Starting /dee2/code/volunteer_pipeline.sh SRR8846543 current disk space = 1515276800000 free memory = 1601251296 SRR8846543 SRAfilesize fa43b797c4a192685d655b25f856ee1a SRR8846543.sra SRR8846543.sra file validated SRR8846543 is paired end SRR8846543 is conventional basespace SRR8846543 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846543_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.80575 18.0 18.0 25.0 18.0 32.0 2 22.23225 18.0 18.0 27.0 18.0 32.0 3 26.96675 27.0 27.0 29.0 18.0 31.0 4 29.8575 31.0 29.0 31.0 27.0 33.0 5 32.0145 33.0 32.0 33.0 31.0 33.0 6 36.66475 38.0 37.0 38.0 34.0 38.0 7 37.2715 38.0 38.0 38.0 36.0 38.0 8 37.2985 38.0 38.0 38.0 36.0 38.0 9 37.34725 38.0 38.0 38.0 37.0 38.0 10-14 37.29905 38.0 38.0 38.0 36.6 38.0 15-19 37.140299999999996 38.0 38.0 38.0 36.2 38.0 20-24 37.02635 38.0 38.0 38.0 35.6 38.0 25-29 37.072199999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.9505 38.0 38.0 38.0 35.6 38.0 35-39 36.88085 38.0 38.0 38.0 35.4 38.0 40-44 36.652300000000004 38.0 38.0 38.0 34.2 38.0 45-49 36.44465 38.0 37.8 38.0 33.6 38.0 50-54 36.7367 38.0 38.0 38.0 34.4 38.0 55-59 36.56365 38.0 38.0 38.0 34.0 38.0 60-64 36.1989 38.0 37.0 38.0 32.8 38.0 65-69 36.05495 38.0 37.0 38.0 31.4 38.0 70-74 35.731700000000004 38.0 36.4 38.0 29.8 38.0 75-79 35.886199999999995 38.0 36.8 38.0 31.6 38.0 80-84 35.83525 38.0 36.2 38.0 31.0 38.0 85-89 35.534749999999995 38.0 36.0 38.0 29.8 38.0 90-94 34.95545 38.0 35.0 38.0 27.8 38.0 95-99 34.65665 38.0 34.6 38.0 26.6 38.0 100-104 34.75305 38.0 35.0 38.0 26.8 38.0 105-109 34.36704999999999 38.0 34.2 38.0 25.4 38.0 110-114 33.03285 37.2 32.2 38.0 16.2 38.0 115-119 32.356 36.4 30.2 38.0 15.0 38.0 120-124 32.45555 36.6 30.6 38.0 15.0 38.0 125-129 32.1114 36.6 30.0 38.0 15.0 38.0 130-134 31.011949999999995 35.0 27.8 38.0 14.0 38.0 135-139 29.460499999999996 34.6 23.4 38.0 13.2 38.0 140-144 28.4534 34.0 21.8 38.0 8.6 38.0 145-149 26.808699999999998 33.8 16.8 38.0 2.0 38.0 150-151 21.59275 28.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 0.0 16 0.0 17 2.0 18 4.0 19 6.0 20 12.0 21 12.0 22 10.0 23 12.0 24 26.0 25 19.0 26 42.0 27 59.0 28 86.0 29 106.0 30 132.0 31 181.0 32 233.0 33 360.0 34 524.0 35 853.0 36 1018.0 37 299.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.18711656441718 35.60838445807771 5.240286298568507 44.964212678936605 2 19.475 32.0 26.5 22.025 3 20.1 29.475 24.5 25.924999999999997 4 25.0 32.800000000000004 21.625 20.575 5 24.025 33.575 21.825 20.575 6 19.1 34.425 23.599999999999998 22.875 7 14.899999999999999 18.3 43.075 23.724999999999998 8 18.625 20.8 27.875 32.7 9 19.2 20.125 30.55 30.125 10-14 22.62 26.700000000000003 23.59 27.089999999999996 15-19 22.055 26.340000000000003 26.179999999999996 25.424999999999997 20-24 22.220000000000002 26.63 25.865 25.285000000000004 25-29 22.54 26.365 25.840000000000003 25.255 30-34 22.06 26.450000000000003 26.3 25.19 35-39 22.29 26.32 26.555 24.834999999999997 40-44 21.990000000000002 27.01 25.485000000000003 25.515 45-49 22.695 26.085 25.729999999999997 25.490000000000002 50-54 22.58 26.31 25.88 25.230000000000004 55-59 22.305 26.290000000000003 26.119999999999997 25.285000000000004 60-64 21.965 26.135 25.75 26.150000000000002 65-69 22.29 26.105 25.805 25.8 70-74 22.74 26.505000000000003 26.21 24.545 75-79 23.255 25.869999999999997 26.085 24.79 80-84 22.825 25.72 26.14 25.314999999999998 85-89 22.355 25.88 26.21 25.555 90-94 22.495 26.08 25.765 25.66 95-99 23.09 25.509999999999998 25.955000000000002 25.445 100-104 23.11 25.835 25.380000000000003 25.674999999999997 105-109 23.064999999999998 25.845000000000002 25.929999999999996 25.16 110-114 23.119999999999997 25.590000000000003 26.045 25.245 115-119 22.745 25.855 26.064999999999998 25.335 120-124 23.055 25.814999999999998 25.465 25.665 125-129 22.900000000000002 26.035000000000004 25.31 25.755 130-134 22.79 26.045 25.34 25.825 135-139 23.535 25.91 25.41 25.145 140-144 24.02 25.430000000000003 25.05 25.5 145-149 23.025000000000002 25.619999999999997 25.69 25.665 150-151 24.3875 24.9875 25.9875 24.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.5 26 2.0 27 2.0 28 3.5 29 6.5 30 9.0 31 13.5 32 17.5 33 26.5 34 38.0 35 44.0 36 52.5 37 67.0 38 87.0 39 125.0 40 149.0 41 163.0 42 191.0 43 209.5 44 217.0 45 227.0 46 231.5 47 202.5 48 185.0 49 188.5 50 175.0 51 165.0 52 143.5 53 112.5 54 96.0 55 94.5 56 89.5 57 68.0 58 65.5 59 72.0 60 66.0 61 54.5 62 46.5 63 43.5 64 37.0 65 38.5 66 45.0 67 34.5 68 20.0 69 16.5 70 13.5 71 12.0 72 10.5 73 7.5 74 5.0 75 2.0 76 0.5 77 0.0 78 0.0 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.23750000000000002 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.1749999999999998 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.3875 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 2.1375 0.0 0.0 0.0 0.0 132-133 2.275 0.0 0.0 0.0 0.0 134-135 2.45 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 2.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCTA 10 0.006832588 144.9875 4 ATCTCAC 10 0.006832588 144.9875 6 CAAACCT 10 0.006832588 144.9875 3 CAATTCC 20 0.0059376103 28.9975 30-34 >>END_MODULE SRR8846543 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846543_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67175 33.0 33.0 34.0 32.0 34.0 2 32.6605 33.0 33.0 34.0 32.0 34.0 3 32.734 33.0 33.0 34.0 32.0 34.0 4 32.8165 33.0 33.0 34.0 32.0 34.0 5 32.6685 33.0 33.0 34.0 32.0 34.0 6 36.9505 38.0 38.0 38.0 36.0 38.0 7 37.02225 38.0 38.0 38.0 36.0 38.0 8 36.99725 38.0 38.0 38.0 36.0 38.0 9 36.90675 38.0 38.0 38.0 36.0 38.0 10-14 36.8649 38.0 38.0 38.0 35.4 38.0 15-19 36.89335 38.0 38.0 38.0 35.6 38.0 20-24 36.8778 38.0 38.0 38.0 35.6 38.0 25-29 36.754999999999995 38.0 38.0 38.0 34.8 38.0 30-34 36.613299999999995 38.0 38.0 38.0 34.4 38.0 35-39 36.68015 38.0 38.0 38.0 34.8 38.0 40-44 36.607949999999995 38.0 38.0 38.0 34.4 38.0 45-49 36.50735 38.0 38.0 38.0 34.0 38.0 50-54 36.32105 38.0 38.0 38.0 33.2 38.0 55-59 36.128 38.0 37.0 38.0 33.0 38.0 60-64 36.22855 38.0 37.2 38.0 33.2 38.0 65-69 36.32425 38.0 37.4 38.0 33.4 38.0 70-74 36.0465 38.0 37.2 38.0 32.4 38.0 75-79 35.693799999999996 38.0 37.0 38.0 29.8 38.0 80-84 35.778 38.0 36.8 38.0 31.2 38.0 85-89 35.674299999999995 38.0 36.8 38.0 30.8 38.0 90-94 35.344049999999996 38.0 36.2 38.0 29.4 38.0 95-99 34.850899999999996 38.0 35.4 38.0 26.8 38.0 100-104 34.594350000000006 38.0 35.0 38.0 26.0 38.0 105-109 34.42830000000001 38.0 34.6 38.0 25.2 38.0 110-114 34.09054999999999 38.0 34.0 38.0 23.6 38.0 115-119 33.5755 38.0 33.8 38.0 21.8 38.0 120-124 33.03535 37.4 33.0 38.0 17.4 38.0 125-129 32.6169 37.0 32.2 38.0 15.0 38.0 130-134 31.966499999999996 36.0 31.0 38.0 14.0 38.0 135-139 30.8024 35.2 29.2 38.0 13.2 38.0 140-144 29.1829 33.2 24.2 38.0 10.8 38.0 145-149 27.465549999999997 33.0 20.0 38.0 2.0 38.0 150-151 20.103875000000002 25.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 5.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 2.0 12 4.0 13 2.0 14 3.0 15 3.0 16 1.0 17 7.0 18 6.0 19 10.0 20 4.0 21 12.0 22 15.0 23 21.0 24 24.0 25 26.0 26 49.0 27 55.0 28 62.0 29 87.0 30 117.0 31 126.0 32 161.0 33 249.0 34 363.0 35 582.0 36 1036.0 37 960.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.125 14.95 12.325 34.599999999999994 2 29.075 19.275000000000002 32.525 19.125 3 22.775000000000002 23.125 30.7 23.400000000000002 4 25.2 32.85 18.875 23.075000000000003 5 27.575 32.95 19.575 19.900000000000002 6 19.900000000000002 34.75 21.05 24.3 7 19.7 15.375 39.875 25.05 8 21.8 20.375 26.35 31.474999999999998 9 23.549999999999997 20.0 27.975 28.475 10-14 25.495 24.845 23.27 26.39 15-19 25.1 25.324999999999996 25.255 24.32 20-24 25.45 25.88 24.67 24.0 25-29 25.790000000000003 25.840000000000003 24.43 23.94 30-34 26.009999999999998 25.52 24.545 23.925 35-39 25.535000000000004 25.990000000000002 24.75 23.724999999999998 40-44 25.64 24.95 25.645 23.765 45-49 25.3 25.569999999999997 25.435000000000002 23.695 50-54 25.569999999999997 25.324999999999996 24.965 24.14 55-59 25.715 25.28 25.205 23.799999999999997 60-64 26.090000000000003 25.900000000000002 25.205 22.805 65-69 25.779999999999998 25.919999999999998 24.98 23.32 70-74 25.575 25.515 25.365 23.544999999999998 75-79 25.650000000000002 25.424999999999997 25.264999999999997 23.66 80-84 25.805 25.935000000000002 25.2 23.06 85-89 25.31 26.095000000000002 25.115 23.48 90-94 25.4 26.200000000000003 25.525 22.875 95-99 25.94 25.665 25.025 23.369999999999997 100-104 25.61 25.665 25.4 23.325000000000003 105-109 25.990000000000002 25.965 25.145 22.900000000000002 110-114 26.005 25.985000000000003 24.975 23.035 115-119 26.115 25.540000000000003 24.82 23.525 120-124 25.924999999999997 25.825 25.395 22.855 125-129 26.19 25.605 25.595000000000002 22.61 130-134 26.305 25.990000000000002 25.335 22.37 135-139 26.08 25.645 25.89 22.384999999999998 140-144 26.155 26.284999999999997 25.405 22.155 145-149 26.27 25.669999999999998 25.525 22.535 150-151 25.687500000000004 25.95 25.937500000000004 22.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 2.0 28 6.0 29 6.0 30 4.5 31 7.5 32 9.5 33 15.5 34 25.0 35 28.0 36 36.0 37 58.0 38 75.0 39 89.5 40 113.5 41 141.0 42 169.0 43 176.5 44 181.5 45 201.5 46 215.5 47 215.0 48 215.0 49 200.0 50 167.5 51 139.5 52 136.5 53 131.5 54 112.0 55 103.0 56 93.0 57 95.0 58 101.5 59 91.5 60 76.5 61 75.5 62 66.0 63 52.0 64 50.0 65 49.0 66 45.0 67 41.0 68 34.5 69 36.0 70 35.0 71 25.0 72 18.0 73 12.0 74 7.0 75 5.0 76 3.5 77 1.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0125 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.025 0.0 0.0 0.0 0.025 88-89 0.037500000000000006 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.05 0.0 0.0 0.0 0.025 96-97 0.05 0.0 0.0 0.0 0.025 98-99 0.0625 0.0 0.0 0.0 0.025 100-101 0.0875 0.0 0.0 0.0 0.025 102-103 0.125 0.0 0.0 0.0 0.025 104-105 0.2 0.0 0.0 0.0 0.025 106-107 0.275 0.0 0.0 0.0 0.025 108-109 0.375 0.0 0.0 0.0 0.025 110-111 0.5625 0.0 0.0 0.0 0.025 112-113 0.6875 0.0 0.0 0.0 0.025 114-115 0.8875 0.0 0.0 0.0 0.025 116-117 1.0375 0.0 0.0 0.0 0.025 118-119 1.125 0.0 0.0 0.0 0.025 120-121 1.225 0.0 0.0 0.0 0.025 122-123 1.3375 0.0 0.0 0.0 0.025 124-125 1.5125 0.0 0.0 0.0 0.025 126-127 1.5875 0.0 0.0 0.0 0.025 128-129 1.7875 0.0 0.0 0.0 0.025 130-131 2.0625 0.0 0.0 0.0 0.025 132-133 2.225 0.0 0.0 0.0 0.025 134-135 2.375 0.0 0.0 0.0 0.025 136-137 2.6625 0.0 0.0 0.0 0.025 138-139 2.875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAATCT 10 0.006830828 145.0 3 CACCTAC 10 0.006830828 145.0 9 CCTCTCC 20 3.5877043E-4 108.75 1 >>END_MODULE Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930844 spots for SRR8846543.sra Written 930844 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra Read 930827 spots for SRR8846543.sra Written 930827 spots for SRR8846543.sra SRR ids: ['SRR8846543.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7791toya SRR8846543.sra spots: 18616557 blocks: [[1, 930827], [930828, 1861654], [1861655, 2792481], [2792482, 3723308], [3723309, 4654135], [4654136, 5584962], [5584963, 6515789], [6515790, 7446616], [7446617, 8377443], [8377444, 9308270], [9308271, 10239097], [10239098, 11169924], [11169925, 12100751], [12100752, 13031578], [13031579, 13962405], [13962406, 14893232], [14893233, 15824059], [15824060, 16754886], [16754887, 17685713], [17685714, 18616557]] SRR8846543 file size 6286839 SRR8846543 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846543 SRR8846543_1.fastq SRR8846543_2.fastq Input file: SRR8846543_1.fastq Paired file: SRR8846543_2.fastq trimmed: SRR8846543-trimmed-pair1.fastq, SRR8846543-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:01:53 2024 >> started Thu Dec 12 03:02:13 2024 >> done (19.297s) 18616557 read pairs processed; of these: 11233 ( 0.06%) short read pairs filtered out after trimming by size control 10439 ( 0.06%) empty read pairs filtered out after trimming by size control 18594885 (99.88%) read pairs available; of these: 10599025 (57.00%) trimmed read pairs available after processing 7995860 (43.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 11 0.00% 20 7 0.00% 21 13 0.00% 22 5 0.00% 23 5 0.00% 24 4 0.00% 25 11 0.00% 26 7 0.00% 27 6 0.00% 28 19 0.00% 29 19 0.00% 30 14 0.00% 31 12 0.00% 32 15 0.00% 33 19 0.00% 34 16 0.00% 35 9 0.00% 36 16 0.00% 37 18 0.00% 38 19 0.00% 39 10 0.00% 40 12 0.00% 41 19 0.00% 42 18 0.00% 43 15 0.00% 44 25 0.00% 45 21 0.00% 46 21 0.00% 47 33 0.00% 48 28 0.00% 49 32 0.00% 50 37 0.00% 51 43 0.00% 52 40 0.00% 53 46 0.00% 54 41 0.00% 55 57 0.00% 56 59 0.00% 57 57 0.00% 58 75 0.00% 59 89 0.00% 60 80 0.00% 61 108 0.00% 62 106 0.00% 63 142 0.00% 64 144 0.00% 65 163 0.00% 66 168 0.00% 67 181 0.00% 68 245 0.00% 69 251 0.00% 70 294 0.00% 71 321 0.00% 72 345 0.00% 73 428 0.00% 74 436 0.00% 75 527 0.00% 76 605 0.00% 77 677 0.00% 78 714 0.00% 79 819 0.00% 80 896 0.00% 81 1056 0.01% 82 1176 0.01% 83 1338 0.01% 84 1800 0.01% 85 2252 0.01% 86 2287 0.01% 87 2436 0.01% 88 2574 0.01% 89 2839 0.02% 90 2907 0.02% 91 3156 0.02% 92 3421 0.02% 93 3717 0.02% 94 4078 0.02% 95 4437 0.02% 96 4758 0.03% 97 5065 0.03% 98 5343 0.03% 99 5890 0.03% 100 6349 0.03% 101 6501 0.03% 102 7088 0.04% 103 7696 0.04% 104 7923 0.04% 105 8912 0.05% 106 9489 0.05% 107 10321 0.06% 108 10890 0.06% 109 11495 0.06% 110 12082 0.06% 111 13012 0.07% 112 13803 0.07% 113 14788 0.08% 114 15994 0.09% 115 16886 0.09% 116 17884 0.10% 117 18814 0.10% 118 20312 0.11% 119 21416 0.12% 120 22819 0.12% 121 24156 0.13% 122 25841 0.14% 123 27362 0.15% 124 29576 0.16% 125 31431 0.17% 126 33456 0.18% 127 35596 0.19% 128 38226 0.21% 129 40849 0.22% 130 44447 0.24% 131 47474 0.26% 132 51706 0.28% 133 56262 0.30% 134 61030 0.33% 135 66791 0.36% 136 73617 0.40% 137 81707 0.44% 138 90459 0.49% 139 102437 0.55% 140 115087 0.62% 141 130950 0.70% 142 152481 0.82% 143 180127 0.97% 144 216922 1.17% 145 271439 1.46% 146 356531 1.92% 147 504257 2.71% 148 737572 3.97% 149 1398952 7.52% 150 5228599 28.12% 151 7995860 43.00% 18594885 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=24 prefix-density=0.75 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=104.31 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.9 sequence=AAGAAAGAAAGTGATTTTCTCAACTCTTTCAAACTTTTAGGAATTCACATATGCAAGCTAGCTCCTCGATCGAGAGCCAGGTTGCTACACACAACAACAATCTTGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=16 prefix-density=0.68 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=207.51 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=11.5 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR8846543 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:03:11 Started mapping on | Dec 12 03:03:11 Finished on | Dec 12 03:04:25 Mapping speed, Million of reads per hour | 904.62 Number of input reads | 18594885 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18269768 Uniquely mapped reads % | 98.25% Average mapped length | 295.92 Number of splices: Total | 21016215 Number of splices: Annotated (sjdb) | 19870159 Number of splices: GT/AG | 20755896 Number of splices: GC/AG | 234961 Number of splices: AT/AC | 11078 Number of splices: Non-canonical | 14280 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 166583 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 10682 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 165560 165560 165560 N_multimapping 166583 166583 166583 N_noFeature 660714 17798500 806822 N_ambiguous 374188 2539 49817 UnstrandedReadsAssigned:17234866 PositiveStrandReadsAssigned:468729 NegativeStrandReadsAssigned:17413129 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR8846543 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846543-trimmed-pair1.fastq SRR8846543-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,594,885 reads, 17,474,561 reads pseudoaligned [quant] estimated average fragment length: 276.376 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR8846543.ke.tsv 35125 SRR8846543.se.tsv 88098 total ==> SRR8846543.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.05 5.41015 0.673764 PNS24247 1044 768.624 62.7794 6.72411 PNS24249 1928 1652.62 39.7015 1.97772 PNS24246 1044 768.624 62.7794 6.72411 PNS24248 1044 768.624 62.7794 6.72411 PNS24244 1471 1195.62 46.5503 3.20523 PNS24243 293 78.1083 0 0 KQK14069 1603 1327.62 416.985 25.8569 KQK14071 474 215.109 1.40341 0.537103 ==> SRR8846543.se.tsv <== BRADI_1g14170v3 457 BRADI_1g53295v3 23 BRADI_1g59795v3 258 BRADI_1g07683v3 0 BRADI_1g00485v3 52 BRADI_1g20270v3 2577 BRADI_1g74790v3 259 BRADI_1g09890v3 3 BRADI_1g77505v3 237 BRADI_1g48960v3 0 SRR8846543 completed mapping pipeline successfully