Starting /dee2/code/volunteer_pipeline.sh SRR8846534 current disk space = 1532585361408 free memory = 1363916592 SRR8846534 SRAfilesize 78dadf11f8b069332ae18edceb476545 SRR8846534.sra SRR8846534.sra file validated SRR8846534 is paired end SRR8846534 is conventional basespace SRR8846534 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846534_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.545 25.0 18.0 32.0 18.0 33.0 2 23.7925 25.0 18.0 29.0 18.0 33.0 3 26.79 27.0 25.0 32.0 18.0 32.0 4 29.47525 31.0 29.0 33.0 25.0 33.0 5 31.628 33.0 32.0 33.0 30.0 33.0 6 36.2225 38.0 36.0 38.0 33.0 38.0 7 36.932 38.0 37.0 38.0 35.0 38.0 8 37.14025 38.0 38.0 38.0 36.0 38.0 9 37.3995 38.0 38.0 38.0 37.0 38.0 10-14 37.3147 38.0 38.0 38.0 36.6 38.0 15-19 37.2341 38.0 38.0 38.0 36.4 38.0 20-24 37.27435 38.0 38.0 38.0 36.6 38.0 25-29 37.3833 38.0 38.0 38.0 37.0 38.0 30-34 37.38655 38.0 38.0 38.0 37.0 38.0 35-39 37.27745 38.0 38.0 38.0 36.4 38.0 40-44 37.00565 38.0 38.0 38.0 35.6 38.0 45-49 36.8788 38.0 38.0 38.0 35.4 38.0 50-54 37.03605 38.0 38.0 38.0 35.8 38.0 55-59 36.827999999999996 38.0 38.0 38.0 34.8 38.0 60-64 36.733349999999994 38.0 38.0 38.0 34.2 38.0 65-69 36.6342 38.0 38.0 38.0 34.0 38.0 70-74 36.53405 38.0 37.6 38.0 34.0 38.0 75-79 36.396100000000004 38.0 37.0 38.0 33.8 38.0 80-84 36.1801 38.0 37.0 38.0 33.2 38.0 85-89 35.84065 38.0 36.6 38.0 31.8 38.0 90-94 35.40794999999999 38.0 36.0 38.0 29.0 38.0 95-99 35.32195 38.0 36.0 38.0 29.0 38.0 100-104 35.30435 38.0 35.4 38.0 29.0 38.0 105-109 35.09145 38.0 35.0 38.0 28.6 38.0 110-114 34.2498 38.0 34.2 38.0 24.8 38.0 115-119 33.71815 37.8 33.8 38.0 22.6 38.0 120-124 33.643899999999995 37.6 33.8 38.0 22.2 38.0 125-129 33.2019 36.8 32.8 38.0 20.2 38.0 130-134 32.42475 36.2 31.0 38.0 14.8 38.0 135-139 31.304949999999998 35.0 28.8 38.0 14.0 38.0 140-144 30.388150000000003 35.0 27.0 38.0 13.6 38.0 145-149 28.867 33.8 24.2 38.0 6.4 38.0 150-151 23.78125 29.5 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 1.0 19 4.0 20 5.0 21 7.0 22 6.0 23 8.0 24 23.0 25 13.0 26 23.0 27 31.0 28 48.0 29 67.0 30 91.0 31 127.0 32 196.0 33 257.0 34 447.0 35 799.0 36 1274.0 37 566.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.132231404958674 20.816115702479337 8.18698347107438 41.864669421487605 2 22.35 24.375 33.025 20.25 3 21.099999999999998 28.15 26.724999999999998 24.025 4 26.174999999999997 30.25 20.875 22.7 5 23.025000000000002 34.575 21.775 20.625 6 17.825 35.175 23.225 23.775 7 15.275 19.575 43.1 22.05 8 19.275000000000002 20.75 28.475 31.5 9 20.225 19.900000000000002 30.825000000000003 29.049999999999997 10-14 23.11 26.185000000000002 24.125 26.58 15-19 22.37 26.61 25.685000000000002 25.335 20-24 22.165000000000003 27.175 26.029999999999998 24.63 25-29 21.89 26.63 26.340000000000003 25.14 30-34 22.06 26.51 26.05 25.380000000000003 35-39 21.955 27.034999999999997 26.009999999999998 25.0 40-44 22.61 26.525 26.0 24.865000000000002 45-49 22.675 26.605 25.835 24.884999999999998 50-54 22.384999999999998 26.13 26.015 25.47 55-59 22.71 26.02 26.66 24.610000000000003 60-64 22.335 26.284999999999997 25.95 25.430000000000003 65-69 22.695 25.945 26.31 25.05 70-74 23.425 25.900000000000002 25.94 24.735 75-79 22.919999999999998 26.3 25.490000000000002 25.290000000000003 80-84 22.634999999999998 26.165 25.745 25.455 85-89 23.365 26.435 25.3 24.9 90-94 23.150000000000002 25.31 26.085 25.455 95-99 23.375 25.95 26.015 24.66 100-104 23.64 26.11 25.285000000000004 24.965 105-109 23.794999999999998 26.19 25.275 24.740000000000002 110-114 22.875 26.11 25.900000000000002 25.115 115-119 23.445 26.075 25.629999999999995 24.85 120-124 23.400000000000002 25.95 25.624999999999996 25.025 125-129 23.200000000000003 26.150000000000002 25.929999999999996 24.72 130-134 23.75 25.46 25.31 25.480000000000004 135-139 22.97 26.015 25.64 25.374999999999996 140-144 23.305 25.779999999999998 25.765 25.15 145-149 23.43 25.759999999999998 25.679999999999996 25.130000000000003 150-151 23.5875 24.625 25.7125 26.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 3.0 27 3.5 28 3.0 29 6.0 30 7.5 31 6.0 32 13.5 33 30.0 34 35.5 35 50.0 36 74.5 37 91.0 38 101.0 39 115.0 40 142.5 41 172.5 42 198.0 43 201.0 44 196.5 45 208.5 46 214.0 47 205.5 48 198.0 49 192.0 50 162.5 51 142.0 52 122.0 53 102.0 54 101.5 55 94.5 56 89.5 57 82.5 58 70.5 59 76.5 60 75.0 61 56.0 62 47.5 63 44.0 64 47.5 65 39.0 66 32.5 67 32.0 68 26.0 69 20.0 70 18.0 71 13.5 72 10.5 73 9.0 74 5.0 75 3.0 76 0.5 77 2.0 78 2.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7060010085728694 1.4000000000000001 3 0.07564296520423601 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.8 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTCTG 10 0.006836113 144.9625 5 TGTAACA 10 0.006836113 144.9625 7 >>END_MODULE SRR8846534 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846534_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7365 33.0 33.0 34.0 32.0 34.0 2 32.851 33.0 33.0 34.0 32.0 34.0 3 32.62375 33.0 33.0 34.0 32.0 34.0 4 32.892 33.0 33.0 34.0 32.0 34.0 5 32.83925 34.0 33.0 34.0 32.0 34.0 6 36.98875 38.0 38.0 38.0 36.0 38.0 7 37.112 38.0 38.0 38.0 36.0 38.0 8 37.1475 38.0 38.0 38.0 36.0 38.0 9 37.07725 38.0 38.0 38.0 36.0 38.0 10-14 37.0771 38.0 38.0 38.0 36.2 38.0 15-19 37.0487 38.0 38.0 38.0 36.2 38.0 20-24 37.06095 38.0 38.0 38.0 36.2 38.0 25-29 37.00834999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.9376 38.0 38.0 38.0 36.0 38.0 35-39 36.862049999999996 38.0 38.0 38.0 35.2 38.0 40-44 36.82045 38.0 38.0 38.0 35.2 38.0 45-49 36.73465 38.0 38.0 38.0 34.8 38.0 50-54 36.55245 38.0 38.0 38.0 34.2 38.0 55-59 36.38705 38.0 38.0 38.0 33.8 38.0 60-64 36.4906 38.0 38.0 38.0 33.8 38.0 65-69 36.54765 38.0 38.0 38.0 34.2 38.0 70-74 36.4919 38.0 38.0 38.0 34.0 38.0 75-79 36.1297 38.0 37.2 38.0 33.0 38.0 80-84 36.035450000000004 38.0 37.0 38.0 33.0 38.0 85-89 35.84855 38.0 37.0 38.0 31.6 38.0 90-94 35.7014 38.0 36.4 38.0 31.2 38.0 95-99 35.44065 38.0 36.0 38.0 30.2 38.0 100-104 35.2182 38.0 35.8 38.0 28.8 38.0 105-109 34.8158 38.0 34.8 38.0 27.4 38.0 110-114 34.315099999999994 38.0 34.4 38.0 24.6 38.0 115-119 34.032149999999994 38.0 34.0 38.0 23.2 38.0 120-124 33.45815 38.0 33.8 38.0 19.0 38.0 125-129 32.6489 37.0 32.2 38.0 16.2 38.0 130-134 32.3244 36.4 31.4 38.0 14.6 38.0 135-139 31.070000000000004 35.6 29.2 38.0 13.2 38.0 140-144 30.01645 34.6 27.2 38.0 12.4 38.0 145-149 28.418550000000003 33.4 24.4 38.0 3.8 38.0 150-151 21.225 26.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 1.0 5 2.0 6 0.0 7 1.0 8 0.0 9 2.0 10 1.0 11 2.0 12 4.0 13 1.0 14 0.0 15 0.0 16 2.0 17 6.0 18 7.0 19 5.0 20 6.0 21 12.0 22 17.0 23 24.0 24 24.0 25 27.0 26 30.0 27 39.0 28 45.0 29 51.0 30 95.0 31 106.0 32 145.0 33 227.0 34 320.0 35 627.0 36 1168.0 37 998.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.0 14.7 11.15 36.15 2 28.199999999999996 20.025000000000002 32.375 19.400000000000002 3 22.650000000000002 22.5 30.75 24.099999999999998 4 25.8 31.974999999999998 18.7 23.525 5 26.6 34.2 19.725 19.475 6 20.349999999999998 34.75 21.3 23.599999999999998 7 20.125 14.799999999999999 39.225 25.85 8 22.125 21.3 24.425 32.15 9 23.375 21.65 27.750000000000004 27.224999999999998 10-14 26.490000000000002 24.47 22.97 26.07 15-19 25.525 25.235000000000003 24.795 24.445 20-24 25.605 25.264999999999997 25.185000000000002 23.945 25-29 25.83 25.495 24.72 23.955000000000002 30-34 25.435000000000002 25.629999999999995 24.465 24.47 35-39 25.09 25.695 25.16 24.055 40-44 25.745 25.455 24.615000000000002 24.185000000000002 45-49 25.724999999999998 25.285000000000004 25.224999999999998 23.765 50-54 25.509999999999998 25.97 24.385 24.135 55-59 26.1 25.345000000000002 25.055 23.5 60-64 25.25 25.355 25.11 24.285 65-69 25.759999999999998 25.264999999999997 25.64 23.335 70-74 25.845000000000002 24.79 25.14 24.224999999999998 75-79 25.405 25.615 24.875 24.104999999999997 80-84 25.755 25.569999999999997 25.135 23.54 85-89 25.555 25.895000000000003 24.985 23.565 90-94 25.335 25.82 25.509999999999998 23.335 95-99 25.564999999999998 26.11 24.85 23.474999999999998 100-104 25.34 25.555 25.64 23.465 105-109 25.490000000000002 25.874999999999996 25.264999999999997 23.369999999999997 110-114 25.555 26.32 25.185000000000002 22.939999999999998 115-119 26.255 25.650000000000002 25.335 22.759999999999998 120-124 25.430000000000003 25.465 25.745 23.36 125-129 25.985000000000003 25.535000000000004 25.335 23.145 130-134 26.045 25.72 25.474999999999998 22.759999999999998 135-139 25.64 25.585 25.6 23.175 140-144 26.13 26.0 25.619999999999997 22.25 145-149 25.695 25.95 25.31 23.044999999999998 150-151 25.7375 25.662499999999998 26.0 22.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.0 26 1.5 27 1.5 28 3.0 29 4.0 30 6.0 31 8.0 32 10.0 33 16.0 34 26.0 35 32.5 36 38.5 37 55.5 38 68.0 39 93.0 40 134.5 41 145.5 42 150.0 43 171.5 44 186.0 45 193.5 46 196.0 47 195.5 48 191.0 49 174.0 50 169.0 51 165.0 52 139.5 53 126.5 54 120.5 55 103.0 56 92.5 57 91.0 58 94.5 59 89.5 60 83.0 61 78.5 62 66.0 63 65.0 64 64.5 65 61.0 66 54.5 67 46.0 68 38.5 69 32.5 70 31.5 71 23.0 72 14.5 73 11.0 74 8.5 75 7.5 76 6.0 77 4.0 78 3.0 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16645617580197 98.15 2 0.6567314978529932 1.3 3 0.15155342258145996 0.44999999999999996 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.0875 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.4 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 2.1500000000000004 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCTTT 10 0.006830828 145.0 7 >>END_MODULE Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925556 spots for SRR8846534.sra Written 925556 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra Read 925542 spots for SRR8846534.sra Written 925542 spots for SRR8846534.sra SRR ids: ['SRR8846534.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_advfrp_4 SRR8846534.sra spots: 18510854 blocks: [[1, 925542], [925543, 1851084], [1851085, 2776626], [2776627, 3702168], [3702169, 4627710], [4627711, 5553252], [5553253, 6478794], [6478795, 7404336], [7404337, 8329878], [8329879, 9255420], [9255421, 10180962], [10180963, 11106504], [11106505, 12032046], [12032047, 12957588], [12957589, 13883130], [13883131, 14808672], [14808673, 15734214], [15734215, 16659756], [16659757, 17585298], [17585299, 18510854]] SRR8846534 file size 6251020 SRR8846534 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846534 SRR8846534_1.fastq SRR8846534_2.fastq Input file: SRR8846534_1.fastq Paired file: SRR8846534_2.fastq trimmed: SRR8846534-trimmed-pair1.fastq, SRR8846534-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 08:04:36 2024 >> started Mon Dec 9 08:06:16 2024 >> done (99.499s) 18510854 read pairs processed; of these: 11984 ( 0.06%) short read pairs filtered out after trimming by size control 8372 ( 0.05%) empty read pairs filtered out after trimming by size control 18490498 (99.89%) read pairs available; of these: 10475659 (56.65%) trimmed read pairs available after processing 8014839 (43.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 11 0.00% 21 7 0.00% 22 7 0.00% 23 8 0.00% 24 8 0.00% 25 14 0.00% 26 8 0.00% 27 9 0.00% 28 5 0.00% 29 10 0.00% 30 9 0.00% 31 9 0.00% 32 7 0.00% 33 8 0.00% 34 4 0.00% 35 6 0.00% 36 7 0.00% 37 11 0.00% 38 13 0.00% 39 5 0.00% 40 19 0.00% 41 11 0.00% 42 5 0.00% 43 16 0.00% 44 13 0.00% 45 24 0.00% 46 17 0.00% 47 20 0.00% 48 24 0.00% 49 27 0.00% 50 26 0.00% 51 33 0.00% 52 27 0.00% 53 29 0.00% 54 30 0.00% 55 42 0.00% 56 52 0.00% 57 56 0.00% 58 41 0.00% 59 68 0.00% 60 70 0.00% 61 104 0.00% 62 83 0.00% 63 121 0.00% 64 126 0.00% 65 121 0.00% 66 113 0.00% 67 185 0.00% 68 156 0.00% 69 220 0.00% 70 233 0.00% 71 252 0.00% 72 294 0.00% 73 336 0.00% 74 397 0.00% 75 414 0.00% 76 506 0.00% 77 555 0.00% 78 618 0.00% 79 672 0.00% 80 761 0.00% 81 847 0.00% 82 939 0.01% 83 1096 0.01% 84 1697 0.01% 85 1959 0.01% 86 2025 0.01% 87 2222 0.01% 88 2378 0.01% 89 2479 0.01% 90 2746 0.01% 91 2793 0.02% 92 3110 0.02% 93 3364 0.02% 94 3671 0.02% 95 3958 0.02% 96 4337 0.02% 97 4608 0.02% 98 4887 0.03% 99 5301 0.03% 100 5735 0.03% 101 6084 0.03% 102 6646 0.04% 103 7254 0.04% 104 7671 0.04% 105 8125 0.04% 106 9037 0.05% 107 9601 0.05% 108 10356 0.06% 109 11241 0.06% 110 11978 0.06% 111 12491 0.07% 112 13404 0.07% 113 14216 0.08% 114 15374 0.08% 115 16562 0.09% 116 17417 0.09% 117 18692 0.10% 118 20058 0.11% 119 21109 0.11% 120 22607 0.12% 121 23970 0.13% 122 25714 0.14% 123 27342 0.15% 124 29153 0.16% 125 30854 0.17% 126 32979 0.18% 127 35363 0.19% 128 37968 0.21% 129 40864 0.22% 130 44152 0.24% 131 47202 0.26% 132 51573 0.28% 133 55568 0.30% 134 60335 0.33% 135 65953 0.36% 136 72585 0.39% 137 80056 0.43% 138 89648 0.48% 139 100586 0.54% 140 112591 0.61% 141 128363 0.69% 142 150258 0.81% 143 178318 0.96% 144 215389 1.16% 145 271955 1.47% 146 362318 1.96% 147 510334 2.76% 148 746829 4.04% 149 1383049 7.48% 150 5137223 27.78% 151 8014839 43.35% 18490498 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=8 prefix-density=0.91 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=20 fanout-score=11.54 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=3.8 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=11 prefix-density=0.81 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=114.55 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.5 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR8846534 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 08:10:52 Started mapping on | Dec 09 08:10:53 Finished on | Dec 09 08:19:06 Mapping speed, Million of reads per hour | 135.02 Number of input reads | 18490498 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18011587 Uniquely mapped reads % | 97.41% Average mapped length | 296.13 Number of splices: Total | 20441024 Number of splices: Annotated (sjdb) | 19329831 Number of splices: GT/AG | 20179278 Number of splices: GC/AG | 237590 Number of splices: AT/AC | 9797 Number of splices: Non-canonical | 14359 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 154799 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 12917 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.34% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 331581 331581 331581 N_multimapping 154799 154799 154799 N_noFeature 607253 17503672 748768 N_ambiguous 428575 2356 62844 UnstrandedReadsAssigned:16975759 PositiveStrandReadsAssigned:505559 NegativeStrandReadsAssigned:17199975 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846534 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846534-trimmed-pair1.fastq SRR8846534-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,490,498 reads, 17,254,217 reads pseudoaligned [quant] estimated average fragment length: 271.285 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52973 SRR8846534.ke.tsv 35125 SRR8846534.se.tsv 88098 total ==> SRR8846534.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.115 0 0 PNS24247 1044 773.715 64.2911 6.76941 PNS24249 1928 1657.72 45.1492 2.21882 PNS24246 1044 773.715 64.2911 6.76941 PNS24248 1044 773.715 64.2911 6.76941 PNS24244 1471 1200.72 25.9776 1.76255 PNS24243 293 79.0943 0 0 KQK14069 1603 1332.72 2373.59 145.094 KQK14071 474 218.52 86.1696 32.1252 ==> SRR8846534.se.tsv <== BRADI_1g14170v3 3440 BRADI_1g53295v3 82 BRADI_1g59795v3 705 BRADI_1g07683v3 0 BRADI_1g00485v3 59 BRADI_1g20270v3 3120 BRADI_1g74790v3 69 BRADI_1g09890v3 3 BRADI_1g77505v3 267 BRADI_1g48960v3 1 SRR8846534 completed mapping pipeline successfully