Starting /dee2/code/volunteer_pipeline.sh SRR8846529 current disk space = 1509738307584 free memory = 1380370868 SRR8846529 SRAfilesize 21dd8fbfdb77bb403c878303990a13e6 SRR8846529.sra SRR8846529.sra file validated SRR8846529 is single end SRR8846529 is conventional basespace SRR8846529 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846529_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 40 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.99975 35.0 35.0 35.0 32.0 35.0 2 34.48225 35.0 35.0 35.0 35.0 35.0 3 34.5705 35.0 35.0 35.0 35.0 35.0 4 34.63075 35.0 35.0 35.0 35.0 35.0 5 34.61375 35.0 35.0 35.0 35.0 35.0 6 39.3615 40.0 40.0 40.0 39.0 40.0 7 39.30675 40.0 40.0 40.0 39.0 40.0 8 39.28275 40.0 40.0 40.0 39.0 40.0 9 39.27125 40.0 40.0 40.0 39.0 40.0 10-14 39.346199999999996 40.0 40.0 40.0 39.0 40.0 15-19 39.262150000000005 40.0 40.0 40.0 38.8 40.0 20-24 38.9973 40.0 39.6 40.0 38.0 40.0 25-29 38.846900000000005 40.0 39.6 40.0 37.8 40.0 30-34 38.64615 40.0 40.0 40.0 37.6 40.0 35-39 38.4538 40.0 40.0 40.0 37.0 40.0 40-44 38.1999 40.0 39.4 40.0 36.2 40.0 45-49 37.981849999999994 40.0 39.0 40.0 35.8 40.0 50-54 37.9235 40.0 39.0 40.0 36.0 40.0 55-59 37.804899999999996 40.0 39.0 40.0 36.0 40.0 60-64 37.65235 40.0 39.0 40.0 35.4 40.0 65-69 37.59405 40.0 39.0 40.0 35.0 40.0 70-74 37.401300000000006 40.0 39.0 40.0 34.6 40.0 75-79 37.3849 40.0 39.0 40.0 34.2 40.0 80-84 37.450450000000004 40.0 39.0 40.0 34.8 40.0 85-89 37.3983 40.0 39.0 40.0 34.2 40.0 90-94 37.3633 40.0 39.0 40.0 34.0 40.0 95-99 37.145649999999996 40.0 39.0 40.0 34.0 40.0 100-104 34.7524 37.0 35.4 38.4 30.2 38.6 105-109 37.0446 39.8 39.0 40.0 34.0 40.0 110-114 37.175200000000004 40.0 39.0 40.0 34.2 40.0 115-119 36.943 40.0 39.0 40.0 32.8 40.0 120-124 36.78545 40.0 39.0 40.0 33.4 40.0 125-129 36.41505000000001 40.0 39.0 40.0 31.2 40.0 130-134 36.034299999999995 40.0 38.8 40.0 29.4 40.0 135-139 35.40675 39.8 38.2 40.0 20.0 40.0 140-144 34.64919999999999 39.2 37.6 40.0 10.8 40.0 145-149 33.65220000000001 39.0 36.4 40.0 2.0 40.0 150-151 26.322875 33.0 19.0 38.0 2.0 39.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 8.0 8 12.0 9 21.0 10 21.0 11 28.0 12 13.0 13 10.0 14 11.0 15 7.0 16 2.0 17 5.0 18 1.0 19 4.0 20 5.0 21 6.0 22 6.0 23 13.0 24 19.0 25 11.0 26 11.0 27 16.0 28 28.0 29 41.0 30 37.0 31 42.0 32 47.0 33 89.0 34 71.0 35 108.0 36 120.0 37 210.0 38 511.0 39 2464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.77358490566038 36.15094339622642 1.5345911949685536 22.540880503144653 2 19.075 36.825 25.5 18.6 3 17.0 35.099999999999994 28.65 19.25 4 15.725 37.75 27.975 18.55 5 15.625 39.574999999999996 25.724999999999998 19.075 6 15.25 42.8 24.8 17.150000000000002 7 12.825000000000001 46.875 25.074999999999996 15.225 8 12.950000000000001 43.824999999999996 26.525 16.7 9 13.575000000000001 42.675000000000004 26.700000000000003 17.05 10-14 15.58 33.98 31.175000000000004 19.265 15-19 14.24 30.25 36.254999999999995 19.255 20-24 12.695 29.895 39.335 18.075 25-29 14.275713785689284 32.8316415820791 34.81174058702935 18.08090404520226 30-34 15.803160632126426 35.39207841568314 29.285857171434287 19.51890378075615 35-39 16.62915728932233 35.99899974993748 27.421855463865967 19.94998749687422 40-44 18.23911955977989 35.09754877438719 26.59329664832416 20.070035017508754 45-49 18.056805680568054 35.003500350035004 25.03750375037504 21.902190219021904 50-54 17.52551530918551 35.526315789473685 25.720432259355615 21.22773664198519 55-59 16.710026015609365 36.34180508304983 25.270162097258353 21.67800680408245 60-64 17.280184055216566 35.03551065319596 24.08222466740022 23.602080624187256 65-69 18.480544163248975 35.12053616084825 23.08192457737321 23.31699509852956 70-74 18.260956573944366 35.22113267960776 23.133880328196916 23.38403041825095 75-79 17.983092391576207 35.831124005802614 22.440098044119853 23.745685558501325 80-84 17.858929464732366 36.32816408204102 21.885942971485743 23.92696348174087 85-89 17.83 35.545 21.915000000000003 24.709999999999997 90-94 18.47 36.01 21.075 24.445 95-99 18.08 35.38 21.22 25.319999999999997 100-104 18.735 36.0 21.105 24.16 105-109 19.345000000000002 35.205 20.24 25.21 110-114 18.62 35.665 20.4 25.314999999999998 115-119 19.145 34.785 20.36 25.71 120-124 19.525000000000002 34.21 20.5 25.765 125-129 19.650000000000002 32.615 21.385 26.35 130-134 19.744999999999997 33.22 20.855 26.179999999999996 135-139 19.61 32.655 21.025 26.71 140-144 19.005 33.25 21.17 26.575 145-149 19.665 32.019999999999996 21.32 26.995 150-151 15.262500000000001 34.9125 21.0375 28.787499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 1.0 7 2.0 8 3.5 9 4.0 10 4.0 11 4.5 12 4.0 13 5.5 14 6.5 15 6.0 16 8.5 17 6.0 18 4.5 19 5.0 20 4.0 21 5.0 22 4.0 23 6.5 24 7.0 25 6.5 26 18.0 27 34.0 28 41.0 29 40.5 30 49.0 31 73.0 32 107.5 33 136.5 34 180.0 35 196.0 36 215.0 37 270.0 38 297.5 39 309.5 40 293.0 41 255.0 42 246.0 43 240.0 44 207.0 45 179.5 46 148.0 47 109.5 48 85.5 49 66.0 50 43.0 51 25.5 52 13.5 53 7.5 54 4.0 55 3.0 56 3.5 57 2.0 58 0.5 59 0.5 60 0.5 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.02 35-39 0.025 40-44 0.05 45-49 0.01 50-54 0.06 55-59 0.06 60-64 0.03 65-69 0.03 70-74 0.06 75-79 0.045 80-84 0.05 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.87406296851574 76.6 2 5.067466266866567 8.450000000000001 3 1.2593703148425788 3.15 4 0.6596701649175413 2.1999999999999997 5 0.29985007496251875 1.25 6 0.14992503748125938 0.75 7 0.17991004497751123 1.05 8 0.08995502248875561 0.6 9 0.05997001499250374 0.44999999999999996 >10 0.35982008995502246 5.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GCGAACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGA 46 1.15 No Hit ATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTA 23 0.575 No Hit CTAAATATTCAGTTAAGACCATTCCAAGGCTCCTTTTCGCCATGCATAAA 22 0.5499999999999999 No Hit GTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGA 18 0.44999999999999996 No Hit AAGAAAGAAAGTGATTTTCTCAACTCTTTCAAACTTTTAGGAATTCACAT 18 0.44999999999999996 No Hit GTAAAATTAACTTCAACTATTTGTATTATATCAAAATACTTCGGAGTTGA 17 0.42500000000000004 No Hit CTTTATTCTGTCCCCTTATCTTTCATTCAGAAAAAGGAATGAATGGCTCG 16 0.4 No Hit GTATAATATTACATGTATATGTGTGTATATGTGTAGTCAGGGTTCAAATG 14 0.35000000000000003 No Hit CCATAATACCATCATTTTTAGCTGTGGAGTAGACAGTACAAGTTACCGAT 13 0.325 No Hit GCAGCAAATTTTCTCTTCCCGCTGATTTTCAATACCAAACGATAACAGAG 12 0.3 No Hit CAAACATGTGGTAGATAAATATCAAGAGATGTGTAGCACATGACGTGTCT 11 0.27499999999999997 No Hit ATTCTGTCCCCTTATCTTTCATTCAGAAAAAGGAATGAATGGCTCGGCTA 10 0.25 No Hit AGTTCCATAATACCATCATTTTTAGCTGTGGAGTAGACAGTACAAGTTAC 9 0.22499999999999998 No Hit AAACCGAACGAGCGGATTTTTTTACCTCGTCACAACAATTACAATGACAC 9 0.22499999999999998 No Hit GATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGAT 8 0.2 No Hit AGACAGACAAACAGAGCCTCTGCCTTTCTTATATACTGATGGTTGGTTCA 8 0.2 No Hit CCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGA 8 0.2 No Hit ATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTAC 7 0.17500000000000002 No Hit CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit GACAGCAAGTCGAAAGTTTCTCATAGCAGCAGCAGGATACATGGAAGGAA 7 0.17500000000000002 No Hit AGACAACCACATAACATGCATAATAACAAAGGTGCCAAGCAACCACAGGT 7 0.17500000000000002 No Hit GCTCATTCTTTTTTCATTCATTCATAGGGATAGCGAACGGAACAGAACAG 7 0.17500000000000002 No Hit AGGGAAAGGAAAGCTGCGAATTCATCCATTATTACGAGTGATAGATCATT 7 0.17500000000000002 No Hit ACAGTACTCTAGCTTAGCTAGCATCCCTTGATCAGTCGTAATCACATTAC 6 0.15 No Hit AGACTTAATTATAGGTGTATATTGCACATAACTTCAATTCGTGTACGTAC 6 0.15 No Hit AATATTACATGTATATGTGTGTATATGTGTAGTCAGGGTTCAAATGTACA 6 0.15 No Hit GCCGCTAAACCGAATATATTAATCAATCCACGTCGCAGAGACGTGGCACT 6 0.15 No Hit AGATAGTAAGACCACACGATAAATTTCATTCCATGCAAACACGTACGGAC 6 0.15 No Hit GATCTTAAACATGCTCTCCGGCTGTTATTATTGTCTTAACATAGGCAATT 5 0.125 No Hit CAGACTTAATTATAGGTGTATATTGCACATAACTTCAATTCGTGTACGTA 5 0.125 No Hit ACCGCTAAACCGAATATATTAATCAATCCACGTCGCAGAGACGTGGCACT 5 0.125 No Hit GCTATGGCTATTTCCATATCTTTTTTTTAAGTAATGAGCCTATCCTCTCT 5 0.125 No Hit GGCTCAACCATCAAATCCATTAATTTCAGTACGTACATAAATACTAGCAG 5 0.125 No Hit AACCGAACCGAAATAGGAATACAGTATTTAAACGACAGACATGAACATTG 5 0.125 No Hit ACGAACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGA 5 0.125 No Hit GGATCAACAACATTCAGACACATATATTAAAACGTACAGCCTTGATCGAG 5 0.125 No Hit ACAAGAAGCACCATCCTTTATTGTATCCATCAAATCTCCAGAGAGTAACA 5 0.125 No Hit ACATGCTTAACCAATGAGATTATTGCTCAACCACAGAGACCCACCATATA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.037500000000000006 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.0875 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.1875 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.2375 0.0 0.0 0.0 0.0 40-41 0.3 0.0 0.0 0.0 0.0 42-43 0.4 0.0 0.0 0.0 0.0 44-45 0.5875 0.0 0.0 0.0 0.0 46-47 0.7 0.0 0.0 0.0 0.0 48-49 0.775 0.0 0.0 0.0 0.0 50-51 0.85 0.0 0.0 0.0 0.0 52-53 0.9375 0.0 0.0 0.0 0.0 54-55 1.15 0.0 0.0 0.0 0.0 56-57 1.3625 0.0 0.0 0.0 0.0 58-59 1.575 0.0 0.0 0.0 0.0 60-61 1.75 0.0 0.0 0.0 0.0 62-63 2.075 0.0 0.0 0.0 0.0 64-65 2.5375 0.0 0.0 0.0 0.0 66-67 2.875 0.0 0.0 0.0 0.0 68-69 3.425 0.0 0.0 0.0 0.0 70-71 3.8125 0.0 0.0 0.0 0.0 72-73 4.4 0.0 0.0 0.0 0.0 74-75 5.0125 0.0 0.0 0.0 0.0 76-77 5.6625 0.0 0.0 0.0 0.0 78-79 6.15 0.0 0.0 0.0 0.0 80-81 6.7375 0.0 0.0 0.0 0.0 82-83 7.6875 0.0 0.0 0.0 0.0 84-85 8.575 0.0 0.0 0.0 0.0 86-87 9.462499999999999 0.0 0.0 0.0 0.0 88-89 10.2875 0.0 0.0 0.0 0.0 90-91 11.037500000000001 0.0 0.0 0.0 0.0 92-93 11.9875 0.0 0.0 0.0 0.0 94-95 13.325 0.0 0.0 0.0 0.0 96-97 14.725 0.0 0.0 0.0 0.0 98-99 15.9875 0.0 0.0 0.0 0.0 100-101 17.3875 0.0 0.0 0.0 0.0 102-103 18.9125 0.0 0.0 0.0 0.0 104-105 20.3875 0.0 0.0 0.0 0.0 106-107 21.6125 0.0 0.0 0.0 0.0 108-109 23.025 0.0 0.0 0.0 0.0 110-111 24.7375 0.0 0.0 0.0 0.0 112-113 26.4625 0.0 0.0 0.0 0.0 114-115 27.675 0.0 0.0 0.0 0.0 116-117 29.125 0.0 0.0 0.0 0.0 118-119 30.6 0.0 0.0 0.0 0.0 120-121 32.087500000000006 0.0 0.0 0.0 0.0 122-123 33.625 0.0 0.0 0.0 0.0 124-125 35.175 0.0 0.0 0.0 0.0 126-127 36.6375 0.0 0.0 0.0 0.0 128-129 38.125 0.0 0.0 0.0 0.0 130-131 39.724999999999994 0.0 0.0 0.0 0.0 132-133 40.9 0.0 0.0 0.0 0.0 134-135 42.1625 0.0 0.0 0.0 0.0 136-137 43.325 0.0 0.0 0.0 0.0 138-139 44.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 110 1.3008325E-4 11.863637 130-134 >>END_MODULE Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260794 READS because READLEN < 1 Read 1260794 spots for SRR8846529.sra Written 1260794 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra Rejected 1260777 READS because READLEN < 1 Read 1260777 spots for SRR8846529.sra Written 1260777 spots for SRR8846529.sra SRR ids: ['SRR8846529.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_avck2h2p SRR8846529.sra spots: 25215557 blocks: [[1, 1260777], [1260778, 2521554], [2521555, 3782331], [3782332, 5043108], [5043109, 6303885], [6303886, 7564662], [7564663, 8825439], [8825440, 10086216], [10086217, 11346993], [11346994, 12607770], [12607771, 13868547], [13868548, 15129324], [15129325, 16390101], [16390102, 17650878], [17650879, 18911655], [18911656, 20172432], [20172433, 21433209], [21433210, 22693986], [22693987, 23954763], [23954764, 25215557]] SRR8846529 file size 8523024 SRR8846529 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846529 SRR8846529_1.fastq Input file: SRR8846529_1.fastq trimmed: SRR8846529-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 07:33:37 2024 >> started Mon Dec 9 07:35:18 2024 >> done (100.046s) 25215557 reads processed; of these: 10430 ( 0.04%) short reads filtered out after trimming by size control 3382 ( 0.01%) empty reads filtered out after trimming by size control 25201745 (99.95%) reads available; of these: 15591521 (61.87%) trimmed reads available after processing 9610224 (38.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2478 0.01% 19 10706 0.04% 20 2620 0.01% 21 3300 0.01% 22 4676 0.02% 23 6250 0.02% 24 9006 0.04% 25 10950 0.04% 26 12518 0.05% 27 12781 0.05% 28 16135 0.06% 29 16938 0.07% 30 19998 0.08% 31 24503 0.10% 32 26462 0.11% 33 28108 0.11% 34 29821 0.12% 35 31730 0.13% 36 36479 0.14% 37 34707 0.14% 38 36502 0.14% 39 39268 0.16% 40 40003 0.16% 41 41981 0.17% 42 41920 0.17% 43 42241 0.17% 44 43516 0.17% 45 42655 0.17% 46 43345 0.17% 47 43591 0.17% 48 43365 0.17% 49 43564 0.17% 50 43769 0.17% 51 43459 0.17% 52 43976 0.17% 53 44305 0.18% 54 45045 0.18% 55 45765 0.18% 56 47035 0.19% 57 48963 0.19% 58 49625 0.20% 59 51544 0.20% 60 52286 0.21% 61 53327 0.21% 62 55194 0.22% 63 57380 0.23% 64 59294 0.24% 65 62686 0.25% 66 60860 0.24% 67 64092 0.25% 68 66522 0.26% 69 70458 0.28% 70 74622 0.30% 71 77889 0.31% 72 80529 0.32% 73 86660 0.34% 74 91952 0.36% 75 95167 0.38% 76 95921 0.38% 77 98726 0.39% 78 99044 0.39% 79 104672 0.42% 80 105400 0.42% 81 105859 0.42% 82 107384 0.43% 83 111520 0.44% 84 113973 0.45% 85 119726 0.48% 86 119829 0.48% 87 122589 0.49% 88 126555 0.50% 89 129178 0.51% 90 132178 0.52% 91 135172 0.54% 92 138626 0.55% 93 142124 0.56% 94 145949 0.58% 95 153496 0.61% 96 162261 0.64% 97 170138 0.68% 98 174753 0.69% 99 185270 0.74% 100 186739 0.74% 101 188597 0.75% 102 179934 0.71% 103 176855 0.70% 104 177829 0.71% 105 177704 0.71% 106 176081 0.70% 107 179917 0.71% 108 180040 0.71% 109 186632 0.74% 110 187933 0.75% 111 192691 0.76% 112 192166 0.76% 113 194137 0.77% 114 191677 0.76% 115 195278 0.77% 116 197850 0.79% 117 197554 0.78% 118 192503 0.76% 119 184128 0.73% 120 6187 0.02% 121 6548 0.03% 122 6877 0.03% 123 6881 0.03% 124 7136 0.03% 125 7524 0.03% 126 7985 0.03% 127 8935 0.04% 128 9135 0.04% 129 9519 0.04% 130 10078 0.04% 131 10901 0.04% 132 11372 0.05% 133 11795 0.05% 134 12712 0.05% 135 13634 0.05% 136 15132 0.06% 137 16222 0.06% 138 19846 0.08% 139 19889 0.08% 140 22213 0.09% 141 26268 0.10% 142 29334 0.12% 143 35160 0.14% 144 44290 0.18% 145 57842 0.23% 146 72860 0.29% 147 101123 0.40% 148 175687 0.70% 149 345671 1.37% 150 5211656 20.68% 151 9610224 38.13% 25201745 reads passed initial QC criterion=sequence-density sequence-density=11.60 sequence-density-rank=1 fanout-score=36.01 fanout-score-rank=5 prefix-density=12.90 prefix-fanout=32.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCACGATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=18 fanout-score=218.28 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=6.4 sequence=ACCAACAGAGAAATAGCCCTCATATCAGCTCCTAAGAAAGCTTAGACACCAACATGCACCAAGATAATTACGGAGTAGTCCATACAACGAGTTCCATAATACCATCATTTTTAGCTGTGGAGTAGACAGTACAAGTTACCGATACATATCAACAACGACGAGAAGATGATGACAATACACTGGCCGGCCTTGTTCCAAATTCCAAAGAAGGAAAAAAGGAAGACAAACACACAGTTGGCCACATG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCACGATCTCGTATGCCGTCTTCTGCTTGAAAA -o SRR8846529 - Input file: STDIN trimmed: SRR8846529-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCACGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Mon Dec 9 07:41:00 2024 >> started Mon Dec 9 07:43:15 2024 >> done (135.028s) 21001454 reads processed; of these: 152 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 21001302 (100.00%) reads available; of these: 4449387 (21.19%) trimmed reads available after processing 16551915 (78.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2107 0.01% 19 8931 0.04% 20 2181 0.01% 21 2755 0.01% 22 3870 0.02% 23 5157 0.02% 24 7572 0.04% 25 9167 0.04% 26 10466 0.05% 27 10657 0.05% 28 13593 0.06% 29 14109 0.07% 30 16788 0.08% 31 20512 0.10% 32 22181 0.11% 33 23459 0.11% 34 24931 0.12% 35 26568 0.13% 36 30380 0.14% 37 29045 0.14% 38 30497 0.15% 39 32734 0.16% 40 33485 0.16% 41 35189 0.17% 42 35065 0.17% 43 35221 0.17% 44 36321 0.17% 45 35881 0.17% 46 36442 0.17% 47 36355 0.17% 48 36374 0.17% 49 36454 0.17% 50 36642 0.17% 51 36213 0.17% 52 36846 0.18% 53 37231 0.18% 54 37805 0.18% 55 38291 0.18% 56 39390 0.19% 57 41540 0.20% 58 41798 0.20% 59 43256 0.21% 60 43570 0.21% 61 44665 0.21% 62 46399 0.22% 63 48151 0.23% 64 50056 0.24% 65 52620 0.25% 66 50894 0.24% 67 53794 0.26% 68 55984 0.27% 69 59225 0.28% 70 62574 0.30% 71 65381 0.31% 72 67903 0.32% 73 72660 0.35% 74 77231 0.37% 75 80191 0.38% 76 80782 0.38% 77 83162 0.40% 78 82931 0.39% 79 87738 0.42% 80 88464 0.42% 81 88690 0.42% 82 90475 0.43% 83 93641 0.45% 84 95829 0.46% 85 100834 0.48% 86 100477 0.48% 87 102675 0.49% 88 106165 0.51% 89 108583 0.52% 90 111288 0.53% 91 113950 0.54% 92 116715 0.56% 93 119894 0.57% 94 122431 0.58% 95 129437 0.62% 96 136281 0.65% 97 142523 0.68% 98 145890 0.69% 99 155183 0.74% 100 156858 0.75% 101 158196 0.75% 102 151392 0.72% 103 148970 0.71% 104 149942 0.71% 105 149109 0.71% 106 148484 0.71% 107 150628 0.72% 108 151130 0.72% 109 155521 0.74% 110 157222 0.75% 111 161502 0.77% 112 161914 0.77% 113 163234 0.78% 114 160813 0.77% 115 162859 0.78% 116 165183 0.79% 117 161388 0.77% 118 158414 0.75% 119 154501 0.74% 120 158379 0.75% 121 158907 0.76% 122 157351 0.75% 123 162639 0.77% 124 168185 0.80% 125 162559 0.77% 126 164013 0.78% 127 161299 0.77% 128 159398 0.76% 129 156207 0.74% 130 151096 0.72% 131 149415 0.71% 132 149642 0.71% 133 145263 0.69% 134 140502 0.67% 135 140537 0.67% 136 138887 0.66% 137 139892 0.67% 138 142905 0.68% 139 142276 0.68% 140 142882 0.68% 141 143099 0.68% 142 145871 0.69% 143 147319 0.70% 144 151674 0.72% 145 158871 0.76% 146 183102 0.87% 147 261375 1.24% 148 394160 1.88% 149 206726 0.98% 150 2871497 13.67% 151 5389319 25.66% criterion=sequence-density sequence-density=1.63 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=36 prefix-density=1.71 prefix-fanout=2.2 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.25 sequence-density-rank=10 fanout-score=64.56 fanout-score-rank=1 prefix-density=1.22 prefix-fanout=13.4 sequence=ACAACACAACAC Started job on | Dec 09 07:46:38 Started mapping on | Dec 09 07:46:39 Finished on | Dec 09 07:50:57 Mapping speed, Million of reads per hour | 351.65 Number of input reads | 25201593 Average input read length | 124 UNIQUE READS: Uniquely mapped reads number | 22901448 Uniquely mapped reads % | 90.87% Average mapped length | 126.16 Number of splices: Total | 145044 Number of splices: Annotated (sjdb) | 25774 Number of splices: GT/AG | 68533 Number of splices: GC/AG | 6836 Number of splices: AT/AC | 237 Number of splices: Non-canonical | 69438 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1506878 % of reads mapped to multiple loci | 5.98% Number of reads mapped to too many loci | 261702 % of reads mapped to too many loci | 1.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 793267 793267 793267 N_multimapping 1506878 1506878 1506878 N_noFeature 1098693 22068306 1341804 N_ambiguous 666531 1780 86164 UnstrandedReadsAssigned:21136224 PositiveStrandReadsAssigned:831362 NegativeStrandReadsAssigned:21473480 Dataset is classified negative stranded MeadianReadLen=137 20thPercentileLength=97 echo kmer=93 SRR8846529 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8846529-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,201,593 reads, 22,277,003 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR8846529.ke.tsv 35125 SRR8846529.se.tsv 88098 total ==> SRR8846529.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 662 28.9539 PNS24243 293 194 0 0 KQK14069 1603 1504 58966.8 2352.68 KQK14071 474 375 1.00048 0.160095 ==> SRR8846529.se.tsv <== BRADI_1g14170v3 58750 BRADI_1g53295v3 150 BRADI_1g59795v3 490 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 1195 BRADI_1g74790v3 142 BRADI_1g09890v3 28 BRADI_1g77505v3 477 BRADI_1g48960v3 0 SRR8846529 completed mapping pipeline successfully