Starting /dee2/code/volunteer_pipeline.sh SRR8846537 current disk space = 1530851500032 free memory = 1346032880 SRR8846537 SRAfilesize 53ae776061fc20c1b7e175316a39aacd SRR8846537.sra SRR8846537.sra file validated SRR8846537 is paired end SRR8846537 is conventional basespace SRR8846537 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846537_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.52825 18.0 18.0 32.0 18.0 33.0 2 29.86575 31.0 27.0 33.0 27.0 33.0 3 30.14425 31.0 29.0 33.0 25.0 33.0 4 31.42375 33.0 32.0 33.0 28.0 33.0 5 32.21625 33.0 32.0 33.0 31.0 33.0 6 37.02 38.0 37.0 38.0 35.0 38.0 7 37.3075 38.0 38.0 38.0 36.0 38.0 8 37.3885 38.0 38.0 38.0 37.0 38.0 9 37.47725 38.0 38.0 38.0 37.0 38.0 10-14 37.260000000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.15285 38.0 38.0 38.0 36.2 38.0 20-24 37.23475 38.0 38.0 38.0 36.4 38.0 25-29 37.4607 38.0 38.0 38.0 37.0 38.0 30-34 37.334050000000005 38.0 38.0 38.0 36.8 38.0 35-39 37.164 38.0 38.0 38.0 36.4 38.0 40-44 36.856350000000006 38.0 38.0 38.0 35.0 38.0 45-49 36.9958 38.0 38.0 38.0 35.4 38.0 50-54 36.94925 38.0 38.0 38.0 35.2 38.0 55-59 36.795550000000006 38.0 38.0 38.0 34.6 38.0 60-64 36.53099999999999 38.0 38.0 38.0 34.0 38.0 65-69 36.53255 38.0 37.6 38.0 34.0 38.0 70-74 36.360699999999994 38.0 37.2 38.0 33.6 38.0 75-79 36.356899999999996 38.0 37.0 38.0 33.6 38.0 80-84 36.1531 38.0 37.0 38.0 32.6 38.0 85-89 35.984899999999996 38.0 36.8 38.0 32.2 38.0 90-94 35.31269999999999 38.0 35.8 38.0 28.8 38.0 95-99 35.27675000000001 38.0 35.8 38.0 29.0 38.0 100-104 35.3467 38.0 35.6 38.0 29.8 38.0 105-109 34.8261 38.0 34.8 38.0 27.0 38.0 110-114 33.88205 37.8 33.8 38.0 21.0 38.0 115-119 33.20255 37.0 32.6 38.0 16.2 38.0 120-124 33.25365 37.0 32.8 38.0 19.0 38.0 125-129 33.03485 36.6 32.6 38.0 17.8 38.0 130-134 31.74785 35.6 29.6 38.0 14.4 38.0 135-139 30.447300000000002 34.8 25.6 38.0 14.0 38.0 140-144 29.770450000000004 35.0 24.4 38.0 13.4 38.0 145-149 28.58415 34.2 23.0 38.0 6.4 38.0 150-151 23.286125 30.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 0.0 19 2.0 20 8.0 21 7.0 22 7.0 23 7.0 24 16.0 25 24.0 26 35.0 27 38.0 28 63.0 29 79.0 30 92.0 31 124.0 32 178.0 33 288.0 34 469.0 35 733.0 36 1195.0 37 630.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.70297290186793 21.441725861615364 8.445146014206788 41.41015522230992 2 24.025 22.1 32.300000000000004 21.575 3 19.375 28.449999999999996 24.675 27.500000000000004 4 24.175 31.5 22.275 22.05 5 24.60615153788447 33.4333583395849 22.355588897224308 19.604901225306325 6 18.325 33.900000000000006 24.875 22.900000000000002 7 15.65 21.05 42.675000000000004 20.625 8 21.025 21.025 28.475 29.475 9 18.325 20.7 33.025 27.950000000000003 10-14 22.64 26.555 24.349999999999998 26.455000000000002 15-19 21.82 26.369999999999997 26.195 25.615 20-24 21.915000000000003 26.365 26.58 25.14 25-29 21.349999999999998 26.974999999999998 26.369999999999997 25.305 30-34 21.815 26.515 26.21 25.46 35-39 21.895 26.865 25.735000000000003 25.505 40-44 21.87 26.19 26.375 25.564999999999998 45-49 22.259999999999998 26.61 26.075 25.055 50-54 22.16 26.08 26.08 25.679999999999996 55-59 22.32 26.215 26.169999999999998 25.295 60-64 22.275 26.02 25.924999999999997 25.779999999999998 65-69 22.255 26.16 26.36 25.224999999999998 70-74 22.13 25.990000000000002 25.935000000000002 25.945 75-79 22.61 26.35 25.7 25.34 80-84 22.650000000000002 25.825 26.215 25.31 85-89 22.49 26.179999999999996 25.72 25.61 90-94 22.74 25.695 26.27 25.295 95-99 22.375 26.44 26.224999999999998 24.959999999999997 100-104 22.095000000000002 26.275 26.150000000000002 25.480000000000004 105-109 23.025000000000002 25.905 25.679999999999996 25.39 110-114 23.24 25.759999999999998 25.990000000000002 25.009999999999998 115-119 23.015 25.674999999999997 25.724999999999998 25.585 120-124 22.465 26.265 25.840000000000003 25.430000000000003 125-129 23.035 25.85 25.845000000000002 25.27 130-134 23.51 25.575 25.974999999999998 24.94 135-139 22.895 25.540000000000003 25.974999999999998 25.590000000000003 140-144 22.835 26.290000000000003 26.045 24.83 145-149 23.13 24.91 26.290000000000003 25.669999999999998 150-151 23.625 25.2625 26.2875 24.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.5 27 4.0 28 4.0 29 4.0 30 11.5 31 15.5 32 16.0 33 26.0 34 36.5 35 45.5 36 50.0 37 71.0 38 101.5 39 118.0 40 142.0 41 170.0 42 195.0 43 208.5 44 218.0 45 223.0 46 229.0 47 233.5 48 205.5 49 185.0 50 178.5 51 154.0 52 126.0 53 114.5 54 111.5 55 92.0 56 68.5 57 64.5 58 64.0 59 65.5 60 62.0 61 52.0 62 48.5 63 45.5 64 43.0 65 38.0 66 36.0 67 28.5 68 18.0 69 17.5 70 15.5 71 11.0 72 9.0 73 7.5 74 5.5 75 3.0 76 1.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.5875 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7749999999999999 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.1124999999999998 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.5125 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.9249999999999998 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGACG 10 0.0068396386 144.9375 145 >>END_MODULE SRR8846537 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846537_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65175 33.0 33.0 34.0 32.0 34.0 2 32.603 33.0 33.0 34.0 32.0 34.0 3 32.757 33.0 33.0 34.0 32.0 34.0 4 32.70925 33.0 33.0 34.0 32.0 34.0 5 32.738 33.0 33.0 34.0 32.0 34.0 6 36.933 38.0 38.0 38.0 36.0 38.0 7 36.8685 38.0 38.0 38.0 35.0 38.0 8 36.94575 38.0 38.0 38.0 36.0 38.0 9 36.98675 38.0 38.0 38.0 36.0 38.0 10-14 36.932249999999996 38.0 38.0 38.0 35.8 38.0 15-19 36.9382 38.0 38.0 38.0 36.0 38.0 20-24 36.934749999999994 38.0 38.0 38.0 35.8 38.0 25-29 36.76915 38.0 38.0 38.0 35.0 38.0 30-34 36.73395000000001 38.0 38.0 38.0 35.0 38.0 35-39 36.76975 38.0 38.0 38.0 35.2 38.0 40-44 36.70195 38.0 38.0 38.0 35.0 38.0 45-49 36.61815 38.0 38.0 38.0 34.8 38.0 50-54 36.28339999999999 38.0 38.0 38.0 33.6 38.0 55-59 36.19425 38.0 38.0 38.0 33.2 38.0 60-64 36.25435 38.0 37.8 38.0 33.4 38.0 65-69 36.452650000000006 38.0 38.0 38.0 34.0 38.0 70-74 36.1827 38.0 37.4 38.0 33.2 38.0 75-79 35.824149999999996 38.0 37.0 38.0 31.4 38.0 80-84 35.95145 38.0 37.0 38.0 32.6 38.0 85-89 35.726549999999996 38.0 36.6 38.0 31.0 38.0 90-94 35.481350000000006 38.0 36.2 38.0 30.0 38.0 95-99 35.07655 38.0 35.6 38.0 28.4 38.0 100-104 34.63815 38.0 35.0 38.0 26.2 38.0 105-109 34.734249999999996 38.0 34.8 38.0 27.0 38.0 110-114 34.318799999999996 38.0 34.2 38.0 24.6 38.0 115-119 33.807249999999996 38.0 34.0 38.0 21.4 38.0 120-124 32.9925 37.4 32.8 38.0 15.0 38.0 125-129 32.883050000000004 37.4 32.2 38.0 15.0 38.0 130-134 32.12145 36.4 31.4 38.0 14.2 38.0 135-139 30.82945 35.0 28.8 38.0 13.4 38.0 140-144 29.49035 33.6 25.6 38.0 12.2 38.0 145-149 27.7108 33.0 20.6 38.0 2.0 38.0 150-151 20.896124999999998 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 7.0 4 1.0 5 2.0 6 0.0 7 1.0 8 1.0 9 2.0 10 2.0 11 1.0 12 1.0 13 2.0 14 1.0 15 1.0 16 7.0 17 5.0 18 4.0 19 10.0 20 10.0 21 10.0 22 14.0 23 23.0 24 25.0 25 23.0 26 36.0 27 43.0 28 62.0 29 65.0 30 102.0 31 120.0 32 157.0 33 244.0 34 346.0 35 593.0 36 1091.0 37 985.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.15 14.674999999999999 12.925 36.25 2 28.425 19.425 33.15 19.0 3 22.35 23.674999999999997 28.775000000000002 25.2 4 26.674999999999997 31.525 19.8 22.0 5 27.800000000000004 31.8 20.200000000000003 20.200000000000003 6 20.674999999999997 34.425 22.325 22.575 7 20.25 16.05 39.574999999999996 24.125 8 22.225 21.349999999999998 25.7 30.725 9 22.85 21.95 26.35 28.849999999999998 10-14 25.75 25.0 23.605 25.645 15-19 25.419999999999998 25.264999999999997 25.41 23.905 20-24 25.365 25.979999999999997 25.15 23.505000000000003 25-29 25.345000000000002 25.990000000000002 24.3 24.365000000000002 30-34 25.380000000000003 25.52 24.97 24.13 35-39 25.365 25.255 25.45 23.93 40-44 25.88 25.845000000000002 24.755 23.52 45-49 25.75 25.3 25.06 23.89 50-54 25.16 25.540000000000003 25.44 23.86 55-59 25.41 25.52 25.585 23.485 60-64 25.490000000000002 25.365 25.36 23.785 65-69 25.34 26.345000000000002 24.57 23.745 70-74 25.874999999999996 25.3 25.53 23.294999999999998 75-79 25.185000000000002 25.96 25.495 23.36 80-84 25.679999999999996 26.169999999999998 25.34 22.81 85-89 25.795 25.88 25.235000000000003 23.09 90-94 25.569999999999997 25.259999999999998 26.105 23.064999999999998 95-99 25.825 25.865 25.385 22.925 100-104 26.090000000000003 26.13 25.259999999999998 22.52 105-109 25.480000000000004 25.259999999999998 26.27 22.99 110-114 25.3 25.825 25.905 22.97 115-119 25.424999999999997 26.595000000000002 25.305 22.675 120-124 25.624999999999996 26.215 25.650000000000002 22.509999999999998 125-129 25.5 25.629999999999995 25.61 23.26 130-134 25.924999999999997 26.07 25.465 22.54 135-139 25.955000000000002 25.965 25.674999999999997 22.405 140-144 26.165 26.435 25.5 21.9 145-149 25.75 26.08 25.740000000000002 22.43 150-151 25.4 26.3 25.974999999999998 22.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 2.0 27 2.0 28 4.5 29 6.0 30 8.0 31 8.5 32 10.0 33 15.0 34 19.0 35 27.0 36 37.0 37 58.0 38 84.0 39 105.0 40 128.0 41 146.5 42 162.0 43 183.0 44 202.0 45 203.5 46 216.0 47 212.5 48 197.0 49 187.5 50 160.0 51 142.5 52 145.5 53 139.0 54 120.5 55 98.0 56 86.5 57 80.0 58 75.0 59 78.5 60 67.5 61 65.5 62 67.0 63 66.0 64 59.0 65 45.0 66 43.5 67 48.5 68 42.0 69 33.0 70 32.0 71 22.0 72 14.0 73 15.0 74 10.5 75 7.0 76 5.5 77 2.5 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8500000000000001 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.3875 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.4875 0.0 0.0 0.0 0.0 138-139 2.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246304 spots for SRR8846537.sra Written 1246304 spots for SRR8846537.sra Read 1246315 spots for SRR8846537.sra Written 1246315 spots for SRR8846537.sra SRR ids: ['SRR8846537.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rl1qol76 SRR8846537.sra spots: 24926091 blocks: [[1, 1246304], [1246305, 2492608], [2492609, 3738912], [3738913, 4985216], [4985217, 6231520], [6231521, 7477824], [7477825, 8724128], [8724129, 9970432], [9970433, 11216736], [11216737, 12463040], [12463041, 13709344], [13709345, 14955648], [14955649, 16201952], [16201953, 17448256], [17448257, 18694560], [18694561, 19940864], [19940865, 21187168], [21187169, 22433472], [22433473, 23679776], [23679777, 24926091]] SRR8846537 file size 8424933 SRR8846537 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846537 SRR8846537_1.fastq SRR8846537_2.fastq Input file: SRR8846537_1.fastq Paired file: SRR8846537_2.fastq trimmed: SRR8846537-trimmed-pair1.fastq, SRR8846537-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 08:55:18 2024 >> started Mon Dec 9 08:57:30 2024 >> done (131.450s) 24926091 read pairs processed; of these: 17790 ( 0.07%) short read pairs filtered out after trimming by size control 12970 ( 0.05%) empty read pairs filtered out after trimming by size control 24895331 (99.88%) read pairs available; of these: 14355032 (57.66%) trimmed read pairs available after processing 10540299 (42.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 3 0.00% 21 7 0.00% 22 6 0.00% 23 7 0.00% 24 4 0.00% 25 8 0.00% 26 3 0.00% 27 9 0.00% 28 10 0.00% 29 17 0.00% 30 7 0.00% 31 8 0.00% 32 6 0.00% 33 8 0.00% 34 13 0.00% 35 6 0.00% 36 7 0.00% 37 12 0.00% 38 17 0.00% 39 9 0.00% 40 13 0.00% 41 15 0.00% 42 20 0.00% 43 13 0.00% 44 17 0.00% 45 33 0.00% 46 14 0.00% 47 25 0.00% 48 30 0.00% 49 35 0.00% 50 40 0.00% 51 35 0.00% 52 60 0.00% 53 53 0.00% 54 33 0.00% 55 50 0.00% 56 65 0.00% 57 70 0.00% 58 77 0.00% 59 91 0.00% 60 118 0.00% 61 107 0.00% 62 131 0.00% 63 144 0.00% 64 159 0.00% 65 188 0.00% 66 176 0.00% 67 243 0.00% 68 226 0.00% 69 259 0.00% 70 305 0.00% 71 331 0.00% 72 368 0.00% 73 432 0.00% 74 482 0.00% 75 525 0.00% 76 595 0.00% 77 650 0.00% 78 729 0.00% 79 822 0.00% 80 943 0.00% 81 1109 0.00% 82 1226 0.00% 83 1427 0.01% 84 2166 0.01% 85 2720 0.01% 86 2780 0.01% 87 2864 0.01% 88 3081 0.01% 89 3156 0.01% 90 3321 0.01% 91 3581 0.01% 92 3847 0.02% 93 4043 0.02% 94 4410 0.02% 95 4884 0.02% 96 5161 0.02% 97 5557 0.02% 98 5888 0.02% 99 6404 0.03% 100 6789 0.03% 101 7280 0.03% 102 7881 0.03% 103 8478 0.03% 104 9112 0.04% 105 9643 0.04% 106 10791 0.04% 107 11530 0.05% 108 12275 0.05% 109 13087 0.05% 110 14019 0.06% 111 14973 0.06% 112 16073 0.06% 113 17325 0.07% 114 18552 0.07% 115 19974 0.08% 116 21197 0.09% 117 22296 0.09% 118 24098 0.10% 119 25976 0.10% 120 27610 0.11% 121 29554 0.12% 122 31792 0.13% 123 33402 0.13% 124 36029 0.14% 125 38654 0.16% 126 41311 0.17% 127 43964 0.18% 128 47959 0.19% 129 51477 0.21% 130 55620 0.22% 131 60562 0.24% 132 66303 0.27% 133 71683 0.29% 134 78879 0.32% 135 86448 0.35% 136 96709 0.39% 137 105906 0.43% 138 119055 0.48% 139 134455 0.54% 140 152344 0.61% 141 175577 0.71% 142 205141 0.82% 143 244913 0.98% 144 298681 1.20% 145 381627 1.53% 146 515077 2.07% 147 726143 2.92% 148 1065500 4.28% 149 1959821 7.87% 150 7004958 28.14% 151 10540299 42.34% 24895331 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=11 prefix-density=0.56 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=123.13 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=15.1 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=29 prefix-density=0.55 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=41.49 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.2 sequence=AAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGT SRR8846537 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 09:00:57 Started mapping on | Dec 09 09:00:57 Finished on | Dec 09 09:08:24 Mapping speed, Million of reads per hour | 200.50 Number of input reads | 24895331 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 24468157 Uniquely mapped reads % | 98.28% Average mapped length | 296.28 Number of splices: Total | 28747640 Number of splices: Annotated (sjdb) | 27081403 Number of splices: GT/AG | 28351886 Number of splices: GC/AG | 359505 Number of splices: AT/AC | 15041 Number of splices: Non-canonical | 21208 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.01% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 225047 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 10615 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 214131 214131 214131 N_multimapping 225047 225047 225047 N_noFeature 876117 23825384 1058148 N_ambiguous 546883 3571 86152 UnstrandedReadsAssigned:23045157 PositiveStrandReadsAssigned:639202 NegativeStrandReadsAssigned:23323857 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846537 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846537-trimmed-pair1.fastq SRR8846537-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,895,331 reads, 23,432,780 reads pseudoaligned [quant] estimated average fragment length: 280.503 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR8846537.ke.tsv 35125 SRR8846537.se.tsv 88098 total ==> SRR8846537.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.981 0 0 PNS24247 1044 764.497 107.426 8.67628 PNS24249 1928 1648.5 55.4727 2.07774 PNS24246 1044 764.497 107.426 8.67628 PNS24248 1044 764.497 107.426 8.67628 PNS24244 1471 1191.5 86.2487 4.4695 PNS24243 293 75.7131 0 0 KQK14069 1603 1323.5 19114.9 891.759 KQK14071 474 211.285 223.235 65.2366 ==> SRR8846537.se.tsv <== BRADI_1g14170v3 21191 BRADI_1g53295v3 166 BRADI_1g59795v3 940 BRADI_1g07683v3 0 BRADI_1g00485v3 103 BRADI_1g20270v3 4188 BRADI_1g74790v3 162 BRADI_1g09890v3 6 BRADI_1g77505v3 444 BRADI_1g48960v3 0 SRR8846537 completed mapping pipeline successfully