Starting /dee2/code/volunteer_pipeline.sh SRR8846541 current disk space = 1530314588160 free memory = 1603911216 SRR8846541 SRAfilesize ef2a1c66f2762c993593c0698e299061 SRR8846541.sra SRR8846541.sra file validated SRR8846541 is paired end SRR8846541 is conventional basespace SRR8846541 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846541_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.863 18.0 18.0 32.0 18.0 33.0 2 29.83425 31.0 27.0 33.0 27.0 33.0 3 30.78975 33.0 29.0 33.0 27.0 33.0 4 31.559 33.0 32.0 33.0 30.0 33.0 5 32.53625 33.0 33.0 33.0 32.0 34.0 6 37.042 38.0 38.0 38.0 35.0 38.0 7 37.2345 38.0 38.0 38.0 36.0 38.0 8 37.28675 38.0 38.0 38.0 36.0 38.0 9 37.43025 38.0 38.0 38.0 37.0 38.0 10-14 37.236749999999994 38.0 38.0 38.0 36.4 38.0 15-19 37.049800000000005 38.0 38.0 38.0 35.8 38.0 20-24 37.1963 38.0 38.0 38.0 36.4 38.0 25-29 37.40225 38.0 38.0 38.0 37.0 38.0 30-34 37.32285 38.0 38.0 38.0 36.8 38.0 35-39 37.1031 38.0 38.0 38.0 36.2 38.0 40-44 36.7629 38.0 38.0 38.0 34.8 38.0 45-49 36.96015 38.0 38.0 38.0 35.6 38.0 50-54 36.94945 38.0 38.0 38.0 35.4 38.0 55-59 36.7966 38.0 38.0 38.0 34.8 38.0 60-64 36.47025 38.0 37.6 38.0 33.8 38.0 65-69 36.42245 38.0 37.2 38.0 33.6 38.0 70-74 36.4041 38.0 37.0 38.0 33.8 38.0 75-79 36.389300000000006 38.0 37.0 38.0 33.8 38.0 80-84 36.14445 38.0 37.0 38.0 32.6 38.0 85-89 35.9402 38.0 36.8 38.0 32.2 38.0 90-94 35.128949999999996 38.0 35.6 38.0 28.0 38.0 95-99 35.124 38.0 35.4 38.0 28.4 38.0 100-104 35.4109 38.0 36.0 38.0 29.6 38.0 105-109 34.72375 38.0 34.8 38.0 26.6 38.0 110-114 33.6221 37.6 33.4 38.0 19.8 38.0 115-119 33.086200000000005 37.0 32.4 38.0 17.4 38.0 120-124 33.285849999999996 37.0 33.0 38.0 17.8 38.0 125-129 33.012 36.6 32.4 38.0 18.6 38.0 130-134 31.8033 35.8 30.0 38.0 14.6 38.0 135-139 30.355349999999998 35.0 25.6 38.0 13.8 38.0 140-144 29.463150000000002 35.0 23.4 38.0 13.0 38.0 145-149 28.334299999999995 34.2 22.6 38.0 4.2 38.0 150-151 23.023125 30.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 2.0 16 1.0 17 3.0 18 3.0 19 3.0 20 4.0 21 2.0 22 11.0 23 16.0 24 18.0 25 27.0 26 28.0 27 60.0 28 64.0 29 61.0 30 91.0 31 127.0 32 221.0 33 274.0 34 445.0 35 730.0 36 1126.0 37 681.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.309885424993336 23.90087929656275 7.780442312816413 39.0087929656275 2 23.674999999999997 22.650000000000002 33.275 20.4 3 19.525000000000002 26.125 23.849999999999998 30.5 4 22.45 33.5 21.875 22.175 5 23.025000000000002 35.35 23.0 18.625 6 19.400000000000002 34.225 23.75 22.625 7 15.65 19.5 42.475 22.375 8 19.775000000000002 21.3 29.75 29.175 9 20.8 20.3 30.0 28.9 10-14 22.925 25.72 24.625 26.729999999999997 15-19 22.35 26.179999999999996 26.13 25.34 20-24 21.75 27.11 26.055 25.085 25-29 21.790000000000003 26.584999999999997 25.915 25.71 30-34 22.42 26.945000000000004 25.885 24.75 35-39 22.21 26.775 25.88 25.135 40-44 22.435 26.68 26.515 24.37 45-49 22.59 26.31 25.995 25.105 50-54 22.255 26.540000000000003 25.869999999999997 25.335 55-59 22.03 26.915 25.855 25.2 60-64 22.59 25.575 26.555 25.28 65-69 22.384999999999998 26.32 26.32 24.975 70-74 22.0 26.58 25.615 25.805 75-79 22.54 26.85 25.695 24.915000000000003 80-84 22.35 26.029999999999998 25.685000000000002 25.935000000000002 85-89 22.67 25.759999999999998 26.435 25.135 90-94 22.6 25.86 26.045 25.495 95-99 23.0 25.75 26.125 25.124999999999996 100-104 22.875 26.229999999999997 26.51 24.385 105-109 22.75 26.085 25.929999999999996 25.235000000000003 110-114 23.085 25.71 25.924999999999997 25.28 115-119 23.275000000000002 25.624999999999996 25.979999999999997 25.119999999999997 120-124 23.095 25.759999999999998 25.635 25.509999999999998 125-129 23.29 25.669999999999998 25.745 25.295 130-134 23.04 26.21 25.474999999999998 25.275 135-139 22.495 25.665 25.900000000000002 25.94 140-144 23.25 25.345000000000002 26.11 25.295 145-149 23.3 25.755 25.7 25.245 150-151 23.05 25.474999999999998 26.275 25.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 1.0 27 2.0 28 5.0 29 8.5 30 10.0 31 15.5 32 22.5 33 29.5 34 40.5 35 50.5 36 66.0 37 84.5 38 100.0 39 117.0 40 133.5 41 167.0 42 195.5 43 205.0 44 205.5 45 197.0 46 207.0 47 216.5 48 209.0 49 196.0 50 179.0 51 162.0 52 141.5 53 115.0 54 94.5 55 88.0 56 82.0 57 70.5 58 66.0 59 62.5 60 61.5 61 59.0 62 51.0 63 39.0 64 34.0 65 35.0 66 30.5 67 29.5 68 27.5 69 21.0 70 15.0 71 12.0 72 11.0 73 9.5 74 6.5 75 3.0 76 1.0 77 1.5 78 1.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.4625 0.0 0.0 0.0 0.0 128-129 1.625 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 1.9874999999999998 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.4000000000000004 0.0 0.0 0.0 0.0 138-139 2.6500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8846541 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846541_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65025 33.0 33.0 34.0 32.0 34.0 2 32.65575 33.0 33.0 34.0 32.0 34.0 3 32.80725 33.0 33.0 34.0 32.0 34.0 4 32.69725 33.0 33.0 34.0 32.0 34.0 5 32.726 33.0 33.0 34.0 32.0 34.0 6 36.90975 38.0 38.0 38.0 36.0 38.0 7 36.977 38.0 38.0 38.0 36.0 38.0 8 37.02075 38.0 38.0 38.0 36.0 38.0 9 37.05325 38.0 38.0 38.0 36.0 38.0 10-14 36.9876 38.0 38.0 38.0 36.0 38.0 15-19 37.0001 38.0 38.0 38.0 36.2 38.0 20-24 36.9659 38.0 38.0 38.0 36.0 38.0 25-29 36.778949999999995 38.0 38.0 38.0 35.0 38.0 30-34 36.719449999999995 38.0 38.0 38.0 34.8 38.0 35-39 36.7915 38.0 38.0 38.0 35.0 38.0 40-44 36.70305 38.0 38.0 38.0 35.0 38.0 45-49 36.62925 38.0 38.0 38.0 34.6 38.0 50-54 36.249 38.0 37.8 38.0 33.6 38.0 55-59 36.1637 38.0 37.8 38.0 33.0 38.0 60-64 36.292899999999996 38.0 37.8 38.0 33.6 38.0 65-69 36.4407 38.0 38.0 38.0 34.0 38.0 70-74 36.22 38.0 37.4 38.0 33.4 38.0 75-79 35.8995 38.0 37.0 38.0 31.8 38.0 80-84 36.0401 38.0 37.0 38.0 33.0 38.0 85-89 35.7747 38.0 37.0 38.0 31.2 38.0 90-94 35.55845 38.0 36.6 38.0 30.2 38.0 95-99 35.0684 38.0 35.6 38.0 28.4 38.0 100-104 34.707 38.0 35.0 38.0 26.4 38.0 105-109 34.77465 38.0 34.8 38.0 27.4 38.0 110-114 34.2783 38.0 34.0 38.0 24.2 38.0 115-119 33.82045000000001 38.0 34.0 38.0 22.6 38.0 120-124 32.9782 37.2 33.2 38.0 15.0 38.0 125-129 32.904450000000004 37.4 32.2 38.0 17.4 38.0 130-134 32.01045 36.4 31.4 38.0 14.2 38.0 135-139 30.55025 35.0 27.6 38.0 13.2 38.0 140-144 29.28275 33.6 25.2 38.0 10.4 38.0 145-149 27.488999999999997 33.0 19.8 38.0 2.0 38.0 150-151 20.68625 26.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 2.0 5 2.0 6 0.0 7 0.0 8 2.0 9 1.0 10 1.0 11 2.0 12 2.0 13 1.0 14 4.0 15 4.0 16 7.0 17 6.0 18 3.0 19 2.0 20 8.0 21 7.0 22 15.0 23 19.0 24 33.0 25 40.0 26 41.0 27 35.0 28 59.0 29 66.0 30 101.0 31 113.0 32 179.0 33 242.0 34 357.0 35 566.0 36 1062.0 37 1010.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.5 14.725 12.775 34.0 2 29.099999999999998 19.575 32.9 18.425 3 22.25 23.65 29.7 24.4 4 24.6 31.75 20.200000000000003 23.45 5 26.05 34.150000000000006 19.85 19.950000000000003 6 20.349999999999998 35.55 21.349999999999998 22.75 7 20.625 14.674999999999999 39.300000000000004 25.4 8 22.55 21.675 25.074999999999996 30.7 9 22.275 21.625 27.900000000000002 28.199999999999996 10-14 26.075 24.805 23.415 25.705 15-19 25.369999999999997 25.66 24.97 24.0 20-24 25.615 26.06 24.59 23.735 25-29 25.31 25.31 25.3 24.08 30-34 25.66 25.64 25.074999999999996 23.625 35-39 25.665 25.745 24.645 23.945 40-44 25.19 25.89 25.405 23.515 45-49 25.119999999999997 25.97 24.959999999999997 23.95 50-54 25.779999999999998 25.619999999999997 25.130000000000003 23.47 55-59 25.900000000000002 26.06 24.86 23.18 60-64 25.669999999999998 26.02 24.865000000000002 23.445 65-69 26.265 25.945 24.805 22.985 70-74 25.124999999999996 25.89 25.45 23.535 75-79 25.915 25.424999999999997 25.405 23.255 80-84 25.185000000000002 25.865 25.155 23.794999999999998 85-89 25.445 25.25 25.935000000000002 23.369999999999997 90-94 25.5 25.215 26.369999999999997 22.915 95-99 25.88 25.540000000000003 25.835 22.745 100-104 25.755 25.580000000000002 25.564999999999998 23.1 105-109 24.925 25.840000000000003 25.395 23.84 110-114 25.83 26.38 25.264999999999997 22.525000000000002 115-119 25.495 26.16 24.905 23.44 120-124 26.224999999999998 25.569999999999997 25.430000000000003 22.775000000000002 125-129 25.77 25.485000000000003 25.605 23.14 130-134 25.75 25.945 25.83 22.475 135-139 25.935000000000002 25.75 25.759999999999998 22.555 140-144 25.874999999999996 25.874999999999996 25.924999999999997 22.325 145-149 25.95 25.779999999999998 25.81 22.46 150-151 25.087500000000002 26.187500000000004 27.3375 21.3875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 3.0 27 3.5 28 3.5 29 4.0 30 7.5 31 11.0 32 13.5 33 18.0 34 27.5 35 43.5 36 49.5 37 58.0 38 75.5 39 99.0 40 123.5 41 148.5 42 172.0 43 180.0 44 191.0 45 204.0 46 203.0 47 192.0 48 191.0 49 184.0 50 177.5 51 158.5 52 120.0 53 117.0 54 111.0 55 100.5 56 89.5 57 76.5 58 76.5 59 81.5 60 85.5 61 76.0 62 71.0 63 65.0 64 53.5 65 47.0 66 50.0 67 45.5 68 43.0 69 38.5 70 30.0 71 24.5 72 19.5 73 14.0 74 6.5 75 5.0 76 4.0 77 2.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.40221216691804923 0.8 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.6499999999999999 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.7000000000000002 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.4124999999999996 0.0 0.0 0.0 0.0 136-137 2.6500000000000004 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTCAC 10 0.006830828 145.0 1 >>END_MODULE Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655333 spots for SRR8846541.sra Written 1655333 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra Read 1655315 spots for SRR8846541.sra Written 1655315 spots for SRR8846541.sra SRR ids: ['SRR8846541.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8dd7en4l SRR8846541.sra spots: 33106318 blocks: [[1, 1655315], [1655316, 3310630], [3310631, 4965945], [4965946, 6621260], [6621261, 8276575], [8276576, 9931890], [9931891, 11587205], [11587206, 13242520], [13242521, 14897835], [14897836, 16553150], [16553151, 18208465], [18208466, 19863780], [19863781, 21519095], [21519096, 23174410], [23174411, 24829725], [24829726, 26485040], [26485041, 28140355], [28140356, 29795670], [29795671, 31450985], [31450986, 33106318]] SRR8846541 file size 11196944 SRR8846541 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846541 SRR8846541_1.fastq SRR8846541_2.fastq Input file: SRR8846541_1.fastq Paired file: SRR8846541_2.fastq trimmed: SRR8846541-trimmed-pair1.fastq, SRR8846541-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 09:12:49 2024 >> started Mon Dec 9 09:13:24 2024 >> done (34.840s) 33106318 read pairs processed; of these: 24933 ( 0.08%) short read pairs filtered out after trimming by size control 19207 ( 0.06%) empty read pairs filtered out after trimming by size control 33062178 (99.87%) read pairs available; of these: 19099689 (57.77%) trimmed read pairs available after processing 13962489 (42.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 5 0.00% 20 6 0.00% 21 7 0.00% 22 12 0.00% 23 12 0.00% 24 15 0.00% 25 8 0.00% 26 13 0.00% 27 13 0.00% 28 18 0.00% 29 14 0.00% 30 13 0.00% 31 18 0.00% 32 13 0.00% 33 10 0.00% 34 14 0.00% 35 13 0.00% 36 17 0.00% 37 16 0.00% 38 12 0.00% 39 21 0.00% 40 23 0.00% 41 27 0.00% 42 25 0.00% 43 22 0.00% 44 33 0.00% 45 43 0.00% 46 34 0.00% 47 38 0.00% 48 36 0.00% 49 45 0.00% 50 56 0.00% 51 52 0.00% 52 74 0.00% 53 64 0.00% 54 82 0.00% 55 77 0.00% 56 102 0.00% 57 132 0.00% 58 126 0.00% 59 143 0.00% 60 148 0.00% 61 197 0.00% 62 185 0.00% 63 249 0.00% 64 225 0.00% 65 273 0.00% 66 293 0.00% 67 339 0.00% 68 349 0.00% 69 425 0.00% 70 496 0.00% 71 541 0.00% 72 596 0.00% 73 775 0.00% 74 816 0.00% 75 926 0.00% 76 1026 0.00% 77 1137 0.00% 78 1235 0.00% 79 1457 0.00% 80 1621 0.00% 81 1875 0.01% 82 2083 0.01% 83 2526 0.01% 84 3673 0.01% 85 4356 0.01% 86 4588 0.01% 87 5008 0.02% 88 5113 0.02% 89 5429 0.02% 90 5733 0.02% 91 6287 0.02% 92 6753 0.02% 93 7156 0.02% 94 7818 0.02% 95 8621 0.03% 96 9308 0.03% 97 9924 0.03% 98 10472 0.03% 99 11431 0.03% 100 12238 0.04% 101 13169 0.04% 102 14208 0.04% 103 15131 0.05% 104 16150 0.05% 105 17380 0.05% 106 18788 0.06% 107 20083 0.06% 108 21550 0.07% 109 23117 0.07% 110 24674 0.07% 111 25859 0.08% 112 27784 0.08% 113 29291 0.09% 114 31159 0.09% 115 33413 0.10% 116 35291 0.11% 117 37420 0.11% 118 39196 0.12% 119 42376 0.13% 120 44661 0.14% 121 47466 0.14% 122 50438 0.15% 123 52801 0.16% 124 56147 0.17% 125 59522 0.18% 126 63136 0.19% 127 68001 0.21% 128 72495 0.22% 129 77015 0.23% 130 82591 0.25% 131 88879 0.27% 132 96575 0.29% 133 103740 0.31% 134 112833 0.34% 135 122296 0.37% 136 133713 0.40% 137 147224 0.45% 138 163289 0.49% 139 183251 0.55% 140 204379 0.62% 141 234922 0.71% 142 273285 0.83% 143 322690 0.98% 144 391043 1.18% 145 495065 1.50% 146 664334 2.01% 147 937142 2.83% 148 1377615 4.17% 149 2534474 7.67% 150 9207412 27.85% 151 13962489 42.23% 33062178 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=15 prefix-density=0.52 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=125.01 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=13.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCA criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=24 prefix-density=0.49 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=90.84 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.6 sequence=GCTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGTTTAAATTGACATCTTCATAAGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTCTAAAACTTTAACTGCTTCCCAAATTTCCCCAATATCAGACATTCCTGT SRR8846541 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 09:14:04 Started mapping on | Dec 09 09:14:04 Finished on | Dec 09 09:17:23 Mapping speed, Million of reads per hour | 598.11 Number of input reads | 33062178 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 32086419 Uniquely mapped reads % | 97.05% Average mapped length | 295.73 Number of splices: Total | 36008206 Number of splices: Annotated (sjdb) | 33889342 Number of splices: GT/AG | 35546545 Number of splices: GC/AG | 416054 Number of splices: AT/AC | 19029 Number of splices: Non-canonical | 26578 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299803 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 22950 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 692838 692838 692838 N_multimapping 299803 299803 299803 N_noFeature 1233183 31212989 1490007 N_ambiguous 724315 4719 108543 UnstrandedReadsAssigned:30128921 PositiveStrandReadsAssigned:868711 NegativeStrandReadsAssigned:30487869 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846541 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846541-trimmed-pair1.fastq SRR8846541-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,062,178 reads, 30,609,859 reads pseudoaligned [quant] estimated average fragment length: 274.535 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,290 rounds 52973 SRR8846541.ke.tsv 35125 SRR8846541.se.tsv 88098 total ==> SRR8846541.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.14 0 0 PNS24247 1044 770.465 131.471 8.06054 PNS24249 1928 1654.47 85.1689 2.4317 PNS24246 1044 770.465 131.471 8.06054 PNS24248 1044 770.465 131.471 8.06054 PNS24244 1471 1197.47 83.417 3.29062 PNS24243 293 81.5592 0 0 KQK14069 1603 1329.47 17356.5 616.694 KQK14071 474 218.937 238.166 51.3863 ==> SRR8846541.se.tsv <== BRADI_1g14170v3 19922 BRADI_1g53295v3 193 BRADI_1g59795v3 1584 BRADI_1g07683v3 0 BRADI_1g00485v3 101 BRADI_1g20270v3 5695 BRADI_1g74790v3 170 BRADI_1g09890v3 9 BRADI_1g77505v3 587 BRADI_1g48960v3 1 SRR8846541 completed mapping pipeline successfully