Starting /dee2/code/volunteer_pipeline.sh SRR8846531 current disk space = 1509755518976 free memory = 1376431272 SRR8846531 SRAfilesize 469d4e5870040940ebb1c632e00386e7 SRR8846531.sra SRR8846531.sra file validated SRR8846531 is single end SRR8846531 is conventional basespace SRR8846531 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846531_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 40 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.12375 35.0 35.0 35.0 32.0 35.0 2 34.51875 35.0 35.0 35.0 35.0 35.0 3 34.63125 35.0 35.0 35.0 35.0 35.0 4 34.61875 35.0 35.0 35.0 35.0 35.0 5 34.62875 35.0 35.0 35.0 35.0 35.0 6 39.3685 40.0 40.0 40.0 39.0 40.0 7 39.30225 40.0 40.0 40.0 39.0 40.0 8 39.367 40.0 40.0 40.0 39.0 40.0 9 39.33025 40.0 40.0 40.0 39.0 40.0 10-14 39.373749999999994 40.0 40.0 40.0 39.0 40.0 15-19 39.22865 40.0 40.0 40.0 38.8 40.0 20-24 38.99855 40.0 39.8 40.0 38.0 40.0 25-29 38.8765 40.0 40.0 40.0 38.0 40.0 30-34 38.6926 40.0 40.0 40.0 37.8 40.0 35-39 38.44115 40.0 40.0 40.0 37.0 40.0 40-44 38.241249999999994 40.0 39.8 40.0 36.6 40.0 45-49 38.07555 40.0 39.0 40.0 36.0 40.0 50-54 37.959050000000005 40.0 39.0 40.0 36.0 40.0 55-59 37.78805 40.0 39.0 40.0 36.0 40.0 60-64 37.67515 40.0 39.0 40.0 35.2 40.0 65-69 37.6138 40.0 39.0 40.0 35.0 40.0 70-74 37.419200000000004 40.0 39.0 40.0 34.4 40.0 75-79 37.482150000000004 40.0 39.0 40.0 34.6 40.0 80-84 37.42335 40.0 39.0 40.0 34.2 40.0 85-89 37.46435 40.0 39.0 40.0 35.0 40.0 90-94 37.4214 40.0 39.0 40.0 34.8 40.0 95-99 37.177550000000004 40.0 39.0 40.0 34.0 40.0 100-104 34.81035 37.0 35.4 38.4 30.0 38.6 105-109 37.092200000000005 39.8 39.0 40.0 34.0 40.0 110-114 37.1611 40.0 39.0 40.0 34.0 40.0 115-119 36.87995 40.0 39.0 40.0 32.8 40.0 120-124 36.75025 40.0 39.0 40.0 34.0 40.0 125-129 36.43815 40.0 39.0 40.0 31.4 40.0 130-134 35.93705 40.0 38.4 40.0 28.2 40.0 135-139 35.32965 39.8 38.0 40.0 20.0 40.0 140-144 34.6237 39.0 37.8 40.0 8.6 40.0 145-149 33.62115 39.0 36.4 40.0 2.0 40.0 150-151 26.3975 33.5 19.0 38.0 2.0 39.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 6.0 7 4.0 8 12.0 9 16.0 10 21.0 11 23.0 12 16.0 13 20.0 14 12.0 15 7.0 16 3.0 17 2.0 18 2.0 19 3.0 20 4.0 21 8.0 22 7.0 23 16.0 24 12.0 25 10.0 26 9.0 27 28.0 28 21.0 29 33.0 30 36.0 31 26.0 32 61.0 33 74.0 34 78.0 35 110.0 36 137.0 37 220.0 38 503.0 39 2459.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.43344196540487 36.87641012785159 1.2785159187766357 22.41163198796691 2 19.375 37.625 24.825 18.175 3 16.400000000000002 35.425000000000004 29.625 18.55 4 16.825000000000003 37.1 27.1 18.975 5 15.049999999999999 40.8 24.55 19.6 6 14.825 43.525000000000006 24.2 17.45 7 13.25 47.075 24.099999999999998 15.575 8 13.775 45.1 24.0 17.125 9 13.350000000000001 42.55 26.700000000000003 17.4 10-14 15.75 35.144999999999996 29.825000000000003 19.28 15-19 13.61 31.15 36.155 19.085 20-24 13.175658782939148 30.14150707535377 38.3719185959298 18.31091554577729 25-29 14.417883576715344 33.34166833366673 33.896779355871175 18.34366873374675 30-34 15.808952238059515 35.23380845211303 29.877469367341835 19.079769942485623 35-39 16.740881573022463 35.608145294441385 27.527893130534846 20.123080002001302 40-44 18.148611458593948 35.97197898423818 25.98949211908932 19.88991743807856 45-49 18.184546136534134 35.8589647411853 24.676169042260565 21.280320080020005 50-54 17.696811971372803 35.33857164306091 25.11886291977379 21.8457534657925 55-59 17.456583754566836 37.92102497372504 23.106951604023823 21.515439667684298 60-64 17.700620372223334 36.11166700020012 23.238943366019612 22.948769261556933 65-69 18.331915745234404 35.663181067694 22.57467353779957 23.43022964927203 70-74 17.85875168927374 36.122929075529306 22.63376545372641 23.384553781470544 75-79 17.958468851638727 35.491618714035525 23.002251688766577 23.547660745559167 80-84 17.984387510008006 36.25900720576461 22.222778222578064 23.53382706164932 85-89 18.52 35.595 21.5 24.385 90-94 18.156815681568155 36.04860486048605 21.147114711471147 24.647464746474647 95-99 18.265 35.31 21.495 24.93 100-104 17.775 36.004999999999995 20.8 25.419999999999998 105-109 18.6 35.825 20.415 25.16 110-114 18.25 35.525 20.990000000000002 25.235000000000003 115-119 18.77 35.275 20.57 25.385 120-124 18.505 35.38 21.025 25.09 125-129 18.735 34.105000000000004 21.29 25.869999999999997 130-134 18.315 33.825 22.31 25.55 135-139 18.13 34.325 21.785 25.759999999999998 140-144 17.044999999999998 35.075 21.97 25.91 145-149 17.005 35.06 21.92 26.015 150-151 13.725000000000001 37.55 21.9625 26.7625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 2.0 5 2.5 6 2.0 7 2.5 8 1.5 9 1.5 10 4.0 11 4.5 12 6.0 13 6.5 14 2.5 15 3.5 16 6.5 17 6.5 18 6.5 19 6.0 20 5.5 21 6.5 22 9.0 23 11.0 24 10.0 25 9.0 26 11.0 27 26.0 28 39.5 29 36.0 30 48.5 31 72.0 32 92.5 33 119.0 34 156.0 35 195.5 36 228.0 37 266.5 38 291.0 39 312.0 40 314.0 41 305.0 42 287.0 43 255.0 44 208.5 45 163.5 46 131.5 47 101.5 48 79.5 49 53.0 50 37.0 51 25.5 52 14.0 53 4.5 54 4.5 55 2.5 56 1.0 57 1.0 58 0.5 59 1.0 60 0.5 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.02 30-34 0.025 35-39 0.065 40-44 0.075 45-49 0.025 50-54 0.095 55-59 0.095 60-64 0.06 65-69 0.065 70-74 0.105 75-79 0.075 80-84 0.08 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.575 #Duplication Level Percentage of deduplicated Percentage of total 1 91.59437630870477 76.55 2 5.474125037391564 9.15 3 1.5255758300927311 3.8249999999999997 4 0.4187855219862399 1.4000000000000001 5 0.14956625785222855 0.625 6 0.14956625785222855 0.75 7 0.029913251570445706 0.17500000000000002 8 0.05982650314089141 0.4 9 0.11965300628178283 0.8999999999999999 >10 0.4786120251271313 6.225 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCGAACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGA 37 0.9249999999999999 No Hit GTAAAATTAACTTCAACTATTTGTATTATATCAAAATACTTCGGAGTTGA 25 0.625 No Hit CTTTATTCTGTCCCCTTATCTTTCATTCAGAAAAAGGAATGAATGGCTCG 19 0.475 No Hit AAGAAAGAAAGTGATTTTCTCAACTCTTTCAAACTTTTAGGAATTCACAT 18 0.44999999999999996 No Hit GTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGA 16 0.4 No Hit GTATAATATTACATGTATATGTGTGTATATGTGTAGTCAGGGTTCAAATG 15 0.375 No Hit CAAACATGTGGTAGATAAATATCAAGAGATGTGTAGCACATGACGTGTCT 15 0.375 No Hit CCATAATACCATCATTTTTAGCTGTGGAGTAGACAGTACAAGTTACCGAT 14 0.35000000000000003 No Hit CTAAATATTCAGTTAAGACCATTCCAAGGCTCCTTTTCGCCATGCATAAA 13 0.325 No Hit GCAGCAAATTTTCTCTTCCCGCTGATTTTCAATACCAAACGATAACAGAG 12 0.3 No Hit AGCACACAATTGGATGATTTATTATACAGACTGTATGTAGGAGTAAGTAC 12 0.3 No Hit ATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTAC 11 0.27499999999999997 No Hit ATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTA 11 0.27499999999999997 No Hit GCTCATTCTTTTTTCATTCATTCATAGGGATAGCGAACGGAACAGAACAG 11 0.27499999999999997 No Hit CTCAACTCTTTCAAACTTTTAGGAATTCACATATGCAAGCTAGCTCCTCG 10 0.25 No Hit AGGGAAAGGAAAGCTGCGAATTCATCCATTATTACGAGTGATAGATCATT 10 0.25 No Hit GATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGAT 9 0.22499999999999998 No Hit CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 9 0.22499999999999998 No Hit CACATAAACACTTGATATGTTTTTTCTTCTTGCGCTAATTAAAACCAGAC 9 0.22499999999999998 No Hit AGATAGTAAGACCACACGATAAATTTCATTCCATGCAAACACGTACGGAC 9 0.22499999999999998 No Hit AATATTACATGTATATGTGTGTATATGTGTAGTCAGGGTTCAAATGTACA 8 0.2 No Hit AAACAACTAAATAACCTTTTTATTCGCTCCTCTAGTCCCAGAAGGATCCA 8 0.2 No Hit ATATGTTAGCGGAAAAACCTTATCCATTAATAGCGGGAACTTCAAGAGCA 7 0.17500000000000002 No Hit GATCTTAAACATGCTCTCCGGCTGTTATTATTGTCTTAACATAGGCAATT 6 0.15 No Hit AGACAACCACATAACATGCATAATAACAAAGGTGCCAAGCAACCACAGGT 6 0.15 No Hit CATCCTACCATTCCATTAGGGAATATCTTTTTGAAGATTAAGAAAGATCC 6 0.15 No Hit CAAAAATTCTTATATGTTAGCGGAAAAACCTTATCCATTAATAGCGGGAA 6 0.15 No Hit ATTCTGTCCCCTTATCTTTCATTCAGAAAAAGGAATGAATGGCTCGGCTA 6 0.15 No Hit GAAAGAACAAAGCAAGATACGATCCAAATTAATTGCCACCACACAACAGA 5 0.125 No Hit AGTTTTGATACAGATTATATTGATGCATTCAAAACAGTAGCCGCTACTTA 5 0.125 No Hit AACAAAGCAAGATACGATCCAAATTAATTGCCACCACACAACAGACGTGC 5 0.125 No Hit GGAAATAAGGATTATCATAAAATGATAGGACAAGAATATCTTCGCAAAGA 5 0.125 No Hit GATAGTAAGACCACACGATAAATTTCATTCCATGCAAACACGTACGGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.037500000000000006 0.0 0.0 0.0 0.0 26-27 0.0625 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.0875 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.35 0.0 0.0 0.0 0.0 42-43 0.4625 0.0 0.0 0.0 0.0 44-45 0.625 0.0 0.0 0.0 0.0 46-47 0.7375 0.0 0.0 0.0 0.0 48-49 0.8625 0.0 0.0 0.0 0.0 50-51 0.95 0.0 0.0 0.0 0.0 52-53 1.1375000000000002 0.0 0.0 0.0 0.0 54-55 1.3625 0.0 0.0 0.0 0.0 56-57 1.5875 0.0 0.0 0.0 0.0 58-59 2.0125 0.0 0.0 0.0 0.0 60-61 2.35 0.0 0.0 0.0 0.0 62-63 2.8499999999999996 0.0 0.0 0.0 0.0 64-65 3.3125 0.0 0.0 0.0 0.0 66-67 3.7125 0.0 0.0 0.0 0.0 68-69 4.1125 0.0 0.0 0.0 0.0 70-71 4.65 0.0 0.0 0.0 0.0 72-73 5.2125 0.0 0.0 0.0 0.0 74-75 6.012499999999999 0.0 0.0 0.0 0.0 76-77 6.7375 0.0 0.0 0.0 0.0 78-79 7.525 0.0 0.0 0.0 0.0 80-81 8.4625 0.0 0.0 0.0 0.0 82-83 9.25 0.0 0.0 0.0 0.0 84-85 9.975000000000001 0.0 0.0 0.0 0.0 86-87 11.225 0.0 0.0 0.0 0.0 88-89 12.350000000000001 0.0 0.0 0.0 0.0 90-91 13.2 0.0 0.0 0.0 0.0 92-93 14.325 0.0 0.0 0.0 0.0 94-95 15.325 0.0 0.0 0.0 0.0 96-97 16.487499999999997 0.0 0.0 0.0 0.0 98-99 17.8875 0.0 0.0 0.0 0.0 100-101 19.075000000000003 0.0 0.0 0.0 0.0 102-103 20.625 0.0 0.0 0.0 0.0 104-105 22.0625 0.0 0.0 0.0 0.0 106-107 23.5375 0.0 0.0 0.0 0.0 108-109 25.1125 0.0 0.0 0.0 0.0 110-111 26.575 0.0 0.0 0.0 0.0 112-113 28.174999999999997 0.0 0.0 0.0 0.0 114-115 29.7125 0.0 0.0 0.0 0.0 116-117 31.15 0.0 0.0 0.0 0.0 118-119 32.6125 0.0 0.0 0.0 0.0 120-121 34.087500000000006 0.0 0.0 0.0 0.0 122-123 35.65 0.0 0.0 0.0 0.0 124-125 37.1375 0.0 0.0 0.0 0.0 126-127 38.7 0.0 0.0 0.0 0.0 128-129 39.9625 0.0 0.0 0.0 0.0 130-131 41.325 0.0 0.0 0.0 0.0 132-133 42.2375 0.0 0.0 0.0 0.0 134-135 43.162499999999994 0.0 0.0 0.0 0.0 136-137 44.349999999999994 0.0 0.0 0.0 0.0 138-139 45.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTCC 10 0.006830828 145.0 1 AATATAA 10 0.006830828 145.0 9 CTTTTTT 65 1.0757503E-7 66.92307 1 AAAAAAA 275 2.5690331E-5 7.381818 135-139 >>END_MODULE Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446049 READS because READLEN < 1 Read 1446049 spots for SRR8846531.sra Written 1446049 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra Rejected 1446031 READS because READLEN < 1 Read 1446031 spots for SRR8846531.sra Written 1446031 spots for SRR8846531.sra SRR ids: ['SRR8846531.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9rrv33gw SRR8846531.sra spots: 28920638 blocks: [[1, 1446031], [1446032, 2892062], [2892063, 4338093], [4338094, 5784124], [5784125, 7230155], [7230156, 8676186], [8676187, 10122217], [10122218, 11568248], [11568249, 13014279], [13014280, 14460310], [14460311, 15906341], [15906342, 17352372], [17352373, 18798403], [18798404, 20244434], [20244435, 21690465], [21690466, 23136496], [23136497, 24582527], [24582528, 26028558], [26028559, 27474589], [27474590, 28920638]] SRR8846531 file size 9778554 SRR8846531 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846531 SRR8846531_1.fastq Input file: SRR8846531_1.fastq trimmed: SRR8846531-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 07:39:35 2024 >> started Mon Dec 9 07:41:00 2024 >> done (84.788s) 28920638 reads processed; of these: 18677 ( 0.06%) short reads filtered out after trimming by size control 3936 ( 0.01%) empty reads filtered out after trimming by size control 28898025 (99.92%) reads available; of these: 18807192 (65.08%) trimmed reads available after processing 10090833 (34.92%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4179 0.01% 19 14623 0.05% 20 4426 0.02% 21 5022 0.02% 22 6882 0.02% 23 8695 0.03% 24 11616 0.04% 25 14242 0.05% 26 16330 0.06% 27 16702 0.06% 28 20700 0.07% 29 21858 0.08% 30 25800 0.09% 31 31784 0.11% 32 33816 0.12% 33 36818 0.13% 34 39314 0.14% 35 41865 0.14% 36 48447 0.17% 37 47277 0.16% 38 50090 0.17% 39 53743 0.19% 40 55422 0.19% 41 58911 0.20% 42 59783 0.21% 43 61098 0.21% 44 63615 0.22% 45 62757 0.22% 46 63955 0.22% 47 64396 0.22% 48 64726 0.22% 49 64582 0.22% 50 64976 0.22% 51 65376 0.23% 52 67059 0.23% 53 67196 0.23% 54 68369 0.24% 55 69564 0.24% 56 71195 0.25% 57 76055 0.26% 58 75959 0.26% 59 77346 0.27% 60 79033 0.27% 61 80701 0.28% 62 84327 0.29% 63 87029 0.30% 64 89512 0.31% 65 93148 0.32% 66 92085 0.32% 67 95699 0.33% 68 99298 0.34% 69 104223 0.36% 70 109830 0.38% 71 114354 0.40% 72 118142 0.41% 73 125545 0.43% 74 132893 0.46% 75 138813 0.48% 76 137794 0.48% 77 141293 0.49% 78 141805 0.49% 79 149037 0.52% 80 148596 0.51% 81 148760 0.51% 82 150195 0.52% 83 154628 0.54% 84 157826 0.55% 85 163773 0.57% 86 163443 0.57% 87 165848 0.57% 88 170629 0.59% 89 173383 0.60% 90 175868 0.61% 91 179899 0.62% 92 182829 0.63% 93 186721 0.65% 94 190041 0.66% 95 198120 0.69% 96 206566 0.71% 97 213600 0.74% 98 217570 0.75% 99 226228 0.78% 100 229011 0.79% 101 232165 0.80% 102 220447 0.76% 103 216645 0.75% 104 218586 0.76% 105 217808 0.75% 106 215574 0.75% 107 218376 0.76% 108 216059 0.75% 109 223555 0.77% 110 222257 0.77% 111 228253 0.79% 112 225106 0.78% 113 228337 0.79% 114 221892 0.77% 115 226758 0.78% 116 229729 0.79% 117 229279 0.79% 118 221327 0.77% 119 212321 0.73% 120 6746 0.02% 121 7002 0.02% 122 7302 0.03% 123 7356 0.03% 124 7792 0.03% 125 8141 0.03% 126 8750 0.03% 127 9395 0.03% 128 9787 0.03% 129 10199 0.04% 130 10751 0.04% 131 11517 0.04% 132 12171 0.04% 133 12603 0.04% 134 13355 0.05% 135 14271 0.05% 136 16083 0.06% 137 17334 0.06% 138 21106 0.07% 139 21110 0.07% 140 23743 0.08% 141 27998 0.10% 142 30603 0.11% 143 36874 0.13% 144 46085 0.16% 145 61114 0.21% 146 76528 0.26% 147 104925 0.36% 148 182459 0.63% 149 361180 1.25% 150 5503774 19.05% 151 10090833 34.92% 28898025 reads passed initial QC criterion=sequence-density sequence-density=11.44 sequence-density-rank=1 fanout-score=34.56 fanout-score-rank=4 prefix-density=12.66 prefix-fanout=31.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACATTAATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=10 fanout-score=60.13 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=7.9 sequence=AACACAAATACAGAGTCTTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACATTAATCTCGTATGCCGTCTTCTGCTTGAAAA -o SRR8846531 - Input file: STDIN trimmed: SRR8846531-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACATTAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Mon Dec 9 07:44:35 2024 >> started Mon Dec 9 07:46:59 2024 >> done (143.911s) 24081688 reads processed; of these: 318 ( 0.00%) short reads filtered out after trimming by size control 4 ( 0.00%) empty reads filtered out after trimming by size control 24081366 (100.00%) reads available; of these: 5008346 (20.80%) trimmed reads available after processing 19073020 (79.20%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3486 0.01% 19 12168 0.05% 20 3732 0.02% 21 4161 0.02% 22 5730 0.02% 23 7277 0.03% 24 9730 0.04% 25 11932 0.05% 26 13676 0.06% 27 14003 0.06% 28 17336 0.07% 29 18286 0.08% 30 21592 0.09% 31 26553 0.11% 32 28267 0.12% 33 30759 0.13% 34 32728 0.14% 35 34908 0.14% 36 40531 0.17% 37 39344 0.16% 38 41810 0.17% 39 45024 0.19% 40 46506 0.19% 41 49139 0.20% 42 49801 0.21% 43 50991 0.21% 44 53298 0.22% 45 52495 0.22% 46 53731 0.22% 47 53648 0.22% 48 53976 0.22% 49 54078 0.22% 50 54226 0.23% 51 55000 0.23% 52 56394 0.23% 53 56457 0.23% 54 57290 0.24% 55 58287 0.24% 56 59589 0.25% 57 64440 0.27% 58 63938 0.27% 59 65325 0.27% 60 66237 0.28% 61 67322 0.28% 62 70479 0.29% 63 72752 0.30% 64 75464 0.31% 65 77997 0.32% 66 77281 0.32% 67 80237 0.33% 68 83093 0.35% 69 87669 0.36% 70 92086 0.38% 71 96030 0.40% 72 99026 0.41% 73 105688 0.44% 74 111397 0.46% 75 116546 0.48% 76 115683 0.48% 77 118603 0.49% 78 118969 0.49% 79 125058 0.52% 80 124687 0.52% 81 124591 0.52% 82 126216 0.52% 83 130117 0.54% 84 132533 0.55% 85 137727 0.57% 86 136999 0.57% 87 139023 0.58% 88 142518 0.59% 89 145412 0.60% 90 147390 0.61% 91 151066 0.63% 92 153726 0.64% 93 157364 0.65% 94 159437 0.66% 95 166403 0.69% 96 173013 0.72% 97 178558 0.74% 98 181496 0.75% 99 189570 0.79% 100 192094 0.80% 101 194679 0.81% 102 185414 0.77% 103 182067 0.76% 104 184194 0.76% 105 182677 0.76% 106 182158 0.76% 107 182380 0.76% 108 181089 0.75% 109 186389 0.77% 110 185104 0.77% 111 190783 0.79% 112 189158 0.79% 113 191249 0.79% 114 185704 0.77% 115 188732 0.78% 116 191239 0.79% 117 187010 0.78% 118 182597 0.76% 119 178381 0.74% 120 183847 0.76% 121 187109 0.78% 122 185692 0.77% 123 192056 0.80% 124 202133 0.84% 125 193896 0.81% 126 192756 0.80% 127 186395 0.77% 128 182991 0.76% 129 177362 0.74% 130 169368 0.70% 131 165675 0.69% 132 164667 0.68% 133 160477 0.67% 134 154027 0.64% 135 153227 0.64% 136 151866 0.63% 137 152933 0.64% 138 153928 0.64% 139 152977 0.64% 140 153752 0.64% 141 154282 0.64% 142 156277 0.65% 143 158502 0.66% 144 161562 0.67% 145 169836 0.71% 146 195523 0.81% 147 276717 1.15% 148 412584 1.71% 149 209889 0.87% 150 2911144 12.09% 151 5507713 22.87% criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=38 prefix-density=1.17 prefix-fanout=2.3 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=99.74 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.0 sequence=AAGCATAAAACTTCAGAATTAGGTGCTTAAAGTATTTGGAACTGAGAATAACAGGGTACGAATATCACATATGGTATTACTGATGCAGTTTCAGCATACTAAAAAATAACAGGACGACTGATAGAGCAAACTGCACAGCTATTGCAGTTTTAGACTCGAAAACGAAGGAAAACCACAAAAGATAACAAAAGACCCGACTAGTATAAACTCAGCACGTAACT Started job on | Dec 09 07:49:17 Started mapping on | Dec 09 07:49:17 Finished on | Dec 09 07:52:08 Mapping speed, Million of reads per hour | 608.37 Number of input reads | 28897703 Average input read length | 120 UNIQUE READS: Uniquely mapped reads number | 26147750 Uniquely mapped reads % | 90.48% Average mapped length | 122.25 Number of splices: Total | 164698 Number of splices: Annotated (sjdb) | 29366 Number of splices: GT/AG | 79548 Number of splices: GC/AG | 7938 Number of splices: AT/AC | 284 Number of splices: Non-canonical | 76928 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1787316 % of reads mapped to multiple loci | 6.18% Number of reads mapped to too many loci | 327598 % of reads mapped to too many loci | 1.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 962637 962637 962637 N_multimapping 1787316 1787316 1787316 N_noFeature 1280876 25217026 1578898 N_ambiguous 705631 2130 81267 UnstrandedReadsAssigned:24161243 PositiveStrandReadsAssigned:928594 NegativeStrandReadsAssigned:24487585 Dataset is classified negative stranded MeadianReadLen=129 20thPercentileLength=90 echo kmer=85 SRR8846531 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8846531-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,897,703 reads, 25,409,363 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR8846531.ke.tsv 35125 SRR8846531.se.tsv 88098 total ==> SRR8846531.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 613 22.8828 PNS24243 293 194 0 0 KQK14069 1603 1504 35121.2 1195.98 KQK14071 474 375 0 0 ==> SRR8846531.se.tsv <== BRADI_1g14170v3 34998 BRADI_1g53295v3 159 BRADI_1g59795v3 535 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1945 BRADI_1g74790v3 154 BRADI_1g09890v3 46 BRADI_1g77505v3 599 BRADI_1g48960v3 0 SRR8846531 completed mapping pipeline successfully