Starting /dee2/code/volunteer_pipeline.sh SRR8846539 current disk space = 1530761084928 free memory = 1608053460 SRR8846539 SRAfilesize ce45ff2e6636e0beda97600714ca0c31 SRR8846539.sra SRR8846539.sra file validated SRR8846539 is paired end SRR8846539 is conventional basespace SRR8846539 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846539_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.5095 25.0 18.0 32.0 18.0 33.0 2 30.2525 31.0 29.0 33.0 27.0 33.0 3 31.07325 33.0 31.0 33.0 27.0 33.0 4 31.83075 33.0 32.0 33.0 30.0 33.0 5 31.39775 33.0 32.0 33.0 28.0 33.0 6 36.5025 38.0 37.0 38.0 34.0 38.0 7 36.881 38.0 38.0 38.0 35.0 38.0 8 37.18275 38.0 38.0 38.0 36.0 38.0 9 37.34325 38.0 38.0 38.0 37.0 38.0 10-14 37.217549999999996 38.0 38.0 38.0 36.2 38.0 15-19 37.089999999999996 38.0 38.0 38.0 36.0 38.0 20-24 37.13255 38.0 38.0 38.0 36.0 38.0 25-29 37.3488 38.0 38.0 38.0 37.0 38.0 30-34 37.3071 38.0 38.0 38.0 36.8 38.0 35-39 37.123749999999994 38.0 38.0 38.0 36.2 38.0 40-44 36.87655 38.0 38.0 38.0 35.2 38.0 45-49 36.973699999999994 38.0 38.0 38.0 35.6 38.0 50-54 36.9193 38.0 38.0 38.0 35.2 38.0 55-59 36.777950000000004 38.0 38.0 38.0 34.6 38.0 60-64 36.509750000000004 38.0 38.0 38.0 34.0 38.0 65-69 36.51925 38.0 37.4 38.0 34.0 38.0 70-74 36.36515 38.0 37.2 38.0 33.6 38.0 75-79 36.356550000000006 38.0 37.0 38.0 33.6 38.0 80-84 36.17739999999999 38.0 37.0 38.0 33.0 38.0 85-89 36.073150000000005 38.0 36.8 38.0 32.6 38.0 90-94 35.49225 38.0 36.0 38.0 29.8 38.0 95-99 35.254599999999996 38.0 36.0 38.0 28.8 38.0 100-104 35.21005 38.0 35.2 38.0 28.6 38.0 105-109 34.91035 38.0 34.8 38.0 28.0 38.0 110-114 34.001850000000005 38.0 34.0 38.0 21.8 38.0 115-119 33.2455 37.0 33.0 38.0 15.0 38.0 120-124 32.939049999999995 37.0 32.0 38.0 15.0 38.0 125-129 33.004949999999994 36.8 32.4 38.0 17.4 38.0 130-134 31.90625 36.0 31.0 38.0 14.8 38.0 135-139 30.454500000000003 35.0 25.6 38.0 14.0 38.0 140-144 29.571700000000003 34.8 24.2 38.0 13.0 38.0 145-149 28.40475 34.2 21.0 38.0 4.2 38.0 150-151 22.99325 29.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 10.0 21 4.0 22 7.0 23 18.0 24 20.0 25 19.0 26 43.0 27 51.0 28 52.0 29 72.0 30 88.0 31 137.0 32 179.0 33 297.0 34 429.0 35 747.0 36 1138.0 37 683.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.56407617086979 21.12712300566135 8.620689655172415 41.68811116829645 2 22.875 23.075000000000003 33.225 20.825 3 19.625 26.5 24.775 29.099999999999998 4 25.724999999999998 31.025000000000002 21.425 21.825 5 25.162581290645324 32.741370685342666 22.911455727863935 19.18459229614807 6 18.5 34.35 23.65 23.5 7 15.525 19.225 43.05 22.2 8 20.5 20.65 28.175 30.675 9 19.575 20.375 31.2 28.849999999999998 10-14 22.75 25.47 24.725 27.055 15-19 22.415 25.900000000000002 26.415 25.27 20-24 21.64 27.6 25.86 24.9 25-29 22.195 26.540000000000003 26.424999999999997 24.84 30-34 21.67 27.18 26.055 25.095 35-39 22.32 26.775 25.71 25.195 40-44 22.384999999999998 26.655 25.795 25.165 45-49 21.965 26.150000000000002 26.424999999999997 25.46 50-54 22.29 25.605 26.22 25.885 55-59 22.07 26.340000000000003 26.515 25.074999999999996 60-64 22.55 26.405 26.07 24.975 65-69 21.95 26.314999999999998 26.669999999999998 25.064999999999998 70-74 23.24 26.334999999999997 25.83 24.595 75-79 22.08 26.115 26.075 25.729999999999997 80-84 22.435 26.22 26.145000000000003 25.2 85-89 22.314999999999998 26.229999999999997 26.035000000000004 25.419999999999998 90-94 22.725 26.105 25.85 25.319999999999997 95-99 22.48 26.200000000000003 25.775 25.545 100-104 23.015 26.32 26.205000000000002 24.46 105-109 22.53 26.355 25.88 25.235000000000003 110-114 23.01 26.005 26.07 24.915000000000003 115-119 23.064999999999998 25.955000000000002 26.029999999999998 24.95 120-124 23.135 26.005 25.380000000000003 25.480000000000004 125-129 23.365 25.759999999999998 26.25 24.625 130-134 22.985 26.44 25.09 25.485000000000003 135-139 22.99 25.735000000000003 25.755 25.52 140-144 23.26 26.484999999999996 25.41 24.845 145-149 23.485 25.77 25.900000000000002 24.845 150-151 23.6625 25.412499999999998 25.8125 25.112499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 2.0 28 3.0 29 5.0 30 8.5 31 16.0 32 20.0 33 26.5 34 35.0 35 41.0 36 57.0 37 76.0 38 91.5 39 122.0 40 152.5 41 176.0 42 204.5 43 207.0 44 204.0 45 221.5 46 221.0 47 210.0 48 202.0 49 180.0 50 165.0 51 164.5 52 144.0 53 120.5 54 113.0 55 89.0 56 76.5 57 78.0 58 64.0 59 62.0 60 60.0 61 50.0 62 46.5 63 41.0 64 37.0 65 37.0 66 39.0 67 32.0 68 22.0 69 16.0 70 14.0 71 13.0 72 9.0 73 7.0 74 5.0 75 4.0 76 3.5 77 2.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.85 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.8374999999999999 0.0 0.0 0.0 0.0 116-117 0.9625 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.4249999999999998 0.0 0.0 0.0 0.0 124-125 1.5750000000000002 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.475 0.0 0.0 0.0 0.0 134-135 2.7750000000000004 0.0 0.0 0.0 0.0 136-137 3.0125 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCAGA 10 0.0068343505 144.975 9 >>END_MODULE SRR8846539 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846539_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67575 33.0 33.0 34.0 32.0 34.0 2 32.609 33.0 33.0 34.0 31.0 34.0 3 32.789 33.0 33.0 34.0 32.0 34.0 4 32.753 33.0 33.0 34.0 32.0 34.0 5 32.808 33.0 33.0 34.0 32.0 34.0 6 36.87275 38.0 38.0 38.0 35.0 38.0 7 36.916 38.0 38.0 38.0 36.0 38.0 8 36.947 38.0 38.0 38.0 36.0 38.0 9 36.975 38.0 38.0 38.0 36.0 38.0 10-14 36.926199999999994 38.0 38.0 38.0 35.8 38.0 15-19 36.91385 38.0 38.0 38.0 36.0 38.0 20-24 36.87915 38.0 38.0 38.0 35.6 38.0 25-29 36.7751 38.0 38.0 38.0 35.0 38.0 30-34 36.701049999999995 38.0 38.0 38.0 34.8 38.0 35-39 36.7587 38.0 38.0 38.0 35.2 38.0 40-44 36.657399999999996 38.0 38.0 38.0 34.8 38.0 45-49 36.589600000000004 38.0 38.0 38.0 34.2 38.0 50-54 36.27575 38.0 38.0 38.0 33.6 38.0 55-59 36.11105 38.0 37.6 38.0 32.6 38.0 60-64 36.1546 38.0 37.6 38.0 33.0 38.0 65-69 36.4191 38.0 38.0 38.0 34.0 38.0 70-74 36.068599999999996 38.0 37.4 38.0 33.2 38.0 75-79 35.8809 38.0 37.0 38.0 31.4 38.0 80-84 35.86495 38.0 37.0 38.0 32.2 38.0 85-89 35.575149999999994 38.0 36.8 38.0 30.6 38.0 90-94 35.443850000000005 38.0 36.2 38.0 29.6 38.0 95-99 35.03085 38.0 35.6 38.0 28.2 38.0 100-104 34.62315 38.0 35.0 38.0 26.0 38.0 105-109 34.66975000000001 38.0 34.8 38.0 26.4 38.0 110-114 34.37525 38.0 34.2 38.0 25.0 38.0 115-119 33.739200000000004 38.0 34.0 38.0 21.8 38.0 120-124 33.00545 37.4 33.2 38.0 15.0 38.0 125-129 32.892399999999995 37.4 32.4 38.0 15.0 38.0 130-134 32.19665 36.4 31.4 38.0 14.4 38.0 135-139 30.8063 35.2 28.6 38.0 13.4 38.0 140-144 29.43895 33.8 25.4 38.0 10.4 38.0 145-149 27.196049999999996 33.0 19.0 38.0 2.0 38.0 150-151 20.363374999999998 25.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 0.0 6 2.0 7 1.0 8 1.0 9 3.0 10 3.0 11 1.0 12 4.0 13 3.0 14 3.0 15 6.0 16 4.0 17 5.0 18 8.0 19 6.0 20 7.0 21 16.0 22 20.0 23 16.0 24 24.0 25 30.0 26 32.0 27 51.0 28 60.0 29 72.0 30 80.0 31 111.0 32 177.0 33 240.0 34 369.0 35 562.0 36 1090.0 37 984.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.8 13.5 13.075000000000001 35.625 2 28.7 19.475 32.5 19.325 3 23.325000000000003 21.825 30.525000000000002 24.325 4 26.3 32.95 18.2 22.55 5 27.075 32.525 20.424999999999997 19.975 6 20.025000000000002 35.5 20.525 23.95 7 19.925 15.225 40.25 24.6 8 21.375 21.325 26.650000000000002 30.65 9 23.849999999999998 21.125 26.974999999999998 28.050000000000004 10-14 25.865 24.92 23.13 26.085 15-19 25.25 25.77 24.645 24.335 20-24 25.105 26.240000000000002 24.895 23.76 25-29 24.83 25.965 25.169999999999998 24.035 30-34 24.915000000000003 25.645 25.445 23.995 35-39 25.385 25.595000000000002 25.395 23.625 40-44 25.245 25.85 25.230000000000004 23.674999999999997 45-49 25.124999999999996 26.090000000000003 25.115 23.669999999999998 50-54 25.064999999999998 25.740000000000002 25.825 23.369999999999997 55-59 25.564999999999998 25.765 25.22 23.45 60-64 25.2 25.330000000000002 25.745 23.724999999999998 65-69 25.495 26.179999999999996 25.415 22.91 70-74 25.795 25.365 25.405 23.435 75-79 24.82 25.040000000000003 26.424999999999997 23.715 80-84 25.895000000000003 25.525 25.259999999999998 23.32 85-89 25.369999999999997 25.645 26.095000000000002 22.89 90-94 25.165 25.624999999999996 25.845000000000002 23.365 95-99 25.22 26.415 25.569999999999997 22.795 100-104 24.63 26.955000000000002 25.44 22.975 105-109 25.624999999999996 26.19 24.740000000000002 23.445 110-114 24.955 26.38 25.224999999999998 23.44 115-119 25.369999999999997 26.14 25.564999999999998 22.925 120-124 26.125 25.77 25.895000000000003 22.21 125-129 25.430000000000003 26.400000000000002 25.745 22.425 130-134 26.115 25.53 26.135 22.220000000000002 135-139 26.27 26.0 25.974999999999998 21.755 140-144 26.27 25.805 25.8 22.125 145-149 26.25 26.6 25.405 21.745 150-151 26.200000000000003 25.85 26.2875 21.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 2.0 26 1.5 27 0.0 28 1.0 29 1.5 30 2.0 31 7.5 32 11.5 33 14.5 34 25.5 35 34.5 36 43.0 37 61.0 38 79.0 39 106.0 40 138.0 41 157.5 42 179.0 43 189.5 44 198.5 45 207.0 46 190.5 47 193.0 48 200.0 49 184.0 50 168.0 51 161.0 52 139.5 53 125.5 54 114.5 55 91.0 56 88.0 57 83.0 58 79.5 59 84.0 60 80.5 61 77.0 62 73.5 63 65.5 64 60.5 65 57.5 66 50.5 67 35.5 68 25.0 69 22.0 70 19.0 71 19.0 72 16.5 73 9.0 74 7.0 75 7.0 76 4.0 77 3.0 78 2.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9625 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.025 0.0 0.0 0.0 122-123 1.4375 0.025 0.0 0.0 0.0 124-125 1.6 0.025 0.0 0.0 0.0 126-127 1.8375 0.025 0.0 0.0 0.0 128-129 2.05 0.025 0.0 0.0 0.0 130-131 2.2750000000000004 0.025 0.0 0.0 0.0 132-133 2.55 0.025 0.0 0.0 0.0 134-135 2.8625 0.025 0.0 0.0 0.0 136-137 3.1 0.025 0.0 0.0 0.0 138-139 3.45 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGCA 10 0.006830828 145.0 7 TCGAGGT 10 0.006830828 145.0 7 >>END_MODULE Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898823 spots for SRR8846539.sra Written 898823 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra Read 898821 spots for SRR8846539.sra Written 898821 spots for SRR8846539.sra SRR ids: ['SRR8846539.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vc8266tx SRR8846539.sra spots: 17976422 blocks: [[1, 898821], [898822, 1797642], [1797643, 2696463], [2696464, 3595284], [3595285, 4494105], [4494106, 5392926], [5392927, 6291747], [6291748, 7190568], [7190569, 8089389], [8089390, 8988210], [8988211, 9887031], [9887032, 10785852], [10785853, 11684673], [11684674, 12583494], [12583495, 13482315], [13482316, 14381136], [14381137, 15279957], [15279958, 16178778], [16178779, 17077599], [17077600, 17976422]] SRR8846539 file size 6069919 SRR8846539 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846539 SRR8846539_1.fastq SRR8846539_2.fastq Input file: SRR8846539_1.fastq Paired file: SRR8846539_2.fastq trimmed: SRR8846539-trimmed-pair1.fastq, SRR8846539-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 08:55:19 2024 >> started Mon Dec 9 08:55:39 2024 >> done (19.283s) 17976422 read pairs processed; of these: 11700 ( 0.07%) short read pairs filtered out after trimming by size control 9899 ( 0.06%) empty read pairs filtered out after trimming by size control 17954823 (99.88%) read pairs available; of these: 10409887 (57.98%) trimmed read pairs available after processing 7544936 (42.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 9 0.00% 21 4 0.00% 22 5 0.00% 23 5 0.00% 24 9 0.00% 25 8 0.00% 26 3 0.00% 27 14 0.00% 28 4 0.00% 29 12 0.00% 30 12 0.00% 31 8 0.00% 32 7 0.00% 33 9 0.00% 34 11 0.00% 35 6 0.00% 36 20 0.00% 37 10 0.00% 38 21 0.00% 39 16 0.00% 40 10 0.00% 41 14 0.00% 42 20 0.00% 43 20 0.00% 44 15 0.00% 45 25 0.00% 46 25 0.00% 47 35 0.00% 48 28 0.00% 49 33 0.00% 50 41 0.00% 51 34 0.00% 52 47 0.00% 53 61 0.00% 54 60 0.00% 55 48 0.00% 56 57 0.00% 57 55 0.00% 58 69 0.00% 59 84 0.00% 60 93 0.00% 61 110 0.00% 62 127 0.00% 63 148 0.00% 64 170 0.00% 65 200 0.00% 66 181 0.00% 67 247 0.00% 68 234 0.00% 69 296 0.00% 70 299 0.00% 71 346 0.00% 72 351 0.00% 73 459 0.00% 74 477 0.00% 75 582 0.00% 76 668 0.00% 77 685 0.00% 78 769 0.00% 79 867 0.00% 80 984 0.01% 81 1164 0.01% 82 1274 0.01% 83 1514 0.01% 84 2081 0.01% 85 2474 0.01% 86 2626 0.01% 87 2876 0.02% 88 3045 0.02% 89 3232 0.02% 90 3281 0.02% 91 3543 0.02% 92 3741 0.02% 93 4107 0.02% 94 4528 0.03% 95 4762 0.03% 96 5201 0.03% 97 5727 0.03% 98 5926 0.03% 99 6490 0.04% 100 6936 0.04% 101 7332 0.04% 102 8003 0.04% 103 8471 0.05% 104 9103 0.05% 105 9774 0.05% 106 10445 0.06% 107 11277 0.06% 108 11866 0.07% 109 12508 0.07% 110 13358 0.07% 111 14283 0.08% 112 14919 0.08% 113 15810 0.09% 114 16683 0.09% 115 18206 0.10% 116 18902 0.11% 117 20257 0.11% 118 21715 0.12% 119 23104 0.13% 120 23996 0.13% 121 25730 0.14% 122 27044 0.15% 123 28840 0.16% 124 30347 0.17% 125 32604 0.18% 126 34269 0.19% 127 36953 0.21% 128 39254 0.22% 129 41856 0.23% 130 44982 0.25% 131 48926 0.27% 132 53095 0.30% 133 56967 0.32% 134 61802 0.34% 135 67035 0.37% 136 73458 0.41% 137 80606 0.45% 138 89713 0.50% 139 101472 0.57% 140 113264 0.63% 141 130417 0.73% 142 150122 0.84% 143 178328 0.99% 144 215333 1.20% 145 272673 1.52% 146 365764 2.04% 147 513918 2.86% 148 752486 4.19% 149 1381704 7.70% 150 4987108 27.78% 151 7544936 42.02% 17954823 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=13 prefix-density=0.50 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=152.74 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.9 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=25 prefix-density=0.43 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=526.20 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=18.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846539 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 08:56:32 Started mapping on | Dec 09 08:56:32 Finished on | Dec 09 08:58:07 Mapping speed, Million of reads per hour | 680.39 Number of input reads | 17954823 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17564160 Uniquely mapped reads % | 97.82% Average mapped length | 295.65 Number of splices: Total | 19931592 Number of splices: Annotated (sjdb) | 18745826 Number of splices: GT/AG | 19674669 Number of splices: GC/AG | 230927 Number of splices: AT/AC | 11075 Number of splices: Non-canonical | 14921 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 159299 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 8346 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 239338 239338 239338 N_multimapping 159299 159299 159299 N_noFeature 677310 17066937 848003 N_ambiguous 383283 2674 57139 UnstrandedReadsAssigned:16503567 PositiveStrandReadsAssigned:494549 NegativeStrandReadsAssigned:16659018 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846539 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846539-trimmed-pair1.fastq SRR8846539-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,954,823 reads, 16,725,838 reads pseudoaligned [quant] estimated average fragment length: 271.809 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 SRR8846539.ke.tsv 35125 SRR8846539.se.tsv 88098 total ==> SRR8846539.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.84 0 0 PNS24247 1044 773.191 70.3821 8.0244 PNS24249 1928 1657.19 38.5332 2.04975 PNS24246 1044 773.191 70.3821 8.0244 PNS24248 1044 773.191 70.3821 8.0244 PNS24244 1471 1200.19 63.3206 4.65085 PNS24243 293 81.8892 0 0 KQK14069 1603 1332.19 6943.53 459.464 KQK14071 474 220.932 106.788 42.6088 ==> SRR8846539.se.tsv <== BRADI_1g14170v3 8085 BRADI_1g53295v3 134 BRADI_1g59795v3 813 BRADI_1g07683v3 0 BRADI_1g00485v3 59 BRADI_1g20270v3 3814 BRADI_1g74790v3 91 BRADI_1g09890v3 1 BRADI_1g77505v3 290 BRADI_1g48960v3 0 SRR8846539 completed mapping pipeline successfully