Starting /dee2/code/volunteer_pipeline.sh SRR8846538 current disk space = 2792277929984 free memory = 1543661888 SRR8846538 SRAfilesize 9f4f7d48295f1a4b37ca8d11a1620bf5 SRR8846538.sra SRR8846538.sra file validated SRR8846538 is paired end SRR8846538 is conventional basespace SRR8846538 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846538_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.71775 18.0 18.0 31.0 18.0 33.0 2 30.2735 32.0 27.0 33.0 27.0 33.0 3 30.70675 31.0 29.0 33.0 27.0 33.0 4 32.08175 33.0 31.0 33.0 29.0 34.0 5 32.6745 33.0 33.0 33.0 32.0 34.0 6 36.91525 38.0 37.0 38.0 35.0 38.0 7 37.3105 38.0 38.0 38.0 36.0 38.0 8 37.28725 38.0 38.0 38.0 37.0 38.0 9 37.435 38.0 38.0 38.0 37.0 38.0 10-14 37.2975 38.0 38.0 38.0 36.6 38.0 15-19 37.1114 38.0 38.0 38.0 36.0 38.0 20-24 37.123200000000004 38.0 38.0 38.0 36.0 38.0 25-29 37.29695 38.0 38.0 38.0 37.0 38.0 30-34 37.18589999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.991749999999996 38.0 38.0 38.0 35.6 38.0 40-44 36.6383 38.0 38.0 38.0 34.2 38.0 45-49 36.5404 38.0 38.0 38.0 33.8 38.0 50-54 36.802800000000005 38.0 38.0 38.0 34.6 38.0 55-59 36.618700000000004 38.0 38.0 38.0 34.0 38.0 60-64 36.240249999999996 38.0 37.4 38.0 32.8 38.0 65-69 36.11985 38.0 37.0 38.0 32.0 38.0 70-74 35.910849999999996 38.0 37.0 38.0 30.6 38.0 75-79 36.05425 38.0 36.8 38.0 31.8 38.0 80-84 35.975 38.0 36.8 38.0 31.8 38.0 85-89 35.6169 38.0 36.0 38.0 30.2 38.0 90-94 34.8803 38.0 35.0 38.0 27.4 38.0 95-99 34.7699 38.0 35.0 38.0 26.4 38.0 100-104 35.06794999999999 38.0 35.0 38.0 28.2 38.0 105-109 34.4885 38.0 34.4 38.0 25.8 38.0 110-114 32.945299999999996 37.0 31.6 38.0 16.6 38.0 115-119 32.480199999999996 36.2 30.6 38.0 15.0 38.0 120-124 32.99315 37.0 32.6 38.0 15.0 38.0 125-129 32.667449999999995 36.6 32.0 38.0 15.0 38.0 130-134 31.2437 35.4 28.2 38.0 14.2 38.0 135-139 29.61225 34.6 24.2 38.0 13.6 38.0 140-144 28.94165 34.2 22.8 38.0 13.0 38.0 145-149 27.577499999999997 33.8 18.8 38.0 2.0 38.0 150-151 22.177500000000002 28.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 2.0 19 4.0 20 4.0 21 3.0 22 13.0 23 16.0 24 24.0 25 27.0 26 38.0 27 49.0 28 68.0 29 89.0 30 117.0 31 165.0 32 241.0 33 320.0 34 472.0 35 808.0 36 1045.0 37 490.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.14621409921671 14.490861618798956 17.650130548302872 39.712793733681465 2 24.575 20.225 35.025 20.175 3 20.95 25.3 26.474999999999998 27.275 4 25.55 30.65 21.6 22.2 5 24.20605151287822 33.80845211302826 22.58064516129032 19.4048512128032 6 18.6 33.800000000000004 24.3 23.3 7 16.900000000000002 18.325 41.65 23.125 8 20.150000000000002 20.724999999999998 27.725 31.4 9 19.275000000000002 20.575 30.825000000000003 29.325000000000003 10-14 23.14 25.965 24.555 26.340000000000003 15-19 22.335 25.31 26.38 25.974999999999998 20-24 22.009999999999998 26.31 26.605 25.074999999999996 25-29 22.85 25.605 26.1 25.445 30-34 23.105 25.715 25.8 25.380000000000003 35-39 22.115000000000002 26.650000000000002 26.41 24.825 40-44 22.535 25.814999999999998 25.945 25.705 45-49 22.225 26.334999999999997 25.735000000000003 25.705 50-54 23.09 25.275 26.35 25.285000000000004 55-59 22.46 25.990000000000002 25.81 25.740000000000002 60-64 22.59 25.45 26.035000000000004 25.924999999999997 65-69 22.62 26.090000000000003 25.88 25.41 70-74 23.03 25.28 26.040000000000003 25.650000000000002 75-79 22.720000000000002 25.8 25.69 25.790000000000003 80-84 22.7 25.740000000000002 26.345000000000002 25.215 85-89 22.564999999999998 25.919999999999998 25.365 26.150000000000002 90-94 23.3 26.045 25.545 25.11 95-99 23.39 25.369999999999997 26.045 25.195 100-104 23.055 25.36 25.935000000000002 25.650000000000002 105-109 23.055 25.575 26.345000000000002 25.025 110-114 22.785 25.755 25.965 25.495 115-119 23.599999999999998 25.795 25.374999999999996 25.230000000000004 120-124 23.215 25.41 26.22 25.155 125-129 23.115 25.174999999999997 26.224999999999998 25.485000000000003 130-134 23.07 26.05 25.88 25.0 135-139 24.345 24.91 25.745 25.0 140-144 23.919999999999998 25.165 25.929999999999996 24.985 145-149 23.01 25.685000000000002 25.445 25.86 150-151 23.65 25.874999999999996 25.387500000000003 25.087500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 4.5 28 5.5 29 5.5 30 7.5 31 13.0 32 20.0 33 20.0 34 29.0 35 40.5 36 51.0 37 69.5 38 95.0 39 120.5 40 129.0 41 164.0 42 199.5 43 197.5 44 188.5 45 200.0 46 221.5 47 218.0 48 200.5 49 168.0 50 166.5 51 161.5 52 139.0 53 133.0 54 115.5 55 94.0 56 79.5 57 79.5 58 76.0 59 66.0 60 58.0 61 61.0 62 61.5 63 51.0 64 45.0 65 47.0 66 43.5 67 31.0 68 27.5 69 26.5 70 17.5 71 11.5 72 12.0 73 12.0 74 7.0 75 3.5 76 1.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.25 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.8 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.45 0.0 0.0 0.0 0.0 136-137 2.6625 0.0 0.0 0.0 0.0 138-139 2.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATGTT 10 0.0068378756 144.95 3 CATGTTG 10 0.0068378756 144.95 4 TTGCTGG 10 0.0068378756 144.95 8 ATGTTGC 30 0.0017998101 72.475006 5 >>END_MODULE SRR8846538 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846538_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.734 33.0 33.0 34.0 32.0 34.0 2 32.87 33.0 33.0 34.0 32.0 34.0 3 32.84625 34.0 33.0 34.0 32.0 34.0 4 32.8175 34.0 33.0 34.0 32.0 34.0 5 32.77775 34.0 33.0 34.0 32.0 34.0 6 37.014 38.0 38.0 38.0 36.0 38.0 7 37.006 38.0 38.0 38.0 36.0 38.0 8 37.09025 38.0 38.0 38.0 36.0 38.0 9 37.027 38.0 38.0 38.0 36.0 38.0 10-14 36.9902 38.0 38.0 38.0 36.0 38.0 15-19 37.0475 38.0 38.0 38.0 36.0 38.0 20-24 37.05485 38.0 38.0 38.0 36.0 38.0 25-29 36.9048 38.0 38.0 38.0 35.6 38.0 30-34 36.7335 38.0 38.0 38.0 34.8 38.0 35-39 36.87495 38.0 38.0 38.0 35.4 38.0 40-44 36.8149 38.0 38.0 38.0 35.2 38.0 45-49 36.58895 38.0 38.0 38.0 34.4 38.0 50-54 36.43235 38.0 38.0 38.0 33.8 38.0 55-59 36.16175 38.0 37.8 38.0 32.8 38.0 60-64 36.429199999999994 38.0 38.0 38.0 33.8 38.0 65-69 36.48015 38.0 38.0 38.0 34.2 38.0 70-74 36.2573 38.0 37.6 38.0 33.2 38.0 75-79 35.922000000000004 38.0 37.0 38.0 31.8 38.0 80-84 36.13055000000001 38.0 37.2 38.0 33.2 38.0 85-89 36.08345 38.0 37.0 38.0 33.0 38.0 90-94 35.64960000000001 38.0 36.6 38.0 30.6 38.0 95-99 35.01785 38.0 35.4 38.0 27.8 38.0 100-104 35.0037 38.0 35.0 38.0 28.0 38.0 105-109 35.0244 38.0 35.2 38.0 27.8 38.0 110-114 34.46385 38.0 34.6 38.0 25.8 38.0 115-119 33.9792 38.0 34.0 38.0 22.6 38.0 120-124 33.27635 37.8 33.4 38.0 16.2 38.0 125-129 33.22279999999999 38.0 33.4 38.0 18.6 38.0 130-134 32.46095 36.4 32.0 38.0 14.6 38.0 135-139 31.49475 35.8 31.0 38.0 13.4 38.0 140-144 29.847199999999997 34.0 26.6 38.0 12.6 38.0 145-149 28.46325 33.6 24.4 38.0 2.0 38.0 150-151 21.768124999999998 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 2.0 5 1.0 6 3.0 7 1.0 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 3.0 14 3.0 15 1.0 16 4.0 17 2.0 18 4.0 19 6.0 20 10.0 21 16.0 22 10.0 23 19.0 24 28.0 25 29.0 26 33.0 27 39.0 28 50.0 29 68.0 30 101.0 31 115.0 32 160.0 33 188.0 34 344.0 35 562.0 36 1075.0 37 1117.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.775000000000006 13.825000000000001 12.5 36.9 2 29.2 18.5 32.375 19.925 3 23.549999999999997 21.95 30.025000000000002 24.474999999999998 4 26.5 30.099999999999998 19.775000000000002 23.625 5 28.775000000000002 32.45 19.575 19.2 6 20.65 34.4 21.4 23.549999999999997 7 20.825 15.525 39.0 24.65 8 23.575 20.025000000000002 23.724999999999998 32.675 9 22.825 21.25 27.250000000000004 28.675 10-14 26.490000000000002 24.635 23.025000000000002 25.85 15-19 25.074999999999996 24.815 25.424999999999997 24.685000000000002 20-24 25.41 25.569999999999997 24.36 24.66 25-29 25.130000000000003 24.73 24.82 25.319999999999997 30-34 25.805 25.245 25.095 23.855 35-39 25.665 26.02 24.27 24.044999999999998 40-44 25.080000000000002 25.345000000000002 25.06 24.515 45-49 25.865 25.45 24.8 23.885 50-54 25.97 25.77 24.58 23.68 55-59 26.145000000000003 25.45 25.009999999999998 23.395 60-64 25.505 25.7 25.290000000000003 23.505000000000003 65-69 25.855 25.4 24.875 23.87 70-74 25.929999999999996 26.005 24.54 23.525 75-79 25.324999999999996 25.735000000000003 25.509999999999998 23.43 80-84 26.1 25.195 25.324999999999996 23.380000000000003 85-89 25.89 25.245 25.485000000000003 23.380000000000003 90-94 25.885 25.365 25.074999999999996 23.674999999999997 95-99 26.095000000000002 26.0 24.855 23.05 100-104 25.97 25.419999999999998 25.69 22.919999999999998 105-109 25.495 25.77 24.935 23.799999999999997 110-114 25.855 26.205000000000002 24.795 23.145 115-119 26.090000000000003 25.535000000000004 24.905 23.47 120-124 25.655 25.679999999999996 25.195 23.47 125-129 25.735000000000003 26.08 25.16 23.025000000000002 130-134 25.480000000000004 26.290000000000003 25.019999999999996 23.21 135-139 25.724999999999998 26.029999999999998 25.324999999999996 22.919999999999998 140-144 26.465 25.94 24.69 22.905 145-149 26.145000000000003 25.564999999999998 25.124999999999996 23.165 150-151 27.150000000000002 26.025 25.6 21.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 2.0 27 1.5 28 4.0 29 7.0 30 8.5 31 12.0 32 13.0 33 14.5 34 19.0 35 26.0 36 38.5 37 46.0 38 69.0 39 94.5 40 106.5 41 136.0 42 161.5 43 168.5 44 171.5 45 190.5 46 199.5 47 200.5 48 208.5 49 186.0 50 164.5 51 159.0 52 133.0 53 118.5 54 128.5 55 115.5 56 90.5 57 84.0 58 88.5 59 86.0 60 83.0 61 94.0 62 92.5 63 75.5 64 60.5 65 59.5 66 53.5 67 45.5 68 41.5 69 29.5 70 27.0 71 25.5 72 19.5 73 14.0 74 9.0 75 4.0 76 2.0 77 2.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.9125 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.425 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.2 0.0 0.0 0.0 0.0 134-135 2.5374999999999996 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306475 spots for SRR8846538.sra Written 1306475 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra Read 1306467 spots for SRR8846538.sra Written 1306467 spots for SRR8846538.sra SRR ids: ['SRR8846538.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__hc1wscp SRR8846538.sra spots: 26129348 blocks: [[1, 1306467], [1306468, 2612934], [2612935, 3919401], [3919402, 5225868], [5225869, 6532335], [6532336, 7838802], [7838803, 9145269], [9145270, 10451736], [10451737, 11758203], [11758204, 13064670], [13064671, 14371137], [14371138, 15677604], [15677605, 16984071], [16984072, 18290538], [18290539, 19597005], [19597006, 20903472], [20903473, 22209939], [22209940, 23516406], [23516407, 24822873], [24822874, 26129348]] SRR8846538 file size 8832678 SRR8846538 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846538 SRR8846538_1.fastq SRR8846538_2.fastq Input file: SRR8846538_1.fastq Paired file: SRR8846538_2.fastq trimmed: SRR8846538-trimmed-pair1.fastq, SRR8846538-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Mar 17 02:04:39 2025 >> started Mon Mar 17 02:05:24 2025 >> done (45.424s) 26129348 read pairs processed; of these: 16699 ( 0.06%) short read pairs filtered out after trimming by size control 11617 ( 0.04%) empty read pairs filtered out after trimming by size control 26101032 (99.89%) read pairs available; of these: 14784205 (56.64%) trimmed read pairs available after processing 11316827 (43.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 15 0.00% 20 12 0.00% 21 12 0.00% 22 9 0.00% 23 12 0.00% 24 11 0.00% 25 16 0.00% 26 15 0.00% 27 22 0.00% 28 9 0.00% 29 7 0.00% 30 14 0.00% 31 12 0.00% 32 14 0.00% 33 7 0.00% 34 15 0.00% 35 8 0.00% 36 12 0.00% 37 14 0.00% 38 24 0.00% 39 22 0.00% 40 24 0.00% 41 20 0.00% 42 26 0.00% 43 30 0.00% 44 21 0.00% 45 32 0.00% 46 30 0.00% 47 39 0.00% 48 32 0.00% 49 37 0.00% 50 36 0.00% 51 45 0.00% 52 61 0.00% 53 63 0.00% 54 59 0.00% 55 93 0.00% 56 80 0.00% 57 105 0.00% 58 94 0.00% 59 109 0.00% 60 134 0.00% 61 129 0.00% 62 157 0.00% 63 157 0.00% 64 183 0.00% 65 196 0.00% 66 238 0.00% 67 249 0.00% 68 321 0.00% 69 328 0.00% 70 397 0.00% 71 410 0.00% 72 448 0.00% 73 556 0.00% 74 594 0.00% 75 709 0.00% 76 851 0.00% 77 884 0.00% 78 932 0.00% 79 1093 0.00% 80 1176 0.00% 81 1346 0.01% 82 1536 0.01% 83 1833 0.01% 84 2633 0.01% 85 3121 0.01% 86 3349 0.01% 87 3593 0.01% 88 3669 0.01% 89 4050 0.02% 90 4001 0.02% 91 4521 0.02% 92 4843 0.02% 93 5106 0.02% 94 5797 0.02% 95 6048 0.02% 96 6635 0.03% 97 6975 0.03% 98 7624 0.03% 99 8158 0.03% 100 8798 0.03% 101 9242 0.04% 102 9815 0.04% 103 10581 0.04% 104 11321 0.04% 105 12353 0.05% 106 13491 0.05% 107 14218 0.05% 108 14799 0.06% 109 16303 0.06% 110 17277 0.07% 111 18513 0.07% 112 19714 0.08% 113 20962 0.08% 114 21962 0.08% 115 23720 0.09% 116 25052 0.10% 117 26781 0.10% 118 28265 0.11% 119 30238 0.12% 120 31961 0.12% 121 34267 0.13% 122 36363 0.14% 123 38236 0.15% 124 41162 0.16% 125 43888 0.17% 126 46278 0.18% 127 50178 0.19% 128 53592 0.21% 129 58215 0.22% 130 62299 0.24% 131 66800 0.26% 132 72862 0.28% 133 79636 0.31% 134 85501 0.33% 135 93669 0.36% 136 102758 0.39% 137 112851 0.43% 138 126262 0.48% 139 142295 0.55% 140 161380 0.62% 141 182673 0.70% 142 213361 0.82% 143 250997 0.96% 144 301414 1.15% 145 376262 1.44% 146 495817 1.90% 147 699549 2.68% 148 1021009 3.91% 149 1942048 7.44% 150 7310909 28.01% 151 11316827 43.36% 26101032 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=14 prefix-density=0.58 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=154.19 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.1 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCA criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=29 prefix-density=0.56 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=142.80 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.0 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGA SRR8846538 testing PE reads STAR mapping to Ensembl genome Started job on | Mar 17 02:06:05 Started mapping on | Mar 17 02:06:05 Finished on | Mar 17 02:07:56 Mapping speed, Million of reads per hour | 846.52 Number of input reads | 26101032 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 25701841 Uniquely mapped reads % | 98.47% Average mapped length | 296.04 Number of splices: Total | 29217794 Number of splices: Annotated (sjdb) | 27512136 Number of splices: GT/AG | 28845317 Number of splices: GC/AG | 335859 Number of splices: AT/AC | 15986 Number of splices: Non-canonical | 20632 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231849 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 13166 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.28% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 179065 179065 179065 N_multimapping 231849 231849 231849 N_noFeature 865236 25005869 1072401 N_ambiguous 569296 3908 81048 UnstrandedReadsAssigned:24267309 PositiveStrandReadsAssigned:692064 NegativeStrandReadsAssigned:24548392 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR8846538 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846538-trimmed-pair1.fastq SRR8846538-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,101,032 reads, 24,645,756 reads pseudoaligned [quant] estimated average fragment length: 280.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR8846538.ke.tsv 35125 SRR8846538.se.tsv 88098 total ==> SRR8846538.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 657.034 0 0 PNS24247 1044 764.371 112.557 8.56013 PNS24249 1928 1648.37 48.1396 1.6977 PNS24246 1044 764.371 112.557 8.56013 PNS24248 1044 764.371 112.557 8.56013 PNS24244 1471 1191.37 39.1902 1.91225 PNS24243 293 78.3695 0 0 KQK14069 1603 1323.37 13542.6 594.887 KQK14071 474 213.841 169.683 46.1276 ==> SRR8846538.se.tsv <== BRADI_1g14170v3 15177 BRADI_1g53295v3 154 BRADI_1g59795v3 1021 BRADI_1g07683v3 0 BRADI_1g00485v3 101 BRADI_1g20270v3 5467 BRADI_1g74790v3 133 BRADI_1g09890v3 2 BRADI_1g77505v3 426 BRADI_1g48960v3 0 SRR8846538 completed mapping pipeline successfully