Starting /dee2/code/volunteer_pipeline.sh SRR8846544 current disk space = 1529749786624 free memory = 1386727856 SRR8846544 SRAfilesize 1a3dfd1c7b27b011c5514791f896ccd6 SRR8846544.sra SRR8846544.sra file validated SRR8846544 is paired end SRR8846544 is conventional basespace SRR8846544 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846544_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.79925 25.0 18.0 32.0 18.0 33.0 2 26.30375 27.0 18.0 31.0 18.0 33.0 3 29.263 30.0 27.0 31.0 25.0 33.0 4 30.78775 31.0 30.0 33.0 28.0 33.0 5 32.15225 33.0 32.0 33.0 31.0 33.0 6 36.5765 38.0 37.0 38.0 34.0 38.0 7 36.93025 38.0 38.0 38.0 35.0 38.0 8 37.04675 38.0 38.0 38.0 36.0 38.0 9 37.232 38.0 38.0 38.0 36.0 38.0 10-14 37.194950000000006 38.0 38.0 38.0 36.4 38.0 15-19 37.438449999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.5056 38.0 38.0 38.0 37.2 38.0 25-29 37.45865 38.0 38.0 38.0 37.0 38.0 30-34 37.213300000000004 38.0 38.0 38.0 36.8 38.0 35-39 37.1074 38.0 38.0 38.0 36.2 38.0 40-44 37.287549999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.2882 38.0 38.0 38.0 36.6 38.0 50-54 37.207800000000006 38.0 38.0 38.0 36.2 38.0 55-59 37.0519 38.0 38.0 38.0 36.0 38.0 60-64 36.971999999999994 38.0 38.0 38.0 35.4 38.0 65-69 36.99635 38.0 38.0 38.0 35.8 38.0 70-74 36.879450000000006 38.0 38.0 38.0 35.0 38.0 75-79 36.832449999999994 38.0 38.0 38.0 34.6 38.0 80-84 36.38655 38.0 37.6 38.0 33.4 38.0 85-89 36.24665 38.0 37.2 38.0 33.6 38.0 90-94 36.24215 38.0 37.4 38.0 33.4 38.0 95-99 36.45735 38.0 37.6 38.0 34.0 38.0 100-104 36.126850000000005 38.0 37.0 38.0 32.8 38.0 105-109 35.21795 38.0 35.8 38.0 28.8 38.0 110-114 35.43255 38.0 35.8 38.0 29.2 38.0 115-119 35.5586 38.0 36.0 38.0 30.6 38.0 120-124 35.501900000000006 38.0 35.8 38.0 30.2 38.0 125-129 34.606100000000005 38.0 34.8 38.0 26.0 38.0 130-134 33.755950000000006 38.0 34.0 38.0 22.2 38.0 135-139 34.187 38.0 34.2 38.0 24.6 38.0 140-144 33.6805 38.0 34.2 38.0 22.6 38.0 145-149 33.06015000000001 38.0 33.8 38.0 17.4 38.0 150-151 28.035 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 2.0 16 2.0 17 0.0 18 1.0 19 4.0 20 3.0 21 4.0 22 4.0 23 11.0 24 8.0 25 13.0 26 20.0 27 13.0 28 27.0 29 42.0 30 37.0 31 83.0 32 110.0 33 173.0 34 233.0 35 486.0 36 1159.0 37 1563.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.699999999999996 10.174999999999999 9.4 39.725 2 29.025000000000002 15.375 34.949999999999996 20.65 3 19.900000000000002 26.974999999999998 25.474999999999998 27.650000000000002 4 25.0 29.9 19.55 25.55 5 25.6 32.475 21.975 19.950000000000003 6 20.17610062893082 32.40251572327044 24.20125786163522 23.22012578616352 7 17.025000000000002 20.45 39.775 22.75 8 20.549999999999997 19.825 27.925 31.7 9 19.1 20.175 32.7 28.025 10-14 23.25 25.735000000000003 24.345 26.669999999999998 15-19 22.785 25.21 25.674999999999997 26.33 20-24 22.96 25.474999999999998 26.150000000000002 25.415 25-29 23.185 25.019999999999996 25.75 26.045 30-34 22.89 26.200000000000003 25.205 25.705 35-39 23.095 25.435000000000002 25.235000000000003 26.235000000000003 40-44 23.13 25.335 25.705 25.83 45-49 23.09 25.64 25.56 25.71 50-54 22.89 24.959999999999997 26.119999999999997 26.029999999999998 55-59 24.115000000000002 25.324999999999996 24.68 25.88 60-64 23.25 25.75 24.975 26.025 65-69 23.24 25.3 25.545 25.915 70-74 23.93 24.305 25.629999999999995 26.135 75-79 24.145 24.09 25.66 26.105 80-84 23.52 24.834999999999997 25.195 26.450000000000003 85-89 23.875 24.88 25.205 26.040000000000003 90-94 23.625 25.430000000000003 25.165 25.779999999999998 95-99 23.185 25.385 25.885 25.545 100-104 24.03 25.31 24.73 25.929999999999996 105-109 23.635 24.82 25.61 25.935000000000002 110-114 23.53 25.064999999999998 25.380000000000003 26.025 115-119 24.57 25.045 24.84 25.545 120-124 24.19 25.255 24.67 25.885 125-129 24.04 24.97 24.765 26.224999999999998 130-134 23.955000000000002 25.314999999999998 24.995 25.735000000000003 135-139 24.39 25.009999999999998 24.81 25.790000000000003 140-144 24.385 25.21 24.505 25.900000000000002 145-149 24.3 25.490000000000002 24.285 25.924999999999997 150-151 24.912368552829246 24.799699549323986 24.336504757135703 25.951427140711065 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 1.5 25 1.0 26 2.0 27 2.0 28 2.0 29 3.5 30 8.5 31 12.0 32 15.0 33 19.0 34 25.0 35 40.0 36 51.5 37 66.5 38 86.5 39 104.0 40 124.5 41 139.0 42 171.5 43 200.5 44 194.0 45 196.5 46 192.0 47 187.0 48 191.5 49 175.0 50 149.5 51 125.5 52 121.5 53 116.0 54 108.0 55 108.0 56 94.0 57 83.0 58 84.5 59 82.5 60 80.5 61 78.5 62 71.5 63 62.5 64 58.5 65 55.5 66 52.0 67 45.0 68 36.5 69 36.0 70 35.0 71 26.5 72 17.5 73 18.5 74 16.5 75 9.5 76 6.5 77 4.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.625 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.1124999999999998 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.525 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.4625 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 4.1125 0.0 0.0 0.0 0.0 134-135 4.449999999999999 0.0 0.0 0.0 0.0 136-137 4.699999999999999 0.0 0.0 0.0 0.0 138-139 5.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCACA 10 0.006830828 145.0 5 >>END_MODULE SRR8846544 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846544_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73925 33.0 33.0 34.0 32.0 34.0 2 32.68925 33.0 33.0 34.0 32.0 34.0 3 32.9205 33.0 33.0 34.0 32.0 34.0 4 32.86325 33.0 33.0 34.0 32.0 34.0 5 32.9665 34.0 33.0 34.0 32.0 34.0 6 37.20425 38.0 38.0 38.0 36.0 38.0 7 37.16925 38.0 38.0 38.0 36.0 38.0 8 37.27575 38.0 38.0 38.0 37.0 38.0 9 37.2815 38.0 38.0 38.0 37.0 38.0 10-14 37.154250000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.10835 38.0 38.0 38.0 36.2 38.0 20-24 36.9067 38.0 38.0 38.0 36.0 38.0 25-29 36.8032 38.0 38.0 38.0 35.2 38.0 30-34 36.94949999999999 38.0 38.0 38.0 36.0 38.0 35-39 37.02305 38.0 38.0 38.0 36.0 38.0 40-44 36.874750000000006 38.0 38.0 38.0 35.6 38.0 45-49 36.5563 38.0 38.0 38.0 34.2 38.0 50-54 36.5287 38.0 38.0 38.0 34.0 38.0 55-59 36.7044 38.0 38.0 38.0 34.8 38.0 60-64 36.48745 38.0 38.0 38.0 34.0 38.0 65-69 36.50135 38.0 38.0 38.0 34.0 38.0 70-74 36.727450000000005 38.0 38.0 38.0 34.8 38.0 75-79 36.72814999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.6452 38.0 38.0 38.0 34.4 38.0 85-89 36.427 38.0 38.0 38.0 34.0 38.0 90-94 36.224000000000004 38.0 37.8 38.0 33.6 38.0 95-99 35.9912 38.0 37.6 38.0 32.6 38.0 100-104 36.0781 38.0 37.6 38.0 33.2 38.0 105-109 35.6543 38.0 36.6 38.0 31.2 38.0 110-114 35.4314 38.0 36.0 38.0 30.0 38.0 115-119 35.227 38.0 36.0 38.0 28.6 38.0 120-124 35.30465 38.0 35.6 38.0 30.0 38.0 125-129 35.246300000000005 38.0 35.8 38.0 29.6 38.0 130-134 34.74034999999999 38.0 35.0 38.0 27.2 38.0 135-139 34.09395 38.0 34.4 38.0 23.2 38.0 140-144 34.040850000000006 38.0 34.0 38.0 23.8 38.0 145-149 33.59985 38.0 33.0 38.0 22.4 38.0 150-151 29.189 36.0 24.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 3.0 5 0.0 6 2.0 7 1.0 8 0.0 9 1.0 10 0.0 11 3.0 12 3.0 13 0.0 14 1.0 15 1.0 16 3.0 17 4.0 18 5.0 19 5.0 20 6.0 21 7.0 22 7.0 23 6.0 24 19.0 25 11.0 26 27.0 27 29.0 28 26.0 29 30.0 30 57.0 31 84.0 32 99.0 33 120.0 34 200.0 35 360.0 36 691.0 37 2187.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.075 13.600000000000001 14.075 38.25 2 31.4 16.55 31.15 20.9 3 22.0 22.7 29.325000000000003 25.974999999999998 4 25.85 31.025000000000002 19.475 23.65 5 27.224999999999998 32.975 18.25 21.55 6 22.325 33.0 20.325 24.349999999999998 7 20.474999999999998 14.725 38.25 26.55 8 22.175 20.599999999999998 24.65 32.574999999999996 9 22.425 22.175 26.224999999999998 29.175 10-14 25.45 24.735 23.105 26.71 15-19 25.619999999999997 24.36 23.990000000000002 26.029999999999998 20-24 25.474999999999998 24.9 24.279999999999998 25.345000000000002 25-29 26.195 24.43 24.345 25.03 30-34 25.6 24.834999999999997 24.665 24.9 35-39 25.855 24.795 23.544999999999998 25.805 40-44 25.869999999999997 25.430000000000003 23.615 25.085 45-49 26.35 25.1 23.96 24.59 50-54 25.89 24.82 24.605 24.685000000000002 55-59 26.505000000000003 24.765 24.215 24.515 60-64 26.46 24.935 24.224999999999998 24.38 65-69 25.525 24.565 24.58 25.330000000000002 70-74 26.314999999999998 25.155 24.07 24.46 75-79 26.375 25.35 23.9 24.375 80-84 26.235000000000003 24.845 24.145 24.775 85-89 26.47 25.195 23.925 24.41 90-94 25.655 24.95 25.195 24.2 95-99 25.8 25.09 24.45 24.66 100-104 26.007600760076006 24.727472747274728 24.312431243124312 24.952495249524954 105-109 26.498974846226936 24.63369505425814 24.35865379806971 24.508676301445217 110-114 25.73257325732573 25.24252425242524 24.752475247524753 24.272427242724273 115-119 26.245 25.355 24.315 24.085 120-124 26.640000000000004 25.025 24.255 24.08 125-129 26.715 25.64 24.13 23.515 130-134 27.222722272227223 25.422542254225423 24.237423742374236 23.117311731173118 135-139 27.171358567928394 25.65128256412821 23.90119505975299 23.276163808190407 140-144 27.26136306815341 26.021301065053255 24.141207060353018 22.57612880644032 145-149 27.45137256862843 25.391269563478176 24.436221811090554 22.72113605680284 150-151 27.11016631236714 26.297361510566464 23.533825184444165 23.058646992622233 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 2.0 28 3.0 29 2.5 30 6.0 31 10.0 32 11.0 33 16.5 34 22.0 35 30.0 36 42.5 37 51.5 38 61.0 39 75.5 40 102.5 41 132.0 42 143.5 43 157.5 44 173.5 45 188.5 46 190.0 47 179.0 48 176.0 49 171.0 50 153.5 51 130.0 52 123.5 53 115.0 54 105.5 55 103.5 56 102.0 57 96.5 58 94.5 59 98.5 60 92.5 61 81.5 62 75.5 63 81.0 64 88.5 65 72.0 66 65.0 67 69.5 68 59.5 69 54.0 70 53.5 71 42.5 72 30.0 73 21.5 74 14.5 75 9.5 76 6.0 77 5.0 78 2.0 79 1.5 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.015 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.005 140-144 0.005 145-149 0.005 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42080080584236 98.7 2 0.4784688995215311 0.95 3 0.07554772097708386 0.22499999999999998 4 0.0 0.0 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4875 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.125 0.0 0.0 0.0 0.0 124-125 2.45 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.2125 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.625 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra Read 732997 spots for SRR8846544.sra Written 732997 spots for SRR8846544.sra Read 732985 spots for SRR8846544.sra Written 732985 spots for SRR8846544.sra SRR ids: ['SRR8846544.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2miukn0k SRR8846544.sra spots: 14659712 blocks: [[1, 732985], [732986, 1465970], [1465971, 2198955], [2198956, 2931940], [2931941, 3664925], [3664926, 4397910], [4397911, 5130895], [5130896, 5863880], [5863881, 6596865], [6596866, 7329850], [7329851, 8062835], [8062836, 8795820], [8795821, 9528805], [9528806, 10261790], [10261791, 10994775], [10994776, 11727760], [11727761, 12460745], [12460746, 13193730], [13193731, 13926715], [13926716, 14659712]] SRR8846544 file size 4945995 SRR8846544 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846544 SRR8846544_1.fastq SRR8846544_2.fastq Input file: SRR8846544_1.fastq Paired file: SRR8846544_2.fastq trimmed: SRR8846544-trimmed-pair1.fastq, SRR8846544-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 09:32:11 2024 >> started Mon Dec 9 09:33:35 2024 >> done (83.812s) 14659712 read pairs processed; of these: 5550 ( 0.04%) short read pairs filtered out after trimming by size control 3698 ( 0.03%) empty read pairs filtered out after trimming by size control 14650464 (99.94%) read pairs available; of these: 6344715 (43.31%) trimmed read pairs available after processing 8305749 (56.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 6 0.00% 21 5 0.00% 22 6 0.00% 23 6 0.00% 24 7 0.00% 25 9 0.00% 26 6 0.00% 27 8 0.00% 28 7 0.00% 29 7 0.00% 30 12 0.00% 31 22 0.00% 32 6 0.00% 33 8 0.00% 34 7 0.00% 35 10 0.00% 36 9 0.00% 37 17 0.00% 38 10 0.00% 39 12 0.00% 40 6 0.00% 41 17 0.00% 42 10 0.00% 43 18 0.00% 44 14 0.00% 45 21 0.00% 46 17 0.00% 47 21 0.00% 48 16 0.00% 49 42 0.00% 50 39 0.00% 51 49 0.00% 52 31 0.00% 53 44 0.00% 54 32 0.00% 55 58 0.00% 56 45 0.00% 57 61 0.00% 58 79 0.00% 59 111 0.00% 60 98 0.00% 61 122 0.00% 62 128 0.00% 63 145 0.00% 64 161 0.00% 65 161 0.00% 66 164 0.00% 67 218 0.00% 68 222 0.00% 69 261 0.00% 70 278 0.00% 71 356 0.00% 72 394 0.00% 73 481 0.00% 74 569 0.00% 75 645 0.00% 76 683 0.00% 77 824 0.01% 78 831 0.01% 79 988 0.01% 80 1056 0.01% 81 1235 0.01% 82 1470 0.01% 83 1636 0.01% 84 2031 0.01% 85 2362 0.02% 86 2580 0.02% 87 2958 0.02% 88 3094 0.02% 89 3496 0.02% 90 3670 0.03% 91 4049 0.03% 92 4369 0.03% 93 4823 0.03% 94 5473 0.04% 95 5908 0.04% 96 6222 0.04% 97 6980 0.05% 98 7221 0.05% 99 7916 0.05% 100 8466 0.06% 101 9033 0.06% 102 9593 0.07% 103 10029 0.07% 104 11003 0.08% 105 11713 0.08% 106 12815 0.09% 107 13706 0.09% 108 14785 0.10% 109 14988 0.10% 110 16056 0.11% 111 16416 0.11% 112 17449 0.12% 113 18188 0.12% 114 19149 0.13% 115 20313 0.14% 116 21399 0.15% 117 22413 0.15% 118 23375 0.16% 119 24693 0.17% 120 25223 0.17% 121 26638 0.18% 122 27229 0.19% 123 28136 0.19% 124 29966 0.20% 125 31261 0.21% 126 32592 0.22% 127 33749 0.23% 128 35238 0.24% 129 37073 0.25% 130 38469 0.26% 131 40151 0.27% 132 41982 0.29% 133 43722 0.30% 134 46043 0.31% 135 48370 0.33% 136 51048 0.35% 137 53989 0.37% 138 57558 0.39% 139 62722 0.43% 140 66863 0.46% 141 71806 0.49% 142 79864 0.55% 143 89558 0.61% 144 101987 0.70% 145 126029 0.86% 146 163985 1.12% 147 231141 1.58% 148 315751 2.16% 149 673953 4.60% 150 3229835 22.05% 151 8305749 56.69% 14650464 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=9 prefix-density=0.83 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=11.82 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.7 sequence=CCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=12 prefix-density=0.76 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=188.01 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.0 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR8846544 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 09:37:42 Started mapping on | Dec 09 09:37:45 Finished on | Dec 09 09:42:33 Mapping speed, Million of reads per hour | 183.13 Number of input reads | 14650464 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14254910 Uniquely mapped reads % | 97.30% Average mapped length | 295.44 Number of splices: Total | 15806042 Number of splices: Annotated (sjdb) | 14921307 Number of splices: GT/AG | 15607964 Number of splices: GC/AG | 177551 Number of splices: AT/AC | 7569 Number of splices: Non-canonical | 12958 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 155060 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 25462 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 1.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 244179 244179 244179 N_multimapping 155060 155060 155060 N_noFeature 506354 13858403 631760 N_ambiguous 314642 1995 43630 UnstrandedReadsAssigned:13433914 PositiveStrandReadsAssigned:394512 NegativeStrandReadsAssigned:13579520 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR8846544 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846544-trimmed-pair1.fastq SRR8846544-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,650,464 reads, 13,640,918 reads pseudoaligned [quant] estimated average fragment length: 264.232 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52973 SRR8846544.ke.tsv 35125 SRR8846544.se.tsv 88098 total ==> SRR8846544.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.309 0 0 PNS24247 1044 780.768 46.5187 6.21544 PNS24249 1928 1664.77 38.1915 2.3932 PNS24246 1044 780.768 46.5187 6.21544 PNS24248 1044 780.768 46.5187 6.21544 PNS24244 1471 1207.77 34.2524 2.95852 PNS24243 293 89.9463 0 0 KQK14069 1603 1339.77 4143.92 322.663 KQK14071 474 229.62 66.9037 30.3953 ==> SRR8846544.se.tsv <== BRADI_1g14170v3 4710 BRADI_1g53295v3 34 BRADI_1g59795v3 401 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2306 BRADI_1g74790v3 106 BRADI_1g09890v3 4 BRADI_1g77505v3 167 BRADI_1g48960v3 0 SRR8846544 completed mapping pipeline successfully