Starting /dee2/code/volunteer_pipeline.sh SRR8846546 current disk space = 1529178853376 free memory = 1593467396 SRR8846546 SRAfilesize c78277136f2380d84ce64bc52ccb613e SRR8846546.sra SRR8846546.sra file validated SRR8846546 is paired end SRR8846546 is conventional basespace SRR8846546 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846546_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.635 30.0 18.0 32.0 18.0 33.0 2 29.81625 31.0 29.0 33.0 25.0 33.0 3 30.366 31.0 29.0 33.0 25.0 33.0 4 31.822 33.0 31.0 33.0 29.0 34.0 5 32.66975 33.0 33.0 33.0 32.0 34.0 6 36.48825 38.0 38.0 38.0 35.0 38.0 7 36.8555 38.0 38.0 38.0 35.0 38.0 8 36.9575 38.0 38.0 38.0 35.0 38.0 9 37.07225 38.0 38.0 38.0 36.0 38.0 10-14 37.078 38.0 38.0 38.0 35.6 38.0 15-19 37.3966 38.0 38.0 38.0 37.2 38.0 20-24 37.5037 38.0 38.0 38.0 37.6 38.0 25-29 37.4124 38.0 38.0 38.0 37.2 38.0 30-34 37.1044 38.0 38.0 38.0 36.2 38.0 35-39 37.0743 38.0 38.0 38.0 36.2 38.0 40-44 37.1944 38.0 38.0 38.0 36.4 38.0 45-49 37.204449999999994 38.0 38.0 38.0 36.4 38.0 50-54 37.103950000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.9375 38.0 38.0 38.0 35.4 38.0 60-64 36.884100000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.98285 38.0 38.0 38.0 35.6 38.0 70-74 36.8121 38.0 38.0 38.0 35.0 38.0 75-79 36.722950000000004 38.0 38.0 38.0 34.6 38.0 80-84 36.2197 38.0 37.4 38.0 33.2 38.0 85-89 36.05215 38.0 37.0 38.0 32.6 38.0 90-94 36.16625 38.0 37.0 38.0 33.0 38.0 95-99 36.442699999999995 38.0 38.0 38.0 34.0 38.0 100-104 35.996950000000005 38.0 37.0 38.0 32.4 38.0 105-109 34.93375 38.0 35.2 38.0 27.0 38.0 110-114 35.31055 38.0 35.6 38.0 28.6 38.0 115-119 35.67655 38.0 36.2 38.0 31.0 38.0 120-124 35.35635 38.0 35.6 38.0 29.6 38.0 125-129 34.34545 38.0 34.6 38.0 24.6 38.0 130-134 33.70365 38.0 34.0 38.0 21.8 38.0 135-139 34.15745 38.0 34.2 38.0 23.8 38.0 140-144 33.592200000000005 38.0 34.0 38.0 22.2 38.0 145-149 32.8956 38.0 33.6 38.0 16.8 38.0 150-151 28.005000000000003 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 2.0 17 0.0 18 6.0 19 1.0 20 1.0 21 4.0 22 4.0 23 10.0 24 10.0 25 13.0 26 18.0 27 27.0 28 32.0 29 47.0 30 50.0 31 74.0 32 116.0 33 167.0 34 263.0 35 442.0 36 1003.0 37 1705.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.025000000000002 13.700000000000001 13.375 41.9 2 25.45 19.675 34.2 20.674999999999997 3 20.4 25.7 27.325 26.575 4 24.10602650662666 32.283070767691925 20.905226306576644 22.705676419104776 5 24.05 33.975 23.400000000000002 18.575 6 19.115044247787612 33.6283185840708 25.10745891276865 22.149178255372945 7 16.150000000000002 20.625 40.849999999999994 22.375 8 19.725 20.8 28.65 30.825000000000003 9 18.6 20.0 33.7 27.700000000000003 10-14 23.275000000000002 25.240000000000002 24.68 26.805 15-19 22.675 26.400000000000002 25.729999999999997 25.195 20-24 22.220000000000002 25.805 26.47 25.505 25-29 22.605 26.215 26.3 24.88 30-34 21.935 26.405 26.05 25.61 35-39 22.545 26.915 25.455 25.085 40-44 22.27 25.845000000000002 26.490000000000002 25.395 45-49 22.97 26.634999999999998 25.590000000000003 24.805 50-54 22.325 26.165 26.740000000000002 24.77 55-59 22.38 26.565 25.5 25.555 60-64 23.04 25.44 25.990000000000002 25.53 65-69 22.975 25.985000000000003 25.97 25.069999999999997 70-74 23.35 25.75 26.015 24.884999999999998 75-79 23.18 25.83 25.555 25.435000000000002 80-84 22.830000000000002 26.005 26.284999999999997 24.88 85-89 23.82 25.465 25.230000000000004 25.485000000000003 90-94 22.93 25.535000000000004 25.955000000000002 25.580000000000002 95-99 22.965 25.245 26.06 25.729999999999997 100-104 23.119999999999997 25.305 26.174999999999997 25.4 105-109 23.02 25.46 25.900000000000002 25.619999999999997 110-114 22.93 25.685000000000002 25.305 26.08 115-119 22.814999999999998 25.995 25.840000000000003 25.35 120-124 23.335 25.305 25.595000000000002 25.765 125-129 23.305 25.445 25.629999999999995 25.619999999999997 130-134 23.24 25.55 25.525 25.685000000000002 135-139 23.93 25.555 25.135 25.380000000000003 140-144 23.565 25.590000000000003 25.4 25.445 145-149 23.45 25.755 24.865000000000002 25.929999999999996 150-151 24.030037546933666 24.881101376720903 24.881101376720903 26.207759699624532 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 1.0 26 2.0 27 1.5 28 2.0 29 6.0 30 9.5 31 9.0 32 16.0 33 27.5 34 36.5 35 45.0 36 61.0 37 80.5 38 95.5 39 111.5 40 134.0 41 161.0 42 184.5 43 203.0 44 203.0 45 213.5 46 230.0 47 219.0 48 195.0 49 176.0 50 160.5 51 148.0 52 132.5 53 114.0 54 101.5 55 96.0 56 94.0 57 81.5 58 68.5 59 57.5 60 56.0 61 58.5 62 49.5 63 45.0 64 47.5 65 45.0 66 44.0 67 39.0 68 28.5 69 25.0 70 19.5 71 16.0 72 15.0 73 8.5 74 4.5 75 3.0 76 4.0 77 5.0 78 2.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 1.125 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.1625 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.8375 0.0 0.0 0.0 0.0 134-135 3.1875 0.0 0.0 0.0 0.0 136-137 3.6125 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8846546 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846546_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66725 33.0 33.0 34.0 32.0 34.0 2 32.627 33.0 33.0 34.0 32.0 34.0 3 32.901 34.0 33.0 34.0 32.0 34.0 4 32.9475 34.0 33.0 34.0 32.0 34.0 5 33.003 34.0 33.0 34.0 32.0 34.0 6 37.13875 38.0 38.0 38.0 36.0 38.0 7 37.1055 38.0 38.0 38.0 37.0 38.0 8 37.28725 38.0 38.0 38.0 37.0 38.0 9 37.177 38.0 38.0 38.0 37.0 38.0 10-14 37.189099999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.0518 38.0 38.0 38.0 36.0 38.0 20-24 36.8686 38.0 38.0 38.0 35.6 38.0 25-29 36.771 38.0 38.0 38.0 35.2 38.0 30-34 36.98215 38.0 38.0 38.0 36.0 38.0 35-39 36.9489 38.0 38.0 38.0 36.0 38.0 40-44 36.711200000000005 38.0 38.0 38.0 34.8 38.0 45-49 36.48875 38.0 38.0 38.0 34.0 38.0 50-54 36.562799999999996 38.0 38.0 38.0 34.2 38.0 55-59 36.65775 38.0 38.0 38.0 34.6 38.0 60-64 36.39020000000001 38.0 37.8 38.0 33.4 38.0 65-69 36.39425 38.0 38.0 38.0 34.0 38.0 70-74 36.6426 38.0 38.0 38.0 34.6 38.0 75-79 36.65845 38.0 38.0 38.0 35.0 38.0 80-84 36.60424999999999 38.0 38.0 38.0 34.8 38.0 85-89 36.42285 38.0 38.0 38.0 34.0 38.0 90-94 36.150150000000004 38.0 37.8 38.0 33.2 38.0 95-99 35.9795 38.0 37.6 38.0 32.6 38.0 100-104 36.01135000000001 38.0 37.4 38.0 33.0 38.0 105-109 35.61285 38.0 36.4 38.0 31.2 38.0 110-114 35.38865 38.0 36.0 38.0 29.6 38.0 115-119 35.1892 38.0 36.0 38.0 28.4 38.0 120-124 35.2298 38.0 36.0 38.0 29.4 38.0 125-129 35.2599 38.0 36.0 38.0 30.0 38.0 130-134 34.51455 38.0 35.0 38.0 25.4 38.0 135-139 34.046800000000005 38.0 34.6 38.0 23.0 38.0 140-144 34.05605 38.0 34.4 38.0 24.0 38.0 145-149 33.39315 38.0 33.0 38.0 20.4 38.0 150-151 28.95975 35.5 24.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 3.0 12 2.0 13 4.0 14 1.0 15 1.0 16 4.0 17 9.0 18 3.0 19 5.0 20 2.0 21 10.0 22 11.0 23 12.0 24 16.0 25 23.0 26 29.0 27 29.0 28 41.0 29 35.0 30 59.0 31 67.0 32 87.0 33 134.0 34 205.0 35 293.0 36 684.0 37 2225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.9 13.175 12.7 38.224999999999994 2 28.499999999999996 18.775 32.175 20.549999999999997 3 21.675 23.474999999999998 29.2 25.650000000000002 4 25.374999999999996 30.975 19.35 24.3 5 26.900000000000002 32.475 20.375 20.25 6 20.825 33.275 22.025 23.875 7 19.55 14.875 40.425 25.15 8 21.825 20.724999999999998 25.3 32.15 9 22.975 20.575 28.349999999999998 28.1 10-14 25.785000000000004 24.435000000000002 22.720000000000002 27.060000000000002 15-19 25.75 24.45 24.560000000000002 25.240000000000002 20-24 25.019999999999996 25.255 24.675 25.05 25-29 25.94 25.755 24.21 24.095 30-34 25.47 25.4 24.9 24.23 35-39 24.865000000000002 25.44 24.87 24.825 40-44 26.064999999999998 25.3 24.095 24.54 45-49 25.8 25.555 24.735 23.91 50-54 25.474999999999998 26.340000000000003 24.095 24.09 55-59 25.825 25.840000000000003 24.63 23.705000000000002 60-64 25.779999999999998 25.28 25.35 23.59 65-69 25.995 25.695 24.51 23.799999999999997 70-74 26.295 25.45 24.375 23.880000000000003 75-79 25.575 25.53 25.235000000000003 23.66 80-84 26.14 25.385 24.98 23.494999999999997 85-89 25.715 25.130000000000003 25.11 24.044999999999998 90-94 26.174999999999997 25.635 25.295 22.895 95-99 26.205000000000002 25.955000000000002 24.82 23.02 100-104 26.08630431521576 25.85629281464073 24.566228311415568 23.491174558727938 105-109 25.995 25.56 25.095 23.35 110-114 25.715 26.229999999999997 25.045 23.01 115-119 25.31 25.505 25.245 23.94 120-124 25.525 25.874999999999996 25.509999999999998 23.09 125-129 26.38 25.135 25.185000000000002 23.3 130-134 26.36 25.924999999999997 24.63 23.085 135-139 25.535000000000004 26.179999999999996 25.185000000000002 23.1 140-144 25.85 26.490000000000002 25.19 22.470000000000002 145-149 26.814022103315498 25.923888583287493 25.023753563034457 22.238335750362552 150-151 27.24431107776944 25.85646411602901 25.406351587896975 21.492873218304574 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 0.5 26 1.0 27 1.5 28 1.0 29 4.0 30 8.0 31 10.0 32 15.0 33 20.5 34 24.5 35 29.0 36 37.5 37 51.5 38 70.5 39 93.5 40 116.0 41 130.5 42 148.0 43 164.0 44 183.0 45 206.5 46 209.5 47 193.0 48 168.5 49 178.5 50 176.5 51 144.5 52 139.5 53 126.5 54 109.0 55 113.5 56 102.0 57 88.0 58 86.0 59 84.0 60 88.0 61 77.0 62 74.0 63 71.5 64 60.0 65 65.5 66 63.5 67 50.5 68 43.0 69 40.5 70 34.0 71 26.0 72 23.0 73 17.5 74 9.5 75 5.0 76 3.5 77 2.5 78 2.5 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.015 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74899598393574 99.35000000000001 2 0.2008032128514056 0.4 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0251004016064257 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.1749999999999998 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 3.1625 0.0125 0.0 0.0 0.0 136-137 3.5875000000000004 0.025 0.0 0.0 0.0 138-139 4.125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACTT 10 0.006830828 145.0 7 CACTTTC 10 0.006830828 145.0 3 GACGAAG 10 0.006830828 145.0 3 CCCCACT 10 0.006830828 145.0 6 AAGCCCC 10 0.006830828 145.0 3 >>END_MODULE Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958115 spots for SRR8846546.sra Written 958115 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra Read 958100 spots for SRR8846546.sra Written 958100 spots for SRR8846546.sra SRR ids: ['SRR8846546.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ltop9_8f SRR8846546.sra spots: 19162015 blocks: [[1, 958100], [958101, 1916200], [1916201, 2874300], [2874301, 3832400], [3832401, 4790500], [4790501, 5748600], [5748601, 6706700], [6706701, 7664800], [7664801, 8622900], [8622901, 9581000], [9581001, 10539100], [10539101, 11497200], [11497201, 12455300], [12455301, 13413400], [13413401, 14371500], [14371501, 15329600], [15329601, 16287700], [16287701, 17245800], [17245801, 18203900], [18203901, 19162015]] SRR8846546 file size 6471677 SRR8846546 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846546 SRR8846546_1.fastq SRR8846546_2.fastq Input file: SRR8846546_1.fastq Paired file: SRR8846546_2.fastq trimmed: SRR8846546-trimmed-pair1.fastq, SRR8846546-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 09:44:18 2024 >> started Mon Dec 9 09:44:38 2024 >> done (19.935s) 19162015 read pairs processed; of these: 10151 ( 0.05%) short read pairs filtered out after trimming by size control 7676 ( 0.04%) empty read pairs filtered out after trimming by size control 19144188 (99.91%) read pairs available; of these: 8003747 (41.81%) trimmed read pairs available after processing 11140441 (58.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 10 0.00% 21 14 0.00% 22 10 0.00% 23 10 0.00% 24 15 0.00% 25 11 0.00% 26 10 0.00% 27 10 0.00% 28 6 0.00% 29 12 0.00% 30 12 0.00% 31 7 0.00% 32 12 0.00% 33 10 0.00% 34 12 0.00% 35 13 0.00% 36 12 0.00% 37 15 0.00% 38 14 0.00% 39 13 0.00% 40 18 0.00% 41 17 0.00% 42 17 0.00% 43 24 0.00% 44 18 0.00% 45 23 0.00% 46 23 0.00% 47 25 0.00% 48 28 0.00% 49 39 0.00% 50 47 0.00% 51 56 0.00% 52 47 0.00% 53 56 0.00% 54 52 0.00% 55 57 0.00% 56 75 0.00% 57 74 0.00% 58 71 0.00% 59 100 0.00% 60 100 0.00% 61 114 0.00% 62 116 0.00% 63 143 0.00% 64 150 0.00% 65 152 0.00% 66 175 0.00% 67 187 0.00% 68 206 0.00% 69 269 0.00% 70 274 0.00% 71 307 0.00% 72 375 0.00% 73 403 0.00% 74 504 0.00% 75 482 0.00% 76 584 0.00% 77 699 0.00% 78 728 0.00% 79 850 0.00% 80 946 0.00% 81 1051 0.01% 82 1208 0.01% 83 1379 0.01% 84 1896 0.01% 85 2269 0.01% 86 2483 0.01% 87 2663 0.01% 88 2939 0.02% 89 3219 0.02% 90 3240 0.02% 91 3489 0.02% 92 3734 0.02% 93 4162 0.02% 94 4446 0.02% 95 5000 0.03% 96 5243 0.03% 97 5909 0.03% 98 6102 0.03% 99 6692 0.03% 100 7221 0.04% 101 7785 0.04% 102 8196 0.04% 103 8691 0.05% 104 9189 0.05% 105 10079 0.05% 106 11098 0.06% 107 11877 0.06% 108 12741 0.07% 109 13379 0.07% 110 14478 0.08% 111 14979 0.08% 112 15865 0.08% 113 16372 0.09% 114 17373 0.09% 115 18450 0.10% 116 19835 0.10% 117 20564 0.11% 118 21878 0.11% 119 23243 0.12% 120 24302 0.13% 121 25833 0.13% 122 26854 0.14% 123 27568 0.14% 124 29183 0.15% 125 30540 0.16% 126 31946 0.17% 127 33863 0.18% 128 35550 0.19% 129 37254 0.19% 130 39982 0.21% 131 41446 0.22% 132 44575 0.23% 133 46910 0.25% 134 50104 0.26% 135 53020 0.28% 136 57176 0.30% 137 60522 0.32% 138 65457 0.34% 139 71518 0.37% 140 77514 0.40% 141 85157 0.44% 142 96189 0.50% 143 108765 0.57% 144 127620 0.67% 145 158003 0.83% 146 215193 1.12% 147 302379 1.58% 148 420521 2.20% 149 909647 4.75% 150 4309862 22.51% 151 11140441 58.19% 19144188 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=16 prefix-density=0.49 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=162.32 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=18.2 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=30 prefix-density=0.72 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=631.08 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=20.1 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846546 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 09:45:18 Started mapping on | Dec 09 09:45:18 Finished on | Dec 09 09:47:36 Mapping speed, Million of reads per hour | 499.41 Number of input reads | 19144188 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18550606 Uniquely mapped reads % | 96.90% Average mapped length | 296.74 Number of splices: Total | 21363647 Number of splices: Annotated (sjdb) | 20048004 Number of splices: GT/AG | 21083292 Number of splices: GC/AG | 251568 Number of splices: AT/AC | 12101 Number of splices: Non-canonical | 16686 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 180598 % of reads mapped to multiple loci | 0.94% Number of reads mapped to too many loci | 9309 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.78% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 419211 419211 419211 N_multimapping 180598 180598 180598 N_noFeature 653220 18047447 804351 N_ambiguous 414466 2832 62642 UnstrandedReadsAssigned:17482920 PositiveStrandReadsAssigned:500327 NegativeStrandReadsAssigned:17683613 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR8846546 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846546-trimmed-pair1.fastq SRR8846546-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,144,188 reads, 17,784,408 reads pseudoaligned [quant] estimated average fragment length: 277.772 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52973 SRR8846546.ke.tsv 35125 SRR8846546.se.tsv 88098 total ==> SRR8846546.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.86 0 0 PNS24247 1044 767.228 81.3662 8.4842 PNS24249 1928 1651.23 43.6008 2.11241 PNS24246 1044 767.228 81.3662 8.4842 PNS24248 1044 767.228 81.3662 8.4842 PNS24244 1471 1194.23 35.3006 2.36476 PNS24243 293 82.6669 0 0 KQK14069 1603 1326.23 9135.74 551.083 KQK14071 474 219.298 125.628 45.829 ==> SRR8846546.se.tsv <== BRADI_1g14170v3 10154 BRADI_1g53295v3 154 BRADI_1g59795v3 612 BRADI_1g07683v3 0 BRADI_1g00485v3 52 BRADI_1g20270v3 4571 BRADI_1g74790v3 129 BRADI_1g09890v3 1 BRADI_1g77505v3 341 BRADI_1g48960v3 0 SRR8846546 completed mapping pipeline successfully