Starting /dee2/code/volunteer_pipeline.sh SRR8846535 current disk space = 1532115103744 free memory = 1572085648 SRR8846535 SRAfilesize 52e8aca5387ff67db2b047405da45d8f SRR8846535.sra SRR8846535.sra file validated SRR8846535 is paired end SRR8846535 is conventional basespace SRR8846535 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846535_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.801 18.0 18.0 32.0 18.0 33.0 2 30.006 31.0 28.0 33.0 27.0 33.0 3 30.91075 33.0 30.0 33.0 27.0 33.0 4 31.866 33.0 32.0 33.0 30.0 33.0 5 32.648 33.0 33.0 33.0 32.0 34.0 6 36.88875 38.0 38.0 38.0 35.0 38.0 7 37.1925 38.0 38.0 38.0 36.0 38.0 8 37.34825 38.0 38.0 38.0 37.0 38.0 9 37.45875 38.0 38.0 38.0 37.0 38.0 10-14 37.27830000000001 38.0 38.0 38.0 36.6 38.0 15-19 37.140550000000005 38.0 38.0 38.0 36.0 38.0 20-24 37.183350000000004 38.0 38.0 38.0 36.2 38.0 25-29 37.45295000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.3281 38.0 38.0 38.0 36.8 38.0 35-39 37.200450000000004 38.0 38.0 38.0 36.4 38.0 40-44 36.8828 38.0 38.0 38.0 35.2 38.0 45-49 37.00465 38.0 38.0 38.0 35.6 38.0 50-54 36.95795 38.0 38.0 38.0 35.8 38.0 55-59 36.8009 38.0 38.0 38.0 34.8 38.0 60-64 36.60445 38.0 38.0 38.0 34.0 38.0 65-69 36.566900000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.4344 38.0 37.6 38.0 33.8 38.0 75-79 36.429449999999996 38.0 37.6 38.0 33.8 38.0 80-84 36.26905 38.0 37.0 38.0 33.2 38.0 85-89 36.129949999999994 38.0 36.8 38.0 32.8 38.0 90-94 35.51465 38.0 36.0 38.0 29.8 38.0 95-99 35.2626 38.0 35.8 38.0 29.0 38.0 100-104 35.42550000000001 38.0 36.0 38.0 29.4 38.0 105-109 35.010149999999996 38.0 35.0 38.0 28.0 38.0 110-114 33.98125 38.0 33.6 38.0 21.8 38.0 115-119 33.318 37.0 33.0 38.0 16.2 38.0 120-124 33.099349999999994 36.8 32.6 38.0 17.4 38.0 125-129 33.0785 36.8 32.6 38.0 19.0 38.0 130-134 32.094449999999995 36.0 31.0 38.0 14.6 38.0 135-139 30.557800000000004 35.0 26.6 38.0 14.0 38.0 140-144 29.73985 34.8 25.0 38.0 13.4 38.0 145-149 28.5661 34.2 23.2 38.0 4.2 38.0 150-151 23.33625 30.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 3.0 18 3.0 19 3.0 20 4.0 21 7.0 22 9.0 23 7.0 24 12.0 25 24.0 26 33.0 27 30.0 28 67.0 29 82.0 30 93.0 31 116.0 32 180.0 33 277.0 34 453.0 35 686.0 36 1205.0 37 703.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.63806066891366 23.126782473424942 7.985480943738657 41.24967591392274 2 23.775 21.95 32.574999999999996 21.7 3 19.825 26.174999999999997 25.074999999999996 28.925 4 24.9 30.925000000000004 21.25 22.925 5 23.575 35.35 21.475 19.6 6 19.15 33.275 24.0 23.575 7 16.225 19.375 41.449999999999996 22.95 8 20.875 19.5 27.275 32.35 9 18.25 20.825 31.05 29.875 10-14 22.7 25.840000000000003 24.435000000000002 27.025 15-19 22.71 25.71 25.945 25.635 20-24 21.935 26.565 26.195 25.305 25-29 22.35 26.41 26.07 25.169999999999998 30-34 22.045 26.86 25.509999999999998 25.585 35-39 22.32 25.490000000000002 26.479999999999997 25.71 40-44 22.345000000000002 26.279999999999998 26.26 25.115 45-49 22.155 26.645000000000003 25.75 25.45 50-54 22.485 25.535000000000004 26.345000000000002 25.635 55-59 22.625 26.46 25.814999999999998 25.1 60-64 22.495 26.185000000000002 26.200000000000003 25.119999999999997 65-69 22.675 26.075 26.0 25.25 70-74 22.61 25.905 26.400000000000002 25.085 75-79 22.755 26.125 25.785000000000004 25.335 80-84 22.835 26.0 25.7 25.465 85-89 22.939999999999998 26.19 25.295 25.575 90-94 23.855 25.61 25.4 25.135 95-99 22.900000000000002 25.94 25.905 25.255 100-104 23.155 25.77 25.974999999999998 25.1 105-109 23.115 25.72 26.11 25.055 110-114 23.1 26.035000000000004 25.31 25.555 115-119 23.31 25.95 25.405 25.335 120-124 23.48 25.180000000000003 25.495 25.845000000000002 125-129 23.31 26.025 25.44 25.224999999999998 130-134 23.365 26.009999999999998 25.7 24.925 135-139 23.369999999999997 25.47 25.535000000000004 25.624999999999996 140-144 23.825 25.515 25.555 25.105 145-149 23.515 25.555 25.895000000000003 25.035 150-151 23.200000000000003 24.9 25.2125 26.687499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 3.0 28 7.0 29 10.0 30 9.5 31 12.0 32 18.5 33 24.5 34 36.0 35 45.0 36 53.5 37 71.5 38 90.5 39 117.5 40 154.5 41 182.0 42 188.0 43 197.0 44 213.0 45 219.5 46 197.5 47 190.0 48 195.0 49 173.0 50 155.5 51 150.5 52 138.5 53 122.5 54 106.0 55 95.5 56 92.0 57 84.5 58 74.5 59 68.0 60 64.0 61 53.5 62 45.0 63 38.0 64 42.5 65 41.5 66 40.5 67 41.5 68 32.0 69 25.5 70 19.0 71 15.5 72 13.0 73 10.0 74 7.5 75 5.0 76 3.0 77 0.5 78 0.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72389558232932 99.325 2 0.2259036144578313 0.44999999999999996 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0251004016064257 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7250000000000001 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.8624999999999998 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.475 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAGCA 10 0.0068378756 144.95 8 CCTTCAT 10 0.0068378756 144.95 5 >>END_MODULE SRR8846535 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846535_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5265 33.0 33.0 34.0 32.0 34.0 2 32.56075 33.0 33.0 34.0 31.0 34.0 3 32.716 33.0 33.0 34.0 32.0 34.0 4 32.57375 33.0 33.0 34.0 32.0 34.0 5 32.6285 34.0 33.0 34.0 32.0 34.0 6 36.86625 38.0 38.0 38.0 35.0 38.0 7 36.83375 38.0 38.0 38.0 36.0 38.0 8 36.79475 38.0 38.0 38.0 36.0 38.0 9 36.856 38.0 38.0 38.0 36.0 38.0 10-14 36.8546 38.0 38.0 38.0 35.8 38.0 15-19 36.82225 38.0 38.0 38.0 35.8 38.0 20-24 36.812400000000004 38.0 38.0 38.0 35.8 38.0 25-29 36.6477 38.0 38.0 38.0 35.0 38.0 30-34 36.53625000000001 38.0 38.0 38.0 34.4 38.0 35-39 36.636 38.0 38.0 38.0 35.0 38.0 40-44 36.545950000000005 38.0 38.0 38.0 34.6 38.0 45-49 36.41824999999999 38.0 38.0 38.0 34.0 38.0 50-54 36.14875 38.0 38.0 38.0 33.4 38.0 55-59 36.005700000000004 38.0 37.4 38.0 32.4 38.0 60-64 36.0211 38.0 37.4 38.0 32.6 38.0 65-69 36.3506 38.0 38.0 38.0 33.8 38.0 70-74 36.007850000000005 38.0 37.4 38.0 32.6 38.0 75-79 35.6613 38.0 37.0 38.0 30.6 38.0 80-84 35.69795 38.0 37.0 38.0 31.0 38.0 85-89 35.4895 38.0 36.6 38.0 30.2 38.0 90-94 35.35865 38.0 36.0 38.0 29.4 38.0 95-99 34.87785 38.0 35.4 38.0 27.4 38.0 100-104 34.477799999999995 38.0 35.0 38.0 25.4 38.0 105-109 34.53365 38.0 34.8 38.0 26.0 38.0 110-114 34.21655 38.0 34.4 38.0 24.0 38.0 115-119 33.575450000000004 38.0 34.0 38.0 17.8 38.0 120-124 32.919 37.6 32.6 38.0 15.0 38.0 125-129 32.64314999999999 37.2 32.0 38.0 15.0 38.0 130-134 32.011100000000006 36.4 31.4 38.0 14.2 38.0 135-139 30.600150000000003 35.2 28.0 38.0 13.2 38.0 140-144 29.252750000000002 33.8 25.4 38.0 8.6 38.0 145-149 27.414749999999998 33.0 19.6 38.0 2.0 38.0 150-151 20.723374999999997 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 7.0 4 4.0 5 2.0 6 0.0 7 0.0 8 1.0 9 3.0 10 1.0 11 2.0 12 2.0 13 1.0 14 5.0 15 4.0 16 5.0 17 3.0 18 6.0 19 15.0 20 9.0 21 13.0 22 19.0 23 24.0 24 21.0 25 32.0 26 44.0 27 51.0 28 73.0 29 76.0 30 88.0 31 102.0 32 148.0 33 227.0 34 328.0 35 595.0 36 1047.0 37 1031.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.275 13.725000000000001 12.925 37.075 2 28.849999999999998 19.75 31.324999999999996 20.075000000000003 3 22.05 22.975 29.25 25.724999999999998 4 26.700000000000003 30.825000000000003 19.425 23.05 5 26.6 32.275 20.0 21.125 6 21.75 33.75 21.825 22.675 7 20.1 15.975 38.824999999999996 25.1 8 22.375 20.875 24.4 32.35 9 22.55 21.875 27.474999999999998 28.1 10-14 26.375 24.884999999999998 23.189999999999998 25.55 15-19 26.025 24.474999999999998 25.080000000000002 24.42 20-24 24.990000000000002 25.81 25.14 24.060000000000002 25-29 25.385 25.535000000000004 25.395 23.685000000000002 30-34 25.06 25.69 25.035 24.215 35-39 25.66 25.34 25.355 23.645 40-44 25.19 25.09 25.88 23.84 45-49 25.629999999999995 25.290000000000003 25.805 23.275000000000002 50-54 25.430000000000003 25.275 25.305 23.990000000000002 55-59 26.174999999999997 25.28 25.264999999999997 23.28 60-64 25.869999999999997 25.174999999999997 25.415 23.54 65-69 25.740000000000002 25.685000000000002 25.09 23.485 70-74 25.69 25.419999999999998 25.485000000000003 23.405 75-79 25.580000000000002 25.72 25.085 23.615 80-84 25.535000000000004 25.355 25.585 23.525 85-89 25.285000000000004 25.924999999999997 24.955 23.835 90-94 25.814999999999998 25.369999999999997 25.635 23.18 95-99 26.55 25.165 24.975 23.31 100-104 25.814999999999998 25.525 25.2 23.46 105-109 25.124999999999996 25.665 25.945 23.265 110-114 25.34 25.869999999999997 25.45 23.34 115-119 25.27 25.39 25.679999999999996 23.66 120-124 25.95 25.71 25.52 22.82 125-129 25.869999999999997 26.165 25.419999999999998 22.545 130-134 26.165 26.229999999999997 25.14 22.465 135-139 25.535000000000004 26.47 25.72 22.275 140-144 26.290000000000003 25.695 25.705 22.31 145-149 26.445 25.88 25.665 22.009999999999998 150-151 26.8 25.2375 26.1125 21.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 1.5 27 3.0 28 4.5 29 6.0 30 8.5 31 12.0 32 15.5 33 23.5 34 30.5 35 35.0 36 49.0 37 55.5 38 66.0 39 88.0 40 121.5 41 154.5 42 167.5 43 169.0 44 189.0 45 207.5 46 193.0 47 189.5 48 181.0 49 168.5 50 169.0 51 156.0 52 135.0 53 124.5 54 107.0 55 100.0 56 94.5 57 80.0 58 83.5 59 88.0 60 83.0 61 74.5 62 72.0 63 74.0 64 65.5 65 50.0 66 40.5 67 43.0 68 46.0 69 45.0 70 34.0 71 22.5 72 20.5 73 15.5 74 11.0 75 6.0 76 4.5 77 5.0 78 2.5 79 0.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7312153303076148 1.4500000000000002 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.23750000000000002 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.925 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.3375 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047880 spots for SRR8846535.sra Written 1047880 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra Read 1047878 spots for SRR8846535.sra Written 1047878 spots for SRR8846535.sra SRR ids: ['SRR8846535.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uhzn52sw SRR8846535.sra spots: 20957562 blocks: [[1, 1047878], [1047879, 2095756], [2095757, 3143634], [3143635, 4191512], [4191513, 5239390], [5239391, 6287268], [6287269, 7335146], [7335147, 8383024], [8383025, 9430902], [9430903, 10478780], [10478781, 11526658], [11526659, 12574536], [12574537, 13622414], [13622415, 14670292], [14670293, 15718170], [15718171, 16766048], [16766049, 17813926], [17813927, 18861804], [18861805, 19909682], [19909683, 20957562]] SRR8846535 file size 7080129 SRR8846535 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846535 SRR8846535_1.fastq SRR8846535_2.fastq Input file: SRR8846535_1.fastq Paired file: SRR8846535_2.fastq trimmed: SRR8846535-trimmed-pair1.fastq, SRR8846535-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 08:19:20 2024 >> started Mon Dec 9 08:21:52 2024 >> done (152.320s) 20957562 read pairs processed; of these: 17243 ( 0.08%) short read pairs filtered out after trimming by size control 13712 ( 0.07%) empty read pairs filtered out after trimming by size control 20926607 (99.85%) read pairs available; of these: 12230583 (58.45%) trimmed read pairs available after processing 8696024 (41.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 3 0.00% 21 7 0.00% 22 1 0.00% 23 2 0.00% 24 8 0.00% 25 7 0.00% 26 4 0.00% 27 11 0.00% 28 8 0.00% 29 9 0.00% 30 13 0.00% 31 10 0.00% 32 9 0.00% 33 12 0.00% 34 13 0.00% 35 11 0.00% 36 13 0.00% 37 11 0.00% 38 9 0.00% 39 21 0.00% 40 13 0.00% 41 12 0.00% 42 18 0.00% 43 11 0.00% 44 18 0.00% 45 28 0.00% 46 23 0.00% 47 37 0.00% 48 40 0.00% 49 38 0.00% 50 40 0.00% 51 43 0.00% 52 60 0.00% 53 65 0.00% 54 59 0.00% 55 66 0.00% 56 71 0.00% 57 88 0.00% 58 88 0.00% 59 79 0.00% 60 116 0.00% 61 127 0.00% 62 154 0.00% 63 164 0.00% 64 155 0.00% 65 196 0.00% 66 260 0.00% 67 240 0.00% 68 260 0.00% 69 307 0.00% 70 343 0.00% 71 380 0.00% 72 417 0.00% 73 466 0.00% 74 526 0.00% 75 649 0.00% 76 718 0.00% 77 751 0.00% 78 840 0.00% 79 977 0.00% 80 1116 0.01% 81 1261 0.01% 82 1352 0.01% 83 1635 0.01% 84 2411 0.01% 85 2799 0.01% 86 2891 0.01% 87 3076 0.01% 88 3345 0.02% 89 3480 0.02% 90 3644 0.02% 91 3878 0.02% 92 4236 0.02% 93 4581 0.02% 94 5018 0.02% 95 5410 0.03% 96 5968 0.03% 97 6411 0.03% 98 6788 0.03% 99 7360 0.04% 100 7761 0.04% 101 8464 0.04% 102 8933 0.04% 103 9884 0.05% 104 10437 0.05% 105 10872 0.05% 106 12205 0.06% 107 13115 0.06% 108 13882 0.07% 109 15228 0.07% 110 16088 0.08% 111 16890 0.08% 112 18266 0.09% 113 19550 0.09% 114 20668 0.10% 115 22150 0.11% 116 23490 0.11% 117 24684 0.12% 118 26353 0.13% 119 28017 0.13% 120 30222 0.14% 121 31821 0.15% 122 33493 0.16% 123 35623 0.17% 124 38149 0.18% 125 40763 0.19% 126 42897 0.20% 127 46034 0.22% 128 49226 0.24% 129 52523 0.25% 130 56328 0.27% 131 60436 0.29% 132 64972 0.31% 133 69710 0.33% 134 76307 0.36% 135 82766 0.40% 136 90389 0.43% 137 98743 0.47% 138 109583 0.52% 139 122459 0.59% 140 138473 0.66% 141 156798 0.75% 142 181849 0.87% 143 214907 1.03% 144 257010 1.23% 145 326278 1.56% 146 433261 2.07% 147 603967 2.89% 148 880623 4.21% 149 1611372 7.70% 150 5780868 27.62% 151 8696024 41.55% 20926607 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=6.28 fanout-score-rank=17 prefix-density=0.98 prefix-fanout=1.7 sequence=TCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=166.84 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=13.2 sequence=AGAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCGAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGG criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=4.67 fanout-score-rank=17 prefix-density=0.78 prefix-fanout=3.5 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=53.75 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.0 sequence=GCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR8846535 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 08:26:45 Started mapping on | Dec 09 08:26:46 Finished on | Dec 09 08:38:17 Mapping speed, Million of reads per hour | 109.02 Number of input reads | 20926607 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20580050 Uniquely mapped reads % | 98.34% Average mapped length | 295.48 Number of splices: Total | 23486133 Number of splices: Annotated (sjdb) | 22124615 Number of splices: GT/AG | 23175956 Number of splices: GC/AG | 280751 Number of splices: AT/AC | 11346 Number of splices: Non-canonical | 18080 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 165000 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 15137 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 193160 193160 193160 N_multimapping 165000 165000 165000 N_noFeature 891242 20025245 1055674 N_ambiguous 459956 2918 70306 UnstrandedReadsAssigned:19228852 PositiveStrandReadsAssigned:551887 NegativeStrandReadsAssigned:19454070 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846535 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846535-trimmed-pair1.fastq SRR8846535-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,926,607 reads, 19,505,725 reads pseudoaligned [quant] estimated average fragment length: 269.357 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52973 SRR8846535.ke.tsv 35125 SRR8846535.se.tsv 88098 total ==> SRR8846535.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.2 0.0254891 0.00287047 PNS24247 1044 775.643 64.1469 6.22328 PNS24249 1928 1659.64 35.8573 1.6258 PNS24246 1044 775.643 64.1469 6.22328 PNS24248 1044 775.643 64.1469 6.22328 PNS24244 1471 1202.64 116.676 7.30049 PNS24243 293 82.035 0 0 KQK14069 1603 1334.64 5187.28 292.469 KQK14071 474 222.196 52.193 17.6759 ==> SRR8846535.se.tsv <== BRADI_1g14170v3 5868 BRADI_1g53295v3 137 BRADI_1g59795v3 336 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 2317 BRADI_1g74790v3 162 BRADI_1g09890v3 5 BRADI_1g77505v3 371 BRADI_1g48960v3 0 SRR8846535 completed mapping pipeline successfully