0 8 34.82925 37.0 33.0 37.0 32.0 37.0 9 35.02725 37.0 33.0 37.0 32.0 37.0 10 35.19075 37.0 33.0 37.0 32.0 37.0 11 35.19875 37.0 34.0 37.0 32.0 37.0 12 35.35525 37.0 34.0 37.0 33.0 37.0 13 37.16675 38.0 38.0 38.0 36.0 38.0 14 37.14825 38.0 38.0 38.0 36.0 38.0 15 37.1105 38.0 38.0 38.0 36.0 38.0 16 37.09075 38.0 38.0 38.0 36.0 38.0 17 37.017 38.0 38.0 38.0 36.0 38.0 18 37.185 38.0 38.0 38.0 37.0 38.0 19 37.12525 38.0 38.0 38.0 36.0 38.0 20 37.053 38.0 38.0 38.0 36.0 38.0 21 37.078 38.0 38.0 38.0 36.0 38.0 22 36.95475 38.0 38.0 38.0 36.0 38.0 23 37.64025 39.0 38.0 39.0 36.0 39.0 24 37.663 39.0 38.0 39.0 36.0 39.0 25 37.62825 39.0 38.0 39.0 36.0 39.0 26 37.505 39.0 38.0 39.0 36.0 39.0 27 37.6035 39.0 38.0 39.0 36.0 39.0 28 37.59325 39.0 38.0 39.0 36.0 39.0 29 37.6075 39.0 38.0 39.0 36.0 39.0 30 37.6845 39.0 38.0 39.0 36.0 39.0 31 37.53125 39.0 38.0 39.0 36.0 39.0 32 37.711 39.0 38.0 39.0 37.0 39.0 33 37.55325 39.0 38.0 39.0 36.0 39.0 34 37.53025 39.0 38.0 39.0 36.0 39.0 35 37.51475 39.0 38.0 39.0 36.0 39.0 36 37.614 39.0 38.0 39.0 36.0 39.0 37 37.52025 39.0 38.0 39.0 36.0 39.0 38 37.52625 39.0 38.0 39.0 36.0 39.0 39 37.429 39.0 38.0 39.0 36.0 39.0 40 37.4745 39.0 38.0 39.0 36.0 39.0 41 37.50525 39.0 38.0 39.0 36.0 39.0 42 37.477 39.0 38.0 39.0 36.0 39.0 43 37.53525 39.0 38.0 39.0 36.0 39.0 44 37.49675 39.0 38.0 39.0 36.0 39.0 45 37.517 39.0 38.0 39.0 36.0 39.0 46 37.4505 39.0 38.0 39.0 36.0 39.0 47 37.3585 39.0 38.0 39.0 36.0 39.0 48 37.5265 39.0 38.0 39.0 37.0 39.0 49 37.401 39.0 38.0 39.0 36.0 39.0 50 37.3595 39.0 38.0 39.0 36.0 39.0 51 36.91575 39.0 37.0 39.0 35.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 3.0 25 4.0 26 10.0 27 11.0 28 15.0 29 25.0 30 39.0 31 62.0 32 80.0 33 97.0 34 144.0 35 252.0 36 653.0 37 2564.0 38 35.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.1 14.774999999999999 39.85 13.275 2 32.925 16.325 36.925000000000004 13.825000000000001 3 36.4 17.05 34.1 12.45 4 35.75 15.174999999999999 35.925000000000004 13.15 5 36.5 15.475 35.55 12.475 6 36.325 14.299999999999999 36.175000000000004 13.200000000000001 7 34.725 13.750000000000002 37.35 14.174999999999999 8 32.425 13.750000000000002 38.574999999999996 15.25 9 32.550000000000004 12.5 38.725 16.225 10 29.4 14.75 39.900000000000006 15.950000000000001 11 27.450000000000003 16.325 39.2 17.025000000000002 12 28.9 19.175 35.875 16.05 13 24.175 21.475 38.800000000000004 15.55 14 24.2 23.25 38.35 14.2 15 23.400000000000002 22.75 38.0 15.85 16 23.150000000000002 23.1 36.199999999999996 17.549999999999997 17 23.825 23.9 35.85 16.425 18 24.474999999999998 23.95 35.25 16.325 19 25.35 23.05 34.2 17.4 20 22.5 24.525 36.0 16.975 21 23.775 22.85 35.699999999999996 17.675 22 23.599999999999998 23.775 34.699999999999996 17.925 23 22.650000000000002 25.2 34.825 17.325 24 23.7 24.525 34.275 17.5 25 22.8 24.075 35.3 17.825 26 23.775 24.575 34.5 17.150000000000002 27 24.45 24.2 33.074999999999996 18.275 28 23.0 25.1 34.25 17.65 29 22.05 26.35 34.025 17.575 30 23.325000000000003 25.924999999999997 33.425 17.325 31 23.599999999999998 26.325 33.025 17.05 32 23.25 26.35 33.125 17.275 33 23.575 25.5 33.300000000000004 17.625 34 22.55 26.75 32.675 18.025 35 22.650000000000002 25.724999999999998 34.449999999999996 17.175 36 21.575 26.825 34.475 17.125 37 22.725 26.375 33.525 17.375 38 22.575 25.650000000000002 34.300000000000004 17.474999999999998 39 21.95 26.424999999999997 33.95 17.675 40 21.6 27.375 32.625 18.4 41 22.025 27.700000000000003 33.425 16.85 42 21.175 26.724999999999998 34.300000000000004 17.8 43 22.400000000000002 27.200000000000003 32.7 17.7 44 21.224999999999998 25.924999999999997 34.975 17.875 45 21.9 27.05 33.050000000000004 18.0 46 21.875 27.85 32.574999999999996 17.7 47 20.875 28.525 33.375 17.224999999999998 48 21.375 28.025 33.825 16.775000000000002 49 21.2 29.925 31.775 17.1 50 21.2 28.575 32.300000000000004 17.925 51 22.025 29.125 31.525 17.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 1.0 3 1.5 4 2.0 5 1.0 6 0.0 7 2.0 8 4.0 9 4.0 10 4.0 11 4.5 12 5.0 13 2.5 14 0.0 15 1.0 16 2.0 17 6.5 18 11.0 19 10.0 20 9.0 21 14.0 22 19.0 23 27.0 24 35.0 25 39.5 26 59.0 27 74.0 28 90.0 29 106.0 30 140.0 31 174.0 32 196.0 33 218.0 34 257.0 35 296.0 36 326.5 37 357.0 38 380.0 39 403.0 40 398.0 41 393.0 42 385.5 43 378.0 44 335.0 45 292.0 46 281.5 47 271.0 48 261.0 49 251.0 50 207.5 51 164.0 52 160.0 53 156.0 54 122.0 55 88.0 56 80.0 57 72.0 58 64.5 59 57.0 60 49.0 61 41.0 62 33.0 63 25.0 64 21.5 65 18.0 66 13.5 67 9.0 68 8.0 69 7.0 70 4.0 71 1.0 72 1.5 73 2.0 74 3.5 75 3.5 76 2.0 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6300403225806451 1.25 3 0.05040322580645161 0.15 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.15 0.0 0.0 0.0 0.0 30 0.15 0.0 0.0 0.0 0.0 31 0.15 0.0 0.0 0.0 0.0 32 0.15 0.0 0.0 0.0 0.0 33 0.2 0.0 0.0 0.0 0.0 34 0.225 0.0 0.0 0.0 0.0 35 0.225 0.0 0.0 0.0 0.0 36 0.225 0.0 0.0 0.0 0.0 37 0.225 0.0 0.0 0.0 0.0 38 0.275 0.0 0.0 0.0 0.0 39 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319132 READS because READLEN < 1 Read 319132 spots for SRR8846528.sra Written 319132 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra Rejected 319119 READS because READLEN < 1 Read 319119 spots for SRR8846528.sra Written 319119 spots for SRR8846528.sra SRR ids: ['SRR8846528.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__mm9hggq SRR8846528.sra spots: 6382393 blocks: [[1, 319119], [319120, 638238], [638239, 957357], [957358, 1276476], [1276477, 1595595], [1595596, 1914714], [1914715, 2233833], [2233834, 2552952], [2552953, 2872071], [2872072, 3191190], [3191191, 3510309], [3510310, 3829428], [3829429, 4148547], [4148548, 4467666], [4467667, 4786785], [4786786, 5105904], [5105905, 5425023], [5425024, 5744142], [5744143, 6063261], [6063262, 6382393]] SRR8846528 file size 895354 SRR8846528 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846528 SRR8846528_1.fastq Input file: SRR8846528_1.fastq trimmed: SRR8846528-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 07:15:45 2024 >> started Mon Dec 9 07:15:59 2024 >> done (13.285s) 6382393 reads processed; of these: 1234 ( 0.02%) short reads filtered out after trimming by size control 250 ( 0.00%) empty reads filtered out after trimming by size control 6380909 (99.98%) reads available; of these: 110073 ( 1.73%) trimmed reads available after processing 6270836 (98.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 311 0.00% 19 548 0.01% 20 38 0.00% 21 46 0.00% 22 80 0.00% 23 128 0.00% 24 126 0.00% 25 167 0.00% 26 188 0.00% 27 258 0.00% 28 335 0.01% 29 418 0.01% 30 518 0.01% 31 617 0.01% 32 638 0.01% 33 751 0.01% 34 976 0.02% 35 1120 0.02% 36 1270 0.02% 37 1480 0.02% 38 1621 0.03% 39 1844 0.03% 40 2075 0.03% 41 2440 0.04% 42 3109 0.05% 43 3185 0.05% 44 3837 0.06% 45 4680 0.07% 46 5835 0.09% 47 7925 0.12% 48 10260 0.16% 49 17978 0.28% 50 35271 0.55% 51 6270836 98.27% 6380909 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=15.66 fanout-score-rank=15 prefix-density=0.36 prefix-fanout=11.4 sequence=GTGTGTGTGTGCGGGCTGGATGCCCTGTTCTACTACTATCGTTCGTGTTTCCAGATGTTTTACTCCGTGTGGAGCAGGGCTTGTACTACCTTTTGCTTGTATTCCGCTTAATGATCTATCACTCGTAATAATGGATGAATTCGCAGCTTTCCTTTCCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=98.47 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.1 sequence=GTATGTATGTTGTTATCGCTGCTGCATTGTTACTCTCTGGAGATTTGATGGATACAATAAAGGATGGTGCTTCTTGTAAATTGTACAA Started job on | Dec 09 07:16:55 Started mapping on | Dec 09 07:16:56 Finished on | Dec 09 07:17:50 Mapping speed, Million of reads per hour | 425.39 Number of input reads | 6380909 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 5786015 Uniquely mapped reads % | 90.68% Average mapped length | 49.23 Number of splices: Total | 69164 Number of splices: Annotated (sjdb) | 47485 Number of splices: GT/AG | 59785 Number of splices: GC/AG | 1692 Number of splices: AT/AC | 34 Number of splices: Non-canonical | 7653 Mismatch rate per base, % | 0.68% Deletion rate per base | 0.00% Deletion average length | 1.25 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391942 % of reads mapped to multiple loci | 6.14% Number of reads mapped to too many loci | 25828 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 202952 202952 202952 N_multimapping 391942 391942 391942 N_noFeature 305193 361909 5611145 N_ambiguous 127391 9388 480 UnstrandedReadsAssigned:5353431 PositiveStrandReadsAssigned:5414718 NegativeStrandReadsAssigned:174390 Dataset is classified positive stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR8846528 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8846528-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,380,909 reads, 5,215,068 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52973 SRR8846528.ke.tsv 35125 SRR8846528.se.tsv 88098 total ==> SRR8846528.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 103 18.5998 PNS24243 293 194 0 0 KQK14069 1603 1504 18736.6 3086.5 KQK14071 474 375 3.05976 2.02153 ==> SRR8846528.se.tsv <== BRADI_1g14170v3 18992 BRADI_1g53295v3 39 BRADI_1g59795v3 84 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 306 BRADI_1g74790v3 20 BRADI_1g09890v3 3 BRADI_1g77505v3 110 BRADI_1g48960v3 0 SRR8846528 completed mapping pipeline successfully