Starting /dee2/code/volunteer_pipeline.sh SRR8846533 current disk space = 1532586393600 free memory = 1607156684 SRR8846533 SRAfilesize 2cd92ca35cb154ea7efc15277fdb6046 SRR8846533.sra SRR8846533.sra file validated SRR8846533 is paired end SRR8846533 is conventional basespace SRR8846533 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846533_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.2125 25.0 18.0 32.0 18.0 33.0 2 26.09775 27.0 18.0 31.0 18.0 33.0 3 29.38575 31.0 28.0 33.0 25.0 33.0 4 31.27275 33.0 31.0 33.0 29.0 33.0 5 32.023 33.0 32.0 33.0 31.0 33.0 6 35.90325 38.0 36.0 38.0 33.0 38.0 7 36.73275 38.0 37.0 38.0 34.0 38.0 8 36.7385 38.0 38.0 38.0 34.0 38.0 9 36.95525 38.0 38.0 38.0 35.0 38.0 10-14 36.9355 38.0 38.0 38.0 35.6 38.0 15-19 37.3428 38.0 38.0 38.0 36.8 38.0 20-24 37.44305000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.30355000000001 38.0 38.0 38.0 36.8 38.0 30-34 37.0629 38.0 38.0 38.0 36.0 38.0 35-39 37.04109999999999 38.0 38.0 38.0 36.0 38.0 40-44 37.18575 38.0 38.0 38.0 36.0 38.0 45-49 37.19415 38.0 38.0 38.0 36.0 38.0 50-54 37.06245 38.0 38.0 38.0 35.8 38.0 55-59 36.919050000000006 38.0 38.0 38.0 35.0 38.0 60-64 36.8851 38.0 38.0 38.0 35.0 38.0 65-69 36.92065 38.0 38.0 38.0 35.2 38.0 70-74 36.7665 38.0 38.0 38.0 34.6 38.0 75-79 36.708999999999996 38.0 38.0 38.0 34.4 38.0 80-84 36.197500000000005 38.0 37.0 38.0 32.4 38.0 85-89 35.95355 38.0 37.0 38.0 31.8 38.0 90-94 36.14975 38.0 36.8 38.0 33.2 38.0 95-99 36.30024999999999 38.0 37.0 38.0 33.4 38.0 100-104 35.83095 38.0 36.6 38.0 31.6 38.0 105-109 34.865 38.0 35.2 38.0 26.4 38.0 110-114 35.35170000000001 38.0 35.6 38.0 29.2 38.0 115-119 35.538149999999995 38.0 36.0 38.0 30.6 38.0 120-124 35.3354 38.0 35.4 38.0 29.6 38.0 125-129 34.260850000000005 38.0 34.4 38.0 24.4 38.0 130-134 33.56555 38.0 34.0 38.0 21.0 38.0 135-139 33.980050000000006 38.0 34.0 38.0 23.4 38.0 140-144 33.314949999999996 38.0 33.6 38.0 20.2 38.0 145-149 32.600500000000004 37.6 33.2 38.0 15.2 38.0 150-151 27.330875 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 0.0 18 3.0 19 2.0 20 3.0 21 4.0 22 9.0 23 5.0 24 15.0 25 21.0 26 15.0 27 22.0 28 39.0 29 46.0 30 65.0 31 101.0 32 118.0 33 170.0 34 284.0 35 432.0 36 1185.0 37 1459.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.5 13.025 14.625 41.85 2 22.8 17.95 40.5 18.75 3 20.849999999999998 23.075000000000003 27.85 28.225 4 23.992994746059544 30.873154866149612 22.091568676507382 23.042281711283465 5 24.349999999999998 30.95 24.6 20.1 6 19.894233190632082 31.65449508939814 24.85520020146059 23.59607151850919 7 15.15 19.175 42.05 23.625 8 19.55 20.1 28.349999999999998 32.0 9 20.125 18.625 31.424999999999997 29.825000000000003 10-14 23.005 25.569999999999997 24.46 26.965 15-19 22.245 26.015 25.485000000000003 26.255 20-24 22.16610830541527 26.336316815840792 25.706285314265713 25.791289564478227 25-29 22.487248724872487 25.992599259925992 26.37763776377638 25.14251425142514 30-34 22.675 26.025 26.16 25.14 35-39 22.225 26.314999999999998 25.955000000000002 25.505 40-44 22.975 25.835 25.965 25.224999999999998 45-49 22.814999999999998 26.009999999999998 25.919999999999998 25.255 50-54 23.167316731673168 26.092609260926093 25.377537753775375 25.36253625362536 55-59 23.071153557677885 26.09630481524076 25.94129706485324 24.891244562228113 60-64 22.725 25.805 25.91 25.56 65-69 22.98 25.685000000000002 25.885 25.45 70-74 22.99 26.169999999999998 25.735000000000003 25.105 75-79 22.877287728772878 25.967596759675963 26.072607260726073 25.082508250825082 80-84 22.85028262718223 25.81661747786504 26.02671202040918 25.306387874543546 85-89 23.237780779428686 25.6841262694482 26.109360148081446 24.968732803041675 90-94 23.411705852926463 25.957978989494745 25.287643821910955 25.34267133566783 95-99 23.264652930586116 25.3000600120024 25.950190038007605 25.48509701940388 100-104 23.301165058252913 26.001300065003253 25.34126706335317 25.35626781339067 105-109 24.02 25.44 24.959999999999997 25.580000000000002 110-114 23.095 25.619999999999997 25.935000000000002 25.35 115-119 23.235 26.185000000000002 24.915000000000003 25.665 120-124 22.99 25.95 25.595000000000002 25.465 125-129 23.407340734073408 25.797579757975797 25.757575757575758 25.03750375037504 130-134 23.29664832416208 25.822911455727866 25.45272636318159 25.427713856928463 135-139 23.404042425455273 25.425255153091854 25.485291174704823 25.685411246748046 140-144 23.450242657727525 25.43653374693551 25.43653374693551 25.676689848401463 145-149 23.512053616084824 25.612683805141543 25.152545763729115 25.72271681504451 150-151 23.904332582018533 25.018782870022537 24.843476083145504 26.233408464813422 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.0 27 2.0 28 1.5 29 4.0 30 11.0 31 13.0 32 14.0 33 26.5 34 30.0 35 36.5 36 48.5 37 61.0 38 92.5 39 113.0 40 117.5 41 161.0 42 201.5 43 195.0 44 207.5 45 231.0 46 228.0 47 208.0 48 193.0 49 186.5 50 172.5 51 156.0 52 136.0 53 120.5 54 112.0 55 97.5 56 90.5 57 84.0 58 66.0 59 59.0 60 60.5 61 59.0 62 55.5 63 52.5 64 45.0 65 39.0 66 44.0 67 35.5 68 29.0 69 26.5 70 20.5 71 17.5 72 12.0 73 7.5 74 5.0 75 3.5 76 2.5 77 1.5 78 1.5 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.0 6 0.7250000000000001 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.01 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.045 85-89 0.055 90-94 0.05 95-99 0.02 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.05 135-139 0.06 140-144 0.065 145-149 0.03 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.825 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.1375 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.9125 0.0 0.0 0.0 0.0 138-139 3.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCAAT 10 0.006585701 146.75949 6 TCCAGCG 10 0.006585701 146.75949 2 GATCCAA 10 0.006585701 146.75949 5 >>END_MODULE SRR8846533 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846533_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5195 33.0 33.0 34.0 32.0 34.0 2 32.533 33.0 33.0 34.0 31.0 34.0 3 32.80575 33.0 33.0 34.0 32.0 34.0 4 32.76825 34.0 33.0 34.0 32.0 34.0 5 32.801 33.0 33.0 34.0 32.0 34.0 6 37.026 38.0 38.0 38.0 36.0 38.0 7 37.03725 38.0 38.0 38.0 36.0 38.0 8 37.07175 38.0 38.0 38.0 36.0 38.0 9 36.991 38.0 38.0 38.0 36.0 38.0 10-14 37.0201 38.0 38.0 38.0 36.4 38.0 15-19 36.85535 38.0 38.0 38.0 35.6 38.0 20-24 36.68165 38.0 38.0 38.0 34.8 38.0 25-29 36.650349999999996 38.0 38.0 38.0 34.6 38.0 30-34 36.78845 38.0 38.0 38.0 35.4 38.0 35-39 36.8137 38.0 38.0 38.0 35.6 38.0 40-44 36.5508 38.0 38.0 38.0 34.6 38.0 45-49 36.33025 38.0 38.0 38.0 33.6 38.0 50-54 36.3649 38.0 38.0 38.0 34.0 38.0 55-59 36.45055 38.0 38.0 38.0 34.0 38.0 60-64 36.2753 38.0 37.8 38.0 33.6 38.0 65-69 36.229400000000005 38.0 37.8 38.0 33.4 38.0 70-74 36.40625 38.0 38.0 38.0 34.0 38.0 75-79 36.52335 38.0 38.0 38.0 34.4 38.0 80-84 36.49675 38.0 38.0 38.0 34.2 38.0 85-89 36.225 38.0 38.0 38.0 33.6 38.0 90-94 35.900150000000004 38.0 37.2 38.0 32.0 38.0 95-99 35.7123 38.0 37.0 38.0 31.4 38.0 100-104 35.8248 38.0 37.0 38.0 32.6 38.0 105-109 35.2683 38.0 36.2 38.0 29.4 38.0 110-114 35.105199999999996 38.0 35.8 38.0 28.4 38.0 115-119 34.955400000000004 38.0 35.4 38.0 27.4 38.0 120-124 35.0086 38.0 35.4 38.0 28.2 38.0 125-129 34.908550000000005 38.0 35.2 38.0 28.0 38.0 130-134 34.25285 38.0 35.0 38.0 23.6 38.0 135-139 33.746 38.0 34.2 38.0 21.4 38.0 140-144 33.613749999999996 38.0 33.8 38.0 22.2 38.0 145-149 32.7744 38.0 33.0 38.0 16.4 38.0 150-151 28.161 35.5 18.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 2.0 5 1.0 6 3.0 7 0.0 8 2.0 9 0.0 10 1.0 11 1.0 12 2.0 13 4.0 14 0.0 15 3.0 16 2.0 17 5.0 18 5.0 19 5.0 20 5.0 21 8.0 22 12.0 23 10.0 24 11.0 25 17.0 26 26.0 27 45.0 28 51.0 29 60.0 30 51.0 31 73.0 32 125.0 33 149.0 34 194.0 35 312.0 36 729.0 37 2076.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.575 12.4 13.775 38.25 2 28.7 18.525 33.375 19.400000000000002 3 23.1 22.25 29.675 24.975 4 25.3 30.9 18.95 24.85 5 25.85 33.95 19.725 20.474999999999998 6 19.825 34.275 21.45 24.45 7 20.7 15.35 38.824999999999996 25.124999999999996 8 21.975 21.575 24.775 31.674999999999997 9 23.625 21.125 25.85 29.4 10-14 26.33289986996099 24.52735820746224 23.462038611583473 25.677703310993298 15-19 25.2437865679852 24.52367855178277 24.843726558983846 25.388808321248185 20-24 25.53 25.165 25.005 24.3 25-29 25.22252225222522 25.03750375037504 24.69246924692469 25.047504750475046 30-34 25.44 25.825 24.66 24.075 35-39 25.779999999999998 25.155 24.845 24.22 40-44 25.929999999999996 25.540000000000003 24.29 24.240000000000002 45-49 26.25262526252625 24.772477247724773 25.252525252525253 23.72237223722372 50-54 25.366341585396352 25.42135533883471 24.93123280820205 24.281070267566893 55-59 25.740296118447382 24.859943977591037 25.390156062424968 24.009603841536613 60-64 25.465093018603717 25.245049009801964 25.395079015803162 23.894778955791157 65-69 25.874999999999996 25.095 25.195 23.835 70-74 25.505 25.365 25.085 24.044999999999998 75-79 25.740000000000002 25.224999999999998 25.485000000000003 23.549999999999997 80-84 25.874999999999996 25.215 25.31 23.599999999999998 85-89 25.855 25.275 25.195 23.674999999999997 90-94 25.95148787196799 25.496374093523382 25.2863215803951 23.265816454113526 95-99 25.55905748161489 26.184401420781427 24.81364750612837 23.44289359147531 100-104 26.17224640944803 25.546714707501376 25.071310614021918 23.209728269028673 105-109 25.427885096586927 25.58802922630367 25.38784906415774 23.596236612951657 110-114 25.546714707501376 26.1222038732923 23.970374818595808 24.36070660061052 115-119 26.104357396568112 25.95427485116814 24.838661263695034 23.102706488568714 120-124 25.94667600420189 26.27182232004402 24.726126757040667 23.05537491871342 125-129 25.60396138648527 25.799029660381134 25.0937828239884 23.5032261291452 130-134 26.35817908954477 25.652826413206604 25.05752876438219 22.93146573286643 135-139 26.58563425370148 25.230092036814728 25.610244097639058 22.574029611844736 140-144 26.511930368665897 25.73658146165775 25.256365364413984 22.49512280526237 145-149 26.27025405081016 25.91018203640728 24.944988997799562 22.874574914982997 150-151 26.573251595145752 25.647441511322405 24.98436131615163 22.794945577380208 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 1.5 27 1.5 28 1.5 29 4.5 30 5.0 31 6.5 32 11.5 33 18.0 34 25.0 35 35.5 36 43.0 37 58.0 38 71.5 39 80.0 40 109.5 41 141.5 42 163.0 43 171.5 44 187.5 45 200.0 46 189.0 47 197.5 48 190.5 49 182.5 50 177.5 51 155.5 52 147.0 53 125.0 54 106.5 55 109.0 56 97.5 57 85.0 58 89.0 59 80.0 60 73.5 61 76.0 62 69.5 63 57.5 64 57.0 65 63.0 66 59.5 67 51.5 68 41.0 69 35.5 70 36.0 71 29.5 72 25.0 73 20.5 74 12.5 75 6.5 76 4.5 77 4.0 78 2.5 79 1.0 80 0.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.03 15-19 0.015 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.025 55-59 0.04 60-64 0.02 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.025 95-99 0.055 100-104 0.08499999999999999 105-109 0.09 110-114 0.08499999999999999 115-119 0.055 120-124 0.045 125-129 0.034999999999999996 130-134 0.05 135-139 0.04 140-144 0.045 145-149 0.02 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42080080584236 98.7 2 0.528834046839587 1.05 3 0.0 0.0 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.02518257365902795 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.9125000000000001 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.525 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.2125000000000004 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.0250000000000004 0.0 0.0 0.0 0.0 138-139 3.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTCCT 10 0.006830828 145.0 2 GGTCCTC 10 0.006830828 145.0 3 GCACTAC 10 0.006830828 145.0 3 CTTCTGA 10 0.006830828 145.0 7 >>END_MODULE Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040851 spots for SRR8846533.sra Written 1040851 spots for SRR8846533.sra Read 1040856 spots for SRR8846533.sra Written 1040856 spots for SRR8846533.sra SRR ids: ['SRR8846533.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4cid2jzv SRR8846533.sra spots: 20817025 blocks: [[1, 1040851], [1040852, 2081702], [2081703, 3122553], [3122554, 4163404], [4163405, 5204255], [5204256, 6245106], [6245107, 7285957], [7285958, 8326808], [8326809, 9367659], [9367660, 10408510], [10408511, 11449361], [11449362, 12490212], [12490213, 13531063], [13531064, 14571914], [14571915, 15612765], [15612766, 16653616], [16653617, 17694467], [17694468, 18735318], [18735319, 19776169], [19776170, 20817025]] SRR8846533 file size 7032506 SRR8846533 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846533 SRR8846533_1.fastq SRR8846533_2.fastq Input file: SRR8846533_1.fastq Paired file: SRR8846533_2.fastq trimmed: SRR8846533-trimmed-pair1.fastq, SRR8846533-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 08:04:12 2024 >> started Mon Dec 9 08:04:33 2024 >> done (21.470s) 20817025 read pairs processed; of these: 22459 ( 0.11%) short read pairs filtered out after trimming by size control 28525 ( 0.14%) empty read pairs filtered out after trimming by size control 20766041 (99.76%) read pairs available; of these: 8771754 (42.24%) trimmed read pairs available after processing 11994287 (57.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 6 0.00% 21 12 0.00% 22 14 0.00% 23 11 0.00% 24 10 0.00% 25 12 0.00% 26 10 0.00% 27 11 0.00% 28 12 0.00% 29 8 0.00% 30 12 0.00% 31 18 0.00% 32 13 0.00% 33 12 0.00% 34 16 0.00% 35 14 0.00% 36 15 0.00% 37 15 0.00% 38 15 0.00% 39 18 0.00% 40 28 0.00% 41 16 0.00% 42 17 0.00% 43 23 0.00% 44 20 0.00% 45 24 0.00% 46 26 0.00% 47 27 0.00% 48 27 0.00% 49 51 0.00% 50 37 0.00% 51 41 0.00% 52 43 0.00% 53 51 0.00% 54 57 0.00% 55 73 0.00% 56 55 0.00% 57 74 0.00% 58 75 0.00% 59 80 0.00% 60 117 0.00% 61 126 0.00% 62 137 0.00% 63 133 0.00% 64 151 0.00% 65 186 0.00% 66 191 0.00% 67 210 0.00% 68 240 0.00% 69 251 0.00% 70 275 0.00% 71 338 0.00% 72 407 0.00% 73 409 0.00% 74 465 0.00% 75 556 0.00% 76 631 0.00% 77 661 0.00% 78 723 0.00% 79 818 0.00% 80 856 0.00% 81 1033 0.00% 82 1200 0.01% 83 1408 0.01% 84 2320 0.01% 85 2815 0.01% 86 3036 0.01% 87 3019 0.01% 88 3214 0.02% 89 3335 0.02% 90 3463 0.02% 91 3709 0.02% 92 3890 0.02% 93 4204 0.02% 94 4457 0.02% 95 4977 0.02% 96 5308 0.03% 97 5678 0.03% 98 5942 0.03% 99 6352 0.03% 100 6691 0.03% 101 7226 0.03% 102 7569 0.04% 103 8221 0.04% 104 8728 0.04% 105 9208 0.04% 106 10270 0.05% 107 10759 0.05% 108 11833 0.06% 109 12465 0.06% 110 13258 0.06% 111 13559 0.07% 112 14593 0.07% 113 15236 0.07% 114 16396 0.08% 115 17323 0.08% 116 18269 0.09% 117 19000 0.09% 118 20154 0.10% 119 21161 0.10% 120 22160 0.11% 121 23419 0.11% 122 24416 0.12% 123 25769 0.12% 124 27485 0.13% 125 29105 0.14% 126 30173 0.15% 127 32194 0.16% 128 33579 0.16% 129 35647 0.17% 130 38382 0.18% 131 40712 0.20% 132 42936 0.21% 133 46219 0.22% 134 49376 0.24% 135 52853 0.25% 136 57708 0.28% 137 61672 0.30% 138 67709 0.33% 139 74563 0.36% 140 81404 0.39% 141 89722 0.43% 142 102386 0.49% 143 116698 0.56% 144 138797 0.67% 145 174541 0.84% 146 239429 1.15% 147 346427 1.67% 148 485779 2.34% 149 1036709 4.99% 150 4803513 23.13% 151 11994287 57.76% 20766041 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=5.00 fanout-score-rank=19 prefix-density=0.85 prefix-fanout=2.1 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGGAAGCTTCCACATTGTCCAGTACCTGCCGTCGTAGTACCCGGGAGAGTTGCCGTGCTCACGGAAGACGAAACCGACCTTGCTGAACTCGAGGCAAGGAACCCACTTGGAGCGGATGAGATACTCGATCTGCTTCAAGAGGGACTCCACGGTGAGAGGCGGCAGGTAGGAAAGGGTTTCGAACTTCTTGATGCCCTCAATTGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGGAGACGCTGCCGAGACCAGCGCTGGCTGAGCGGCGGCCGATGGGGAGCCCGGCGGTGGACTTGAGGCCCTGGAAAGGAGCAACGGCAGTAGCCGCTGACGACATCACTGTGGGAGCCATCGTACACGTACGTAGATAGCTAACAAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=178.25 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.2 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=35 prefix-density=0.47 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=165.13 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.7 sequence=CTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGTTTAAATTGACATCTTCATAAGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTCTAAAACTTTAACTGCTTCCCAAATTTCCCCAATATCAGACATTCCTGTAGATAAAATCACCGGCTTGCCTGTTTTTGCCACTTTTT SRR8846533 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 08:05:36 Started mapping on | Dec 09 08:05:36 Finished on | Dec 09 08:07:57 Mapping speed, Million of reads per hour | 530.20 Number of input reads | 20766041 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20169094 Uniquely mapped reads % | 97.13% Average mapped length | 297.07 Number of splices: Total | 22958396 Number of splices: Annotated (sjdb) | 21567840 Number of splices: GT/AG | 22654876 Number of splices: GC/AG | 272177 Number of splices: AT/AC | 12132 Number of splices: Non-canonical | 19211 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 167552 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 14649 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.53% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 441418 441418 441418 N_multimapping 167552 167552 167552 N_noFeature 835652 19596233 1012277 N_ambiguous 461940 3056 66612 UnstrandedReadsAssigned:18871502 PositiveStrandReadsAssigned:569805 NegativeStrandReadsAssigned:19090205 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR8846533 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846533-trimmed-pair1.fastq SRR8846533-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,766,041 reads, 19,152,582 reads pseudoaligned [quant] estimated average fragment length: 281.529 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52973 SRR8846533.ke.tsv 35125 SRR8846533.se.tsv 88098 total ==> SRR8846533.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.087 0 0 PNS24247 1044 763.471 87.8587 8.8792 PNS24249 1928 1647.47 40.979 1.91922 PNS24246 1044 763.471 87.8587 8.8792 PNS24248 1044 763.471 87.8587 8.8792 PNS24244 1471 1190.47 101.445 6.57496 PNS24243 293 79.2496 0 0 KQK14069 1603 1322.47 9376.99 547.091 KQK14071 474 215.556 114.291 40.9103 ==> SRR8846533.se.tsv <== BRADI_1g14170v3 10781 BRADI_1g53295v3 112 BRADI_1g59795v3 434 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 2149 BRADI_1g74790v3 169 BRADI_1g09890v3 2 BRADI_1g77505v3 344 BRADI_1g48960v3 1 SRR8846533 completed mapping pipeline successfully