Starting /dee2/code/volunteer_pipeline.sh SRR8846545 current disk space = 1529429336064 free memory = 1603298768 SRR8846545 SRAfilesize 13c38c65ff8aef623613b25279756873 SRR8846545.sra SRR8846545.sra file validated SRR8846545 is paired end SRR8846545 is conventional basespace SRR8846545 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846545_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.56675 25.0 18.0 32.0 18.0 33.0 2 24.457 25.0 18.0 30.0 18.0 33.0 3 28.5885 29.0 27.0 31.0 25.0 33.0 4 28.044 30.0 27.0 33.0 15.0 33.0 5 31.61 33.0 32.0 33.0 28.0 33.0 6 36.60375 38.0 37.0 38.0 34.0 38.0 7 37.05725 38.0 38.0 38.0 35.0 38.0 8 37.04825 38.0 38.0 38.0 36.0 38.0 9 37.31225 38.0 38.0 38.0 37.0 38.0 10-14 37.17355 38.0 38.0 38.0 36.4 38.0 15-19 37.432550000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.54115 38.0 38.0 38.0 37.4 38.0 25-29 37.4512 38.0 38.0 38.0 37.2 38.0 30-34 37.1894 38.0 38.0 38.0 36.6 38.0 35-39 37.123450000000005 38.0 38.0 38.0 36.2 38.0 40-44 37.28835 38.0 38.0 38.0 36.8 38.0 45-49 37.2629 38.0 38.0 38.0 36.6 38.0 50-54 37.17925 38.0 38.0 38.0 36.0 38.0 55-59 37.05535 38.0 38.0 38.0 36.0 38.0 60-64 36.974650000000004 38.0 38.0 38.0 35.2 38.0 65-69 37.0133 38.0 38.0 38.0 35.6 38.0 70-74 36.927949999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.80015 38.0 38.0 38.0 34.6 38.0 80-84 36.3887 38.0 37.4 38.0 33.4 38.0 85-89 36.228750000000005 38.0 37.0 38.0 33.2 38.0 90-94 36.2082 38.0 37.0 38.0 33.0 38.0 95-99 36.51685 38.0 37.8 38.0 34.0 38.0 100-104 36.153299999999994 38.0 37.2 38.0 33.0 38.0 105-109 35.21385 38.0 35.8 38.0 28.4 38.0 110-114 35.3445 38.0 35.8 38.0 28.8 38.0 115-119 35.61705 38.0 36.0 38.0 31.0 38.0 120-124 35.4756 38.0 35.6 38.0 30.6 38.0 125-129 34.55505000000001 38.0 34.6 38.0 25.8 38.0 130-134 33.77255 38.0 34.0 38.0 21.8 38.0 135-139 34.021499999999996 38.0 34.2 38.0 23.8 38.0 140-144 33.58565 38.0 33.8 38.0 22.0 38.0 145-149 33.0514 37.8 33.8 38.0 18.6 38.0 150-151 27.993250000000003 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 1.0 19 4.0 20 2.0 21 2.0 22 4.0 23 7.0 24 12.0 25 13.0 26 15.0 27 21.0 28 28.0 29 53.0 30 59.0 31 79.0 32 103.0 33 164.0 34 253.0 35 511.0 36 1195.0 37 1472.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.650000000000002 23.025000000000002 8.575000000000001 45.75 2 20.325 26.5 30.775000000000002 22.400000000000002 3 21.55 27.525 23.925 27.0 4 25.575 32.2 21.025 21.2 5 23.974999999999998 33.925 22.475 19.625 6 19.50729009552539 33.23278029160382 24.786324786324787 22.473604826546005 7 15.55 18.9 43.225 22.325 8 18.975 19.925 27.575 33.525 9 19.25 20.925 31.75 28.075 10-14 22.855 26.035000000000004 24.23 26.88 15-19 22.21 26.035000000000004 25.555 26.200000000000003 20-24 22.61 25.990000000000002 26.040000000000003 25.36 25-29 22.12 25.695 26.11 26.075 30-34 22.305 26.035000000000004 26.325 25.335 35-39 22.189999999999998 25.7 27.08 25.03 40-44 22.035 26.029999999999998 26.035000000000004 25.900000000000002 45-49 22.564999999999998 26.474999999999998 25.655 25.305 50-54 22.605 25.979999999999997 25.619999999999997 25.795 55-59 22.95 25.85 26.005 25.195 60-64 22.755 25.5 25.424999999999997 26.32 65-69 22.09 26.38 25.724999999999998 25.805 70-74 22.96 25.009999999999998 26.064999999999998 25.965 75-79 22.5 25.430000000000003 26.13 25.94 80-84 23.28 25.505 25.835 25.380000000000003 85-89 23.037303730373036 26.007600760076006 25.742574257425744 25.212521252125214 90-94 22.445 26.445 25.41 25.7 95-99 23.665 25.27 25.650000000000002 25.415 100-104 23.425 25.575 25.895000000000003 25.105 105-109 23.32 25.474999999999998 25.44 25.765 110-114 23.46 25.324999999999996 26.275 24.94 115-119 22.925 25.069999999999997 25.814999999999998 26.19 120-124 23.43 25.45 25.869999999999997 25.25 125-129 23.345 25.205 25.71 25.740000000000002 130-134 23.515 25.224999999999998 25.695 25.564999999999998 135-139 23.905 25.424999999999997 25.509999999999998 25.16 140-144 23.785 25.305 25.39 25.52 145-149 24.0 24.990000000000002 25.650000000000002 25.36 150-151 23.967975981986488 25.869402051538653 24.756067050287715 25.40655491618714 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 2.5 28 5.0 29 7.5 30 12.5 31 12.5 32 16.5 33 28.5 34 34.0 35 41.0 36 58.0 37 80.5 38 98.0 39 116.5 40 151.5 41 171.5 42 186.0 43 196.5 44 188.0 45 201.0 46 197.0 47 189.5 48 206.5 49 200.0 50 168.5 51 141.5 52 123.5 53 104.0 54 93.5 55 91.0 56 86.0 57 83.5 58 88.5 59 83.5 60 69.0 61 58.0 62 48.5 63 44.5 64 46.0 65 43.5 66 37.5 67 37.0 68 33.5 69 19.5 70 20.5 71 25.5 72 15.5 73 9.0 74 10.5 75 9.0 76 3.0 77 0.5 78 0.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5499999999999999 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26860025220681 98.4 2 0.6305170239596469 1.25 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.125 0.0 0.0 0.0 0.0 128-129 1.3 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.7 0.0 0.0 0.0 0.0 134-135 1.8 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGTC 10 0.006830828 145.0 9 >>END_MODULE SRR8846545 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846545_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75325 33.0 33.0 34.0 32.0 34.0 2 32.71975 33.0 33.0 34.0 32.0 34.0 3 32.9115 34.0 33.0 34.0 32.0 34.0 4 32.979 34.0 33.0 34.0 32.0 34.0 5 33.00325 34.0 33.0 34.0 32.0 34.0 6 37.282 38.0 38.0 38.0 37.0 38.0 7 37.224 38.0 38.0 38.0 37.0 38.0 8 37.29 38.0 38.0 38.0 37.0 38.0 9 37.2495 38.0 38.0 38.0 37.0 38.0 10-14 37.2303 38.0 38.0 38.0 37.0 38.0 15-19 37.1336 38.0 38.0 38.0 36.4 38.0 20-24 36.939949999999996 38.0 38.0 38.0 35.8 38.0 25-29 36.86130000000001 38.0 38.0 38.0 35.6 38.0 30-34 36.97255 38.0 38.0 38.0 36.0 38.0 35-39 37.07365 38.0 38.0 38.0 36.0 38.0 40-44 36.80615 38.0 38.0 38.0 35.6 38.0 45-49 36.6015 38.0 38.0 38.0 34.4 38.0 50-54 36.67524999999999 38.0 38.0 38.0 34.8 38.0 55-59 36.6952 38.0 38.0 38.0 34.8 38.0 60-64 36.572950000000006 38.0 38.0 38.0 34.4 38.0 65-69 36.53225 38.0 38.0 38.0 34.2 38.0 70-74 36.695049999999995 38.0 38.0 38.0 35.0 38.0 75-79 36.761199999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.686 38.0 38.0 38.0 34.8 38.0 85-89 36.4935 38.0 38.0 38.0 34.4 38.0 90-94 36.257999999999996 38.0 38.0 38.0 33.6 38.0 95-99 36.04345 38.0 37.4 38.0 32.8 38.0 100-104 36.188 38.0 37.8 38.0 33.8 38.0 105-109 35.737449999999995 38.0 36.6 38.0 31.8 38.0 110-114 35.530150000000006 38.0 36.4 38.0 30.8 38.0 115-119 35.32015 38.0 36.0 38.0 29.4 38.0 120-124 35.31825 38.0 36.0 38.0 29.8 38.0 125-129 35.322 38.0 36.0 38.0 30.6 38.0 130-134 34.65565 38.0 35.0 38.0 26.8 38.0 135-139 34.24475 38.0 34.8 38.0 24.0 38.0 140-144 34.1661 38.0 34.4 38.0 24.2 38.0 145-149 33.50815 38.0 33.0 38.0 22.6 38.0 150-151 29.364125 36.0 27.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 3.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 2.0 11 1.0 12 1.0 13 1.0 14 3.0 15 1.0 16 3.0 17 2.0 18 7.0 19 4.0 20 7.0 21 2.0 22 6.0 23 5.0 24 13.0 25 9.0 26 25.0 27 35.0 28 24.0 29 42.0 30 49.0 31 77.0 32 95.0 33 132.0 34 201.0 35 296.0 36 684.0 37 2262.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.8 14.025000000000002 11.95 37.225 2 28.975 19.775000000000002 30.825000000000003 20.424999999999997 3 22.625 23.875 29.349999999999998 24.15 4 26.8 31.025000000000002 19.15 23.025000000000002 5 26.174999999999997 33.225 19.950000000000003 20.65 6 21.0 33.300000000000004 21.425 24.275 7 19.925 14.725 39.25 26.1 8 21.375 21.25 24.349999999999998 33.025 9 23.1 21.6 26.6 28.7 10-14 26.44 24.895 22.465 26.200000000000003 15-19 25.71 24.91 24.45 24.93 20-24 25.345000000000002 26.395000000000003 23.72 24.54 25-29 25.755 25.474999999999998 24.415 24.355 30-34 25.285000000000004 25.555 24.665 24.495 35-39 25.47 25.900000000000002 24.255 24.375 40-44 26.36 24.86 24.435000000000002 24.345 45-49 26.25 25.105 24.345 24.3 50-54 25.674999999999997 25.295 24.88 24.15 55-59 25.264999999999997 24.86 24.990000000000002 24.884999999999998 60-64 25.900000000000002 25.465 24.605 24.03 65-69 25.605 24.94 25.369999999999997 24.085 70-74 25.590000000000003 25.09 24.94 24.38 75-79 26.27 25.205 24.735 23.79 80-84 26.169999999999998 25.66 24.529999999999998 23.64 85-89 26.265 25.2 24.7 23.835 90-94 25.615 25.27 25.045 24.07 95-99 25.790000000000003 25.779999999999998 24.21 24.22 100-104 25.50755075507551 25.63256325632563 24.66246624662466 24.197419741974198 105-109 25.94018803760752 25.275055011002202 25.135027005401078 23.649729945989197 110-114 26.238935840376055 25.448817322598387 24.948742311346702 23.363504525678852 115-119 25.57255725572557 25.842584258425845 25.082508250825082 23.502350235023503 120-124 25.509999999999998 25.840000000000003 25.235000000000003 23.415 125-129 26.064999999999998 24.884999999999998 25.515 23.535 130-134 26.0976097609761 25.81258125812581 24.71747174717472 23.37233723372337 135-139 26.131306565328266 25.99129956497825 25.02125106255313 22.856142807140355 140-144 26.3913195659783 25.461273063653184 25.301265063253165 22.846142307115354 145-149 26.3976397639764 26.44264426442644 24.872487248724873 22.28722872287229 150-151 25.740717589698715 25.678209776222026 25.353169146143266 23.22790348793599 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 1.5 29 5.5 30 9.0 31 11.0 32 14.0 33 13.5 34 15.5 35 29.5 36 49.0 37 53.5 38 72.0 39 100.5 40 107.5 41 129.0 42 149.5 43 153.0 44 172.5 45 201.0 46 205.0 47 186.0 48 182.5 49 187.0 50 167.5 51 146.5 52 134.0 53 117.0 54 110.5 55 100.5 56 89.0 57 87.5 58 89.5 59 90.0 60 88.0 61 87.0 62 82.5 63 77.5 64 72.5 65 63.0 66 55.0 67 52.0 68 49.0 69 46.0 70 42.0 71 31.5 72 23.5 73 18.0 74 9.5 75 7.0 76 4.5 77 2.5 78 1.0 79 0.0 80 1.5 81 1.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.02 110-114 0.015 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.005 140-144 0.005 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19191919191918 98.2 2 0.6818181818181818 1.35 3 0.07575757575757576 0.22499999999999998 4 0.025252525252525252 0.1 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.6625000000000001 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.9625 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.5125 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.725 0.0 0.0 0.0 0.0 136-137 1.8875 0.0 0.0 0.0 0.0 138-139 2.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710070 spots for SRR8846545.sra Written 710070 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra Read 710058 spots for SRR8846545.sra Written 710058 spots for SRR8846545.sra SRR ids: ['SRR8846545.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0zyb7nt6 SRR8846545.sra spots: 14201172 blocks: [[1, 710058], [710059, 1420116], [1420117, 2130174], [2130175, 2840232], [2840233, 3550290], [3550291, 4260348], [4260349, 4970406], [4970407, 5680464], [5680465, 6390522], [6390523, 7100580], [7100581, 7810638], [7810639, 8520696], [8520697, 9230754], [9230755, 9940812], [9940813, 10650870], [10650871, 11360928], [11360929, 12070986], [12070987, 12781044], [12781045, 13491102], [13491103, 14201172]] SRR8846545 file size 4790610 SRR8846545 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846545 SRR8846545_1.fastq SRR8846545_2.fastq Input file: SRR8846545_1.fastq Paired file: SRR8846545_2.fastq trimmed: SRR8846545-trimmed-pair1.fastq, SRR8846545-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 09:37:01 2024 >> started Mon Dec 9 09:37:16 2024 >> done (14.665s) 14201172 read pairs processed; of these: 5166 ( 0.04%) short read pairs filtered out after trimming by size control 2947 ( 0.02%) empty read pairs filtered out after trimming by size control 14193059 (99.94%) read pairs available; of these: 5649771 (39.81%) trimmed read pairs available after processing 8543288 (60.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 9 0.00% 20 4 0.00% 21 12 0.00% 22 4 0.00% 23 6 0.00% 24 5 0.00% 25 6 0.00% 26 6 0.00% 27 4 0.00% 28 10 0.00% 29 6 0.00% 30 11 0.00% 31 7 0.00% 32 11 0.00% 33 7 0.00% 34 9 0.00% 35 5 0.00% 36 6 0.00% 37 6 0.00% 38 8 0.00% 39 5 0.00% 40 17 0.00% 41 8 0.00% 42 20 0.00% 43 12 0.00% 44 12 0.00% 45 23 0.00% 46 15 0.00% 47 20 0.00% 48 11 0.00% 49 18 0.00% 50 14 0.00% 51 31 0.00% 52 21 0.00% 53 20 0.00% 54 22 0.00% 55 27 0.00% 56 45 0.00% 57 39 0.00% 58 40 0.00% 59 54 0.00% 60 60 0.00% 61 58 0.00% 62 65 0.00% 63 72 0.00% 64 84 0.00% 65 90 0.00% 66 97 0.00% 67 98 0.00% 68 104 0.00% 69 134 0.00% 70 157 0.00% 71 160 0.00% 72 169 0.00% 73 188 0.00% 74 216 0.00% 75 268 0.00% 76 286 0.00% 77 310 0.00% 78 318 0.00% 79 358 0.00% 80 425 0.00% 81 513 0.00% 82 540 0.00% 83 647 0.00% 84 980 0.01% 85 1167 0.01% 86 1151 0.01% 87 1264 0.01% 88 1368 0.01% 89 1541 0.01% 90 1613 0.01% 91 1722 0.01% 92 1933 0.01% 93 2027 0.01% 94 2194 0.02% 95 2346 0.02% 96 2586 0.02% 97 2787 0.02% 98 2920 0.02% 99 3244 0.02% 100 3425 0.02% 101 3765 0.03% 102 4084 0.03% 103 4230 0.03% 104 4602 0.03% 105 5001 0.04% 106 5561 0.04% 107 5821 0.04% 108 6305 0.04% 109 6642 0.05% 110 7245 0.05% 111 7640 0.05% 112 7987 0.06% 113 8510 0.06% 114 9124 0.06% 115 9870 0.07% 116 10352 0.07% 117 11169 0.08% 118 11611 0.08% 119 12144 0.09% 120 12669 0.09% 121 13568 0.10% 122 14413 0.10% 123 15117 0.11% 124 15899 0.11% 125 16695 0.12% 126 17673 0.12% 127 18647 0.13% 128 19893 0.14% 129 21176 0.15% 130 22735 0.16% 131 23613 0.17% 132 25331 0.18% 133 26809 0.19% 134 28922 0.20% 135 31506 0.22% 136 34340 0.24% 137 36183 0.25% 138 40180 0.28% 139 44020 0.31% 140 47339 0.33% 141 53206 0.37% 142 60718 0.43% 143 69265 0.49% 144 82329 0.58% 145 108213 0.76% 146 143189 1.01% 147 213149 1.50% 148 294590 2.08% 149 660353 4.65% 150 3256064 22.94% 151 8543288 60.19% 14193059 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=11 prefix-density=0.87 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=123.97 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.0 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.58 fanout-score-rank=10 prefix-density=0.75 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=33.17 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.8 sequence=AGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR8846545 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 09:37:55 Started mapping on | Dec 09 09:37:55 Finished on | Dec 09 09:39:25 Mapping speed, Million of reads per hour | 567.72 Number of input reads | 14193059 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13757616 Uniquely mapped reads % | 96.93% Average mapped length | 297.70 Number of splices: Total | 15621638 Number of splices: Annotated (sjdb) | 14762194 Number of splices: GT/AG | 15426115 Number of splices: GC/AG | 176057 Number of splices: AT/AC | 7462 Number of splices: Non-canonical | 12004 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 137405 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 16395 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 301624 301624 301624 N_multimapping 137405 137405 137405 N_noFeature 493734 13391026 592203 N_ambiguous 311856 1908 44019 UnstrandedReadsAssigned:12952026 PositiveStrandReadsAssigned:364682 NegativeStrandReadsAssigned:13121394 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR8846545 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846545-trimmed-pair1.fastq SRR8846545-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,193,059 reads, 13,176,209 reads pseudoaligned [quant] estimated average fragment length: 283.16 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52973 SRR8846545.ke.tsv 35125 SRR8846545.se.tsv 88098 total ==> SRR8846545.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.51 0 0 PNS24247 1044 761.84 46.2526 6.55682 PNS24249 1928 1645.84 23.3807 1.53423 PNS24246 1044 761.84 46.2526 6.55682 PNS24248 1044 761.84 46.2526 6.55682 PNS24244 1471 1188.84 39.8614 3.62118 PNS24243 293 76.8927 0 0 KQK14069 1603 1320.84 3310.76 270.706 KQK14071 474 212.452 58.0138 29.4911 ==> SRR8846545.se.tsv <== BRADI_1g14170v3 3860 BRADI_1g53295v3 42 BRADI_1g59795v3 472 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2280 BRADI_1g74790v3 105 BRADI_1g09890v3 1 BRADI_1g77505v3 212 BRADI_1g48960v3 0 SRR8846545 completed mapping pipeline successfully