Starting /dee2/code/volunteer_pipeline.sh SRR8846542 current disk space = 1515340222464 free memory = 1601325640 SRR8846542 SRAfilesize 77366137eb8eee83fca3ece811f8594c SRR8846542.sra SRR8846542.sra file validated SRR8846542 is paired end SRR8846542 is conventional basespace SRR8846542 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846542_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.95925 27.0 18.0 32.0 18.0 33.0 2 26.35875 28.0 18.0 31.0 18.0 33.0 3 28.19375 31.0 27.0 32.0 18.0 33.0 4 30.685 31.0 30.0 33.0 27.0 33.0 5 31.57075 33.0 32.0 33.0 30.0 33.0 6 36.494 38.0 37.0 38.0 34.0 38.0 7 37.012 38.0 38.0 38.0 36.0 38.0 8 37.05975 38.0 38.0 38.0 36.0 38.0 9 37.24825 38.0 38.0 38.0 36.0 38.0 10-14 37.23005 38.0 38.0 38.0 36.6 38.0 15-19 37.20295 38.0 38.0 38.0 36.0 38.0 20-24 37.2358 38.0 38.0 38.0 36.4 38.0 25-29 37.3238 38.0 38.0 38.0 36.8 38.0 30-34 37.35185 38.0 38.0 38.0 37.0 38.0 35-39 37.21405 38.0 38.0 38.0 36.4 38.0 40-44 36.9923 38.0 38.0 38.0 35.8 38.0 45-49 36.90665 38.0 38.0 38.0 35.2 38.0 50-54 37.02825 38.0 38.0 38.0 35.6 38.0 55-59 36.904250000000005 38.0 38.0 38.0 35.0 38.0 60-64 36.778400000000005 38.0 38.0 38.0 34.4 38.0 65-69 36.583149999999996 38.0 38.0 38.0 34.0 38.0 70-74 36.422900000000006 38.0 37.4 38.0 33.4 38.0 75-79 36.3761 38.0 37.0 38.0 33.4 38.0 80-84 36.0666 38.0 37.0 38.0 32.8 38.0 85-89 35.757850000000005 38.0 36.6 38.0 31.2 38.0 90-94 35.2066 38.0 35.8 38.0 28.8 38.0 95-99 35.25715 38.0 35.6 38.0 28.8 38.0 100-104 35.254 38.0 35.4 38.0 29.0 38.0 105-109 34.8749 38.0 35.0 38.0 27.4 38.0 110-114 34.14534999999999 38.0 34.0 38.0 23.4 38.0 115-119 33.457800000000006 37.4 33.4 38.0 19.0 38.0 120-124 33.623000000000005 37.4 33.4 38.0 22.6 38.0 125-129 33.179500000000004 36.8 32.8 38.0 18.6 38.0 130-134 32.15239999999999 35.8 30.6 38.0 14.6 38.0 135-139 30.9584 35.0 27.8 38.0 14.0 38.0 140-144 30.021050000000002 35.0 25.6 38.0 13.0 38.0 145-149 28.812900000000003 33.8 24.6 38.0 6.4 38.0 150-151 23.217375 29.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 7.0 18 1.0 19 5.0 20 5.0 21 6.0 22 4.0 23 14.0 24 16.0 25 27.0 26 32.0 27 35.0 28 60.0 29 60.0 30 80.0 31 147.0 32 174.0 33 285.0 34 423.0 35 714.0 36 1287.0 37 616.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.38174273858922 11.981327800829876 11.592323651452283 38.044605809128626 2 25.124999999999996 18.525 36.875 19.475 3 20.775 24.85 25.3 29.075 4 24.325 32.475 20.75 22.45 5 23.905976494123532 32.25806451612903 23.280820205051263 20.555138784696176 6 18.925 32.95 25.124999999999996 23.0 7 15.950000000000001 19.75 41.4 22.900000000000002 8 20.9 19.275000000000002 28.475 31.35 9 20.125 20.9 31.175000000000004 27.800000000000004 10-14 23.425 25.490000000000002 24.115000000000002 26.97 15-19 23.080000000000002 25.8 25.45 25.669999999999998 20-24 22.715 25.55 26.39 25.345000000000002 25-29 22.845 25.245 26.06 25.85 30-34 22.32 25.75 26.3 25.629999999999995 35-39 22.59 25.740000000000002 25.985000000000003 25.685000000000002 40-44 23.07 25.990000000000002 25.95 24.990000000000002 45-49 22.685 26.55 25.290000000000003 25.474999999999998 50-54 22.835 25.85 25.915 25.4 55-59 23.02 26.21 25.52 25.25 60-64 22.685 25.669999999999998 25.509999999999998 26.135 65-69 23.150000000000002 25.840000000000003 25.455 25.555 70-74 23.369999999999997 25.16 25.495 25.974999999999998 75-79 23.585 25.635 25.195 25.585 80-84 23.265 25.374999999999996 25.96 25.4 85-89 24.15 25.245 25.695 24.91 90-94 23.69 25.19 25.674999999999997 25.445 95-99 23.885 25.77 24.965 25.380000000000003 100-104 24.075 25.34 25.365 25.22 105-109 23.775 25.1 25.355 25.77 110-114 24.185000000000002 24.705 25.840000000000003 25.27 115-119 23.7 25.290000000000003 25.45 25.56 120-124 24.03 25.4 25.319999999999997 25.25 125-129 23.974999999999998 25.674999999999997 24.545 25.805 130-134 24.19 24.610000000000003 25.135 26.064999999999998 135-139 23.95 24.935 24.925 26.19 140-144 24.07 25.16 25.135 25.635 145-149 23.935000000000002 24.43 25.840000000000003 25.795 150-151 24.5375 25.874999999999996 24.45 25.137500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 4.0 28 5.0 29 3.0 30 6.5 31 14.5 32 18.5 33 22.0 34 29.5 35 51.0 36 59.5 37 63.0 38 84.5 39 108.0 40 128.5 41 142.0 42 177.5 43 213.0 44 215.5 45 207.5 46 204.0 47 197.0 48 188.0 49 177.0 50 161.0 51 138.5 52 126.0 53 119.5 54 100.5 55 94.0 56 90.0 57 85.0 58 74.0 59 69.0 60 75.0 61 74.0 62 65.5 63 54.0 64 53.0 65 52.5 66 42.5 67 37.5 68 30.0 69 22.0 70 27.0 71 28.5 72 22.0 73 14.0 74 8.5 75 5.5 76 4.0 77 2.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.3624999999999998 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.6124999999999998 0.0 0.0 0.0 0.0 128-129 1.8 0.0 0.0 0.0 0.0 130-131 1.9500000000000002 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGAA 10 0.0068378756 144.95 8 GCACCCT 10 0.0068378756 144.95 145 >>END_MODULE SRR8846542 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846542_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69875 33.0 33.0 34.0 32.0 34.0 2 32.80975 33.0 33.0 34.0 32.0 34.0 3 32.60075 33.0 33.0 34.0 31.0 34.0 4 32.802 33.0 33.0 34.0 32.0 34.0 5 32.773 33.0 33.0 34.0 32.0 34.0 6 36.905 38.0 38.0 38.0 36.0 38.0 7 37.00375 38.0 38.0 38.0 36.0 38.0 8 36.983 38.0 38.0 38.0 36.0 38.0 9 36.975 38.0 38.0 38.0 36.0 38.0 10-14 36.98125 38.0 38.0 38.0 36.2 38.0 15-19 37.00075 38.0 38.0 38.0 36.0 38.0 20-24 36.9822 38.0 38.0 38.0 36.2 38.0 25-29 36.90645000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.80455 38.0 38.0 38.0 35.2 38.0 35-39 36.6726 38.0 38.0 38.0 34.6 38.0 40-44 36.711650000000006 38.0 38.0 38.0 34.8 38.0 45-49 36.6406 38.0 38.0 38.0 34.8 38.0 50-54 36.492149999999995 38.0 38.0 38.0 34.0 38.0 55-59 36.284150000000004 38.0 38.0 38.0 33.4 38.0 60-64 36.353300000000004 38.0 38.0 38.0 33.6 38.0 65-69 36.45295 38.0 38.0 38.0 34.0 38.0 70-74 36.33005 38.0 38.0 38.0 33.8 38.0 75-79 36.057050000000004 38.0 37.0 38.0 32.6 38.0 80-84 35.807599999999994 38.0 37.0 38.0 31.4 38.0 85-89 35.673950000000005 38.0 36.8 38.0 30.8 38.0 90-94 35.481849999999994 38.0 36.2 38.0 29.8 38.0 95-99 35.231849999999994 38.0 35.8 38.0 29.0 38.0 100-104 34.88905 38.0 35.0 38.0 27.6 38.0 105-109 34.4978 38.0 34.6 38.0 25.6 38.0 110-114 34.0663 38.0 34.2 38.0 23.8 38.0 115-119 33.74015 38.0 34.0 38.0 22.2 38.0 120-124 33.128949999999996 37.6 33.2 38.0 16.2 38.0 125-129 32.3053 36.4 31.6 38.0 14.8 38.0 130-134 31.9115 36.0 31.0 38.0 13.8 38.0 135-139 30.696949999999998 35.0 28.8 38.0 13.2 38.0 140-144 29.4212 33.8 25.4 38.0 10.4 38.0 145-149 27.9769 33.0 22.4 38.0 2.0 38.0 150-151 20.612875 25.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 2.0 5 2.0 6 3.0 7 0.0 8 0.0 9 2.0 10 1.0 11 0.0 12 2.0 13 4.0 14 3.0 15 2.0 16 2.0 17 3.0 18 7.0 19 8.0 20 7.0 21 8.0 22 17.0 23 17.0 24 24.0 25 30.0 26 37.0 27 54.0 28 62.0 29 66.0 30 92.0 31 119.0 32 165.0 33 228.0 34 369.0 35 574.0 36 1115.0 37 967.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.125 12.375 14.424999999999999 39.074999999999996 2 30.0 17.775 31.4 20.825 3 22.825 21.7 28.299999999999997 27.175 4 25.3 31.4 19.175 24.125 5 28.175 31.974999999999998 19.85 20.0 6 21.325 34.4 20.599999999999998 23.674999999999997 7 20.65 14.149999999999999 38.75 26.450000000000003 8 22.075 20.674999999999997 24.325 32.925 9 23.525 20.25 26.25 29.975 10-14 26.71 23.965 23.05 26.275 15-19 25.64 24.83 24.05 25.480000000000004 20-24 26.13 25.174999999999997 23.97 24.725 25-29 25.775 25.185000000000002 24.490000000000002 24.55 30-34 26.005 25.1 24.27 24.625 35-39 26.02 24.985 23.945 25.05 40-44 26.6 24.43 23.91 25.06 45-49 25.865 24.445 24.59 25.1 50-54 25.61 25.169999999999998 24.38 24.84 55-59 26.21 24.895 24.485 24.41 60-64 25.75 24.505 24.625 25.119999999999997 65-69 25.919999999999998 25.185000000000002 24.715 24.18 70-74 25.515 24.745 24.715 25.025 75-79 25.424999999999997 24.915000000000003 24.97 24.69 80-84 26.19 24.865000000000002 24.3 24.645 85-89 25.790000000000003 24.945 24.87 24.395 90-94 25.985000000000003 25.31 24.64 24.065 95-99 26.029999999999998 25.185000000000002 24.41 24.375 100-104 26.545 24.9 24.83 23.724999999999998 105-109 25.865 24.955 24.815 24.365000000000002 110-114 26.135 25.25 24.265 24.349999999999998 115-119 26.345000000000002 25.515 24.22 23.919999999999998 120-124 26.245 25.31 24.295 24.15 125-129 26.44 25.490000000000002 24.115000000000002 23.955000000000002 130-134 26.150000000000002 26.07 24.169999999999998 23.61 135-139 26.415 25.245 25.314999999999998 23.025000000000002 140-144 26.490000000000002 25.56 24.44 23.51 145-149 26.365 25.645 25.09 22.900000000000002 150-151 26.187500000000004 25.112499999999997 25.7875 22.912499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 3.0 28 5.0 29 5.0 30 7.5 31 8.5 32 10.0 33 16.0 34 22.5 35 25.0 36 33.0 37 50.5 38 61.0 39 70.0 40 94.0 41 129.0 42 157.5 43 175.5 44 178.0 45 181.0 46 189.5 47 189.5 48 187.0 49 176.5 50 158.0 51 132.5 52 110.0 53 113.0 54 105.0 55 90.5 56 92.5 57 97.5 58 108.0 59 108.0 60 96.5 61 88.5 62 91.5 63 90.5 64 84.0 65 73.5 66 63.0 67 53.5 68 51.0 69 53.5 70 44.5 71 28.5 72 22.5 73 20.5 74 15.0 75 13.5 76 8.5 77 2.5 78 1.5 79 3.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21756688541142 98.275 2 0.6562342251388188 1.3 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.025239777889954566 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9125000000000001 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5125000000000002 0.0 0.0 0.0 0.0 128-129 1.7 0.0 0.0 0.0 0.0 130-131 1.8624999999999998 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.375 0.0 0.0 0.0 0.0 136-137 2.525 0.0 0.0 0.0 0.0 138-139 2.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCTTT 10 0.006830828 145.0 3 >>END_MODULE Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra Read 847988 spots for SRR8846542.sra Written 847988 spots for SRR8846542.sra Read 847983 spots for SRR8846542.sra Written 847983 spots for SRR8846542.sra SRR ids: ['SRR8846542.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4bjj68o7 SRR8846542.sra spots: 16959665 blocks: [[1, 847983], [847984, 1695966], [1695967, 2543949], [2543950, 3391932], [3391933, 4239915], [4239916, 5087898], [5087899, 5935881], [5935882, 6783864], [6783865, 7631847], [7631848, 8479830], [8479831, 9327813], [9327814, 10175796], [10175797, 11023779], [11023780, 11871762], [11871763, 12719745], [12719746, 13567728], [13567729, 14415711], [14415712, 15263694], [15263695, 16111677], [16111678, 16959665]] SRR8846542 file size 5725373 SRR8846542 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846542 SRR8846542_1.fastq SRR8846542_2.fastq Input file: SRR8846542_1.fastq Paired file: SRR8846542_2.fastq trimmed: SRR8846542-trimmed-pair1.fastq, SRR8846542-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:03:07 2024 >> started Thu Dec 12 03:03:28 2024 >> done (20.972s) 16959665 read pairs processed; of these: 11135 ( 0.07%) short read pairs filtered out after trimming by size control 9553 ( 0.06%) empty read pairs filtered out after trimming by size control 16938977 (99.88%) read pairs available; of these: 9744761 (57.53%) trimmed read pairs available after processing 7194216 (42.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 9 0.00% 21 3 0.00% 22 5 0.00% 23 8 0.00% 24 11 0.00% 25 9 0.00% 26 9 0.00% 27 7 0.00% 28 8 0.00% 29 8 0.00% 30 12 0.00% 31 6 0.00% 32 12 0.00% 33 9 0.00% 34 12 0.00% 35 8 0.00% 36 18 0.00% 37 17 0.00% 38 8 0.00% 39 10 0.00% 40 15 0.00% 41 9 0.00% 42 18 0.00% 43 18 0.00% 44 19 0.00% 45 20 0.00% 46 24 0.00% 47 34 0.00% 48 32 0.00% 49 30 0.00% 50 41 0.00% 51 35 0.00% 52 38 0.00% 53 35 0.00% 54 44 0.00% 55 53 0.00% 56 43 0.00% 57 58 0.00% 58 68 0.00% 59 79 0.00% 60 89 0.00% 61 103 0.00% 62 114 0.00% 63 125 0.00% 64 128 0.00% 65 166 0.00% 66 161 0.00% 67 185 0.00% 68 234 0.00% 69 238 0.00% 70 247 0.00% 71 296 0.00% 72 355 0.00% 73 371 0.00% 74 413 0.00% 75 481 0.00% 76 513 0.00% 77 608 0.00% 78 621 0.00% 79 709 0.00% 80 803 0.00% 81 879 0.01% 82 1006 0.01% 83 1210 0.01% 84 1692 0.01% 85 2067 0.01% 86 2138 0.01% 87 2349 0.01% 88 2426 0.01% 89 2531 0.01% 90 2595 0.02% 91 2828 0.02% 92 3087 0.02% 93 3288 0.02% 94 3727 0.02% 95 3844 0.02% 96 4304 0.03% 97 4491 0.03% 98 4827 0.03% 99 5201 0.03% 100 5607 0.03% 101 5993 0.04% 102 6586 0.04% 103 7118 0.04% 104 7522 0.04% 105 8163 0.05% 106 8952 0.05% 107 9248 0.05% 108 10047 0.06% 109 10920 0.06% 110 11560 0.07% 111 12206 0.07% 112 13066 0.08% 113 13682 0.08% 114 14864 0.09% 115 15818 0.09% 116 16946 0.10% 117 17954 0.11% 118 19235 0.11% 119 20181 0.12% 120 21377 0.13% 121 23178 0.14% 122 24116 0.14% 123 26111 0.15% 124 27558 0.16% 125 29766 0.18% 126 31580 0.19% 127 33573 0.20% 128 35747 0.21% 129 38695 0.23% 130 41553 0.25% 131 44498 0.26% 132 48410 0.29% 133 52263 0.31% 134 57315 0.34% 135 62615 0.37% 136 68502 0.40% 137 75908 0.45% 138 83969 0.50% 139 94295 0.56% 140 106291 0.63% 141 120769 0.71% 142 141191 0.83% 143 167307 0.99% 144 202207 1.19% 145 256173 1.51% 146 341598 2.02% 147 481244 2.84% 148 701753 4.14% 149 1293903 7.64% 150 4713263 27.82% 151 7194216 42.47% 16938977 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=8 prefix-density=0.97 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=22 fanout-score=12.36 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=3.9 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.80 fanout-score-rank=9 prefix-density=0.85 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=118.08 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.1 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR8846542 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:04:07 Started mapping on | Dec 12 03:04:07 Finished on | Dec 12 03:05:38 Mapping speed, Million of reads per hour | 670.11 Number of input reads | 16938977 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16621041 Uniquely mapped reads % | 98.12% Average mapped length | 295.93 Number of splices: Total | 18865844 Number of splices: Annotated (sjdb) | 17815434 Number of splices: GT/AG | 18622895 Number of splices: GC/AG | 220117 Number of splices: AT/AC | 8875 Number of splices: Non-canonical | 13957 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 145122 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 16983 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 180246 180246 180246 N_multimapping 145122 145122 145122 N_noFeature 557911 16159017 681844 N_ambiguous 395341 2339 57760 UnstrandedReadsAssigned:15667789 PositiveStrandReadsAssigned:459685 NegativeStrandReadsAssigned:15881437 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846542 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846542-trimmed-pair1.fastq SRR8846542-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,938,977 reads, 15,925,680 reads pseudoaligned [quant] estimated average fragment length: 281.628 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52973 SRR8846542.ke.tsv 35125 SRR8846542.se.tsv 88098 total ==> SRR8846542.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 655.943 0 0 PNS24247 1044 763.372 48.3195 5.53775 PNS24249 1928 1647.37 23.3703 1.24113 PNS24246 1044 763.372 48.3195 5.53775 PNS24248 1044 763.372 48.3195 5.53775 PNS24244 1471 1190.37 33.6712 2.4747 PNS24243 293 78.0357 0 0 KQK14069 1603 1322.37 2006.1 132.723 KQK14071 474 213.723 95.8472 39.2352 ==> SRR8846542.se.tsv <== BRADI_1g14170v3 2909 BRADI_1g53295v3 68 BRADI_1g59795v3 650 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 2869 BRADI_1g74790v3 72 BRADI_1g09890v3 1 BRADI_1g77505v3 237 BRADI_1g48960v3 0 SRR8846542 completed mapping pipeline successfully