Starting /dee2/code/volunteer_pipeline.sh SRR8846547 current disk space = 1528966868992 free memory = 1413535736 SRR8846547 SRAfilesize e355cb4b489e0289b93d35c59d0300f0 SRR8846547.sra SRR8846547.sra file validated SRR8846547 is paired end SRR8846547 is conventional basespace SRR8846547 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846547_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.8725 18.0 18.0 31.0 18.0 32.0 2 29.39025 30.0 27.0 33.0 27.0 33.0 3 30.56825 31.0 29.0 33.0 27.0 33.0 4 31.60975 33.0 32.0 33.0 30.0 33.0 5 32.30625 33.0 33.0 33.0 31.0 34.0 6 36.76625 38.0 37.0 38.0 34.0 38.0 7 37.1015 38.0 38.0 38.0 36.0 38.0 8 37.3175 38.0 38.0 38.0 36.0 38.0 9 37.35525 38.0 38.0 38.0 37.0 38.0 10-14 37.28075 38.0 38.0 38.0 36.6 38.0 15-19 37.16495 38.0 38.0 38.0 36.0 38.0 20-24 37.20265 38.0 38.0 38.0 36.2 38.0 25-29 37.444500000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.365700000000004 38.0 38.0 38.0 36.8 38.0 35-39 37.178700000000006 38.0 38.0 38.0 36.4 38.0 40-44 36.948350000000005 38.0 38.0 38.0 35.6 38.0 45-49 37.03215 38.0 38.0 38.0 35.6 38.0 50-54 36.96375 38.0 38.0 38.0 35.4 38.0 55-59 36.82965 38.0 38.0 38.0 34.8 38.0 60-64 36.5754 38.0 38.0 38.0 34.0 38.0 65-69 36.539849999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.453599999999994 38.0 37.8 38.0 33.8 38.0 75-79 36.442949999999996 38.0 37.4 38.0 33.6 38.0 80-84 36.31225 38.0 37.0 38.0 33.6 38.0 85-89 36.19645 38.0 37.0 38.0 32.6 38.0 90-94 35.53645 38.0 36.0 38.0 29.8 38.0 95-99 35.350049999999996 38.0 35.8 38.0 29.2 38.0 100-104 35.29774999999999 38.0 35.6 38.0 29.0 38.0 105-109 34.9929 38.0 34.8 38.0 28.0 38.0 110-114 34.2029 38.0 34.2 38.0 24.0 38.0 115-119 33.61155 38.0 33.8 38.0 19.0 38.0 120-124 33.2826 37.2 33.2 38.0 17.8 38.0 125-129 33.17615 36.8 33.0 38.0 17.8 38.0 130-134 32.19925 36.0 31.4 38.0 15.0 38.0 135-139 30.688350000000003 35.4 26.4 38.0 14.0 38.0 140-144 29.932500000000005 35.0 25.0 38.0 13.6 38.0 145-149 28.92215 34.2 24.6 38.0 6.4 38.0 150-151 23.711 30.5 7.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 3.0 21 5.0 22 7.0 23 12.0 24 20.0 25 20.0 26 32.0 27 35.0 28 59.0 29 76.0 30 94.0 31 121.0 32 179.0 33 294.0 34 397.0 35 683.0 36 1175.0 37 780.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.68767687162336 27.218934911242602 8.103936197581682 42.98945201955235 2 23.625 21.475 32.7 22.2 3 19.625 26.450000000000003 23.25 30.675 4 23.45 33.85 20.200000000000003 22.5 5 24.006001500375092 33.58339584896224 22.330582645661416 20.080020005001252 6 18.099999999999998 33.7 25.5 22.7 7 15.675 20.0 41.9 22.425 8 20.05 20.424999999999997 28.025 31.5 9 19.950000000000003 20.3 31.05 28.7 10-14 22.59 26.215 24.425 26.77 15-19 22.545 26.35 25.82 25.285000000000004 20-24 22.445 26.619999999999997 25.430000000000003 25.505 25-29 22.564999999999998 26.525 26.0 24.91 30-34 22.35 26.06 26.245 25.345000000000002 35-39 22.38 26.455000000000002 25.795 25.369999999999997 40-44 22.555 26.38 26.240000000000002 24.825 45-49 22.055 26.029999999999998 26.14 25.775 50-54 22.965 25.64 26.5 24.895 55-59 22.919999999999998 25.685000000000002 26.025 25.369999999999997 60-64 22.415 26.265 25.75 25.569999999999997 65-69 22.855 26.345000000000002 25.480000000000004 25.319999999999997 70-74 23.25 26.36 25.575 24.815 75-79 22.455 26.32 25.895000000000003 25.330000000000002 80-84 22.71 26.045 26.135 25.11 85-89 22.57 25.650000000000002 26.41 25.369999999999997 90-94 22.865 25.81 26.045 25.28 95-99 22.725 26.055 25.77 25.45 100-104 23.200000000000003 25.924999999999997 25.955000000000002 24.92 105-109 23.805 25.36 25.575 25.259999999999998 110-114 23.43 25.605 25.935000000000002 25.03 115-119 23.150000000000002 26.245 25.445 25.16 120-124 23.335 25.515 25.845000000000002 25.305 125-129 23.080000000000002 26.19 24.62 26.11 130-134 22.93 25.900000000000002 25.735000000000003 25.435000000000002 135-139 23.46 25.895000000000003 25.445 25.2 140-144 23.13 25.86 25.174999999999997 25.835 145-149 23.86 25.45 25.395 25.295 150-151 24.0375 25.374999999999996 24.837500000000002 25.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 2.5 28 3.5 29 7.0 30 11.0 31 12.5 32 17.0 33 25.0 34 31.0 35 42.0 36 60.0 37 75.0 38 82.5 39 113.0 40 149.5 41 166.0 42 200.5 43 205.5 44 203.0 45 231.5 46 228.0 47 213.5 48 200.0 49 181.5 50 158.0 51 137.5 52 134.5 53 130.0 54 115.5 55 98.5 56 87.0 57 79.5 58 64.0 59 53.5 60 61.5 61 56.5 62 47.0 63 41.0 64 42.0 65 42.0 66 33.0 67 30.0 68 25.5 69 22.5 70 20.5 71 15.0 72 12.5 73 12.0 74 8.0 75 4.0 76 2.0 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.3625 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.95 0.0 0.0 0.0 0.0 120-121 2.35 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.0875 0.0 0.0 0.0 0.0 126-127 3.4625000000000004 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.2375 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.55 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAAA 10 0.006577216 146.82278 1 >>END_MODULE SRR8846547 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846547_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7205 33.0 33.0 34.0 32.0 34.0 2 32.68925 33.0 33.0 34.0 32.0 34.0 3 32.89375 34.0 33.0 34.0 32.0 34.0 4 32.80825 33.0 33.0 34.0 32.0 34.0 5 32.8135 34.0 33.0 34.0 32.0 34.0 6 36.944 38.0 38.0 38.0 36.0 38.0 7 36.9965 38.0 38.0 38.0 36.0 38.0 8 36.988 38.0 38.0 38.0 36.0 38.0 9 37.0145 38.0 38.0 38.0 36.0 38.0 10-14 37.0122 38.0 38.0 38.0 36.0 38.0 15-19 37.0327 38.0 38.0 38.0 36.0 38.0 20-24 37.00625 38.0 38.0 38.0 36.0 38.0 25-29 36.89 38.0 38.0 38.0 35.8 38.0 30-34 36.80994999999999 38.0 38.0 38.0 35.4 38.0 35-39 36.80455 38.0 38.0 38.0 35.2 38.0 40-44 36.8015 38.0 38.0 38.0 35.2 38.0 45-49 36.74125 38.0 38.0 38.0 34.8 38.0 50-54 36.49295 38.0 38.0 38.0 34.0 38.0 55-59 36.31195 38.0 38.0 38.0 33.4 38.0 60-64 36.2583 38.0 37.6 38.0 33.2 38.0 65-69 36.523250000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.3859 38.0 38.0 38.0 33.8 38.0 75-79 35.97735 38.0 37.0 38.0 32.2 38.0 80-84 36.0231 38.0 37.0 38.0 33.0 38.0 85-89 35.853 38.0 37.0 38.0 31.6 38.0 90-94 35.735 38.0 36.8 38.0 31.4 38.0 95-99 35.37065 38.0 36.0 38.0 29.6 38.0 100-104 34.808550000000004 38.0 35.0 38.0 27.0 38.0 105-109 34.88505 38.0 35.4 38.0 27.2 38.0 110-114 34.540499999999994 38.0 34.8 38.0 26.0 38.0 115-119 33.9587 38.0 34.0 38.0 23.2 38.0 120-124 33.310199999999995 38.0 33.4 38.0 17.4 38.0 125-129 32.97005 37.6 32.6 38.0 15.0 38.0 130-134 32.2898 36.6 31.8 38.0 14.4 38.0 135-139 30.786 35.2 28.8 38.0 13.4 38.0 140-144 29.5805 34.0 26.4 38.0 10.4 38.0 145-149 27.59855 33.0 20.0 38.0 2.0 38.0 150-151 20.81425 26.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 2.0 15 5.0 16 5.0 17 1.0 18 5.0 19 10.0 20 10.0 21 10.0 22 25.0 23 14.0 24 18.0 25 23.0 26 35.0 27 65.0 28 49.0 29 76.0 30 98.0 31 125.0 32 142.0 33 214.0 34 322.0 35 557.0 36 1106.0 37 1068.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.3 13.450000000000001 13.975000000000001 37.275000000000006 2 29.075 19.400000000000002 32.7 18.825 3 23.474999999999998 22.575 28.075 25.874999999999996 4 26.025 30.3 19.7 23.974999999999998 5 27.025 32.975 19.625 20.375 6 21.349999999999998 34.699999999999996 21.349999999999998 22.6 7 20.65 15.275 40.550000000000004 23.525 8 22.325 21.224999999999998 25.35 31.1 9 22.375 22.025 27.875 27.725 10-14 25.564999999999998 24.465 23.919999999999998 26.05 15-19 25.53 25.465 24.465 24.54 20-24 25.415 25.215 25.014999999999997 24.355 25-29 24.740000000000002 25.669999999999998 25.145 24.445 30-34 25.915 25.474999999999998 25.25 23.36 35-39 25.419999999999998 25.61 25.085 23.885 40-44 24.915000000000003 25.83 25.39 23.865 45-49 25.474999999999998 25.575 25.025 23.925 50-54 25.650000000000002 25.900000000000002 25.34 23.11 55-59 25.424999999999997 26.200000000000003 25.05 23.325000000000003 60-64 25.935000000000002 25.505 25.155 23.405 65-69 25.105 26.305 25.3 23.29 70-74 25.7 25.45 25.605 23.244999999999997 75-79 25.650000000000002 25.775 25.174999999999997 23.400000000000002 80-84 25.795 25.335 25.790000000000003 23.080000000000002 85-89 26.245 25.69 25.324999999999996 22.74 90-94 25.330000000000002 25.650000000000002 25.82 23.200000000000003 95-99 26.179999999999996 25.56 24.84 23.419999999999998 100-104 25.35 25.740000000000002 25.545 23.365 105-109 25.3 26.174999999999997 24.805 23.72 110-114 25.69 25.94 25.575 22.795 115-119 26.064999999999998 25.955000000000002 25.27 22.71 120-124 25.814999999999998 25.715 25.755 22.715 125-129 26.665 26.325 24.529999999999998 22.48 130-134 26.595000000000002 26.265 24.73 22.41 135-139 26.31 26.779999999999998 25.035 21.875 140-144 27.065 25.775 25.155 22.005 145-149 27.0 25.86 25.955000000000002 21.185000000000002 150-151 27.125 25.2 25.9875 21.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.0 24 0.5 25 0.5 26 0.5 27 1.5 28 4.0 29 6.5 30 8.5 31 8.0 32 9.0 33 11.5 34 24.0 35 37.0 36 40.5 37 59.0 38 77.5 39 96.0 40 121.5 41 153.5 42 171.0 43 180.0 44 197.0 45 210.0 46 216.0 47 206.5 48 189.5 49 172.5 50 163.0 51 149.5 52 140.5 53 123.5 54 104.5 55 106.0 56 90.5 57 77.0 58 82.5 59 79.5 60 72.0 61 67.0 62 63.0 63 67.5 64 74.5 65 58.5 66 45.0 67 45.5 68 43.0 69 35.5 70 25.5 71 23.0 72 18.5 73 10.0 74 9.5 75 9.0 76 4.0 77 1.5 78 2.0 79 1.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.3518471977883891 0.7000000000000001 3 0.050263885398341285 0.15 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.9750000000000001 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.1500000000000004 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 3.9625000000000004 0.0 0.0 0.0 0.0 130-131 4.35 0.0 0.0 0.0 0.0 132-133 4.7625 0.0 0.0 0.0 0.0 134-135 5.1625 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 6.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899238 spots for SRR8846547.sra Written 899238 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra Read 899230 spots for SRR8846547.sra Written 899230 spots for SRR8846547.sra SRR ids: ['SRR8846547.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_whkv_9ny SRR8846547.sra spots: 17984608 blocks: [[1, 899230], [899231, 1798460], [1798461, 2697690], [2697691, 3596920], [3596921, 4496150], [4496151, 5395380], [5395381, 6294610], [6294611, 7193840], [7193841, 8093070], [8093071, 8992300], [8992301, 9891530], [9891531, 10790760], [10790761, 11689990], [11689991, 12589220], [12589221, 13488450], [13488451, 14387680], [14387681, 15286910], [15286911, 16186140], [16186141, 17085370], [17085371, 17984608]] SRR8846547 file size 6072693 SRR8846547 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846547 SRR8846547_1.fastq SRR8846547_2.fastq Input file: SRR8846547_1.fastq Paired file: SRR8846547_2.fastq trimmed: SRR8846547-trimmed-pair1.fastq, SRR8846547-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 09:53:39 2024 >> started Mon Dec 9 09:55:15 2024 >> done (96.485s) 17984608 read pairs processed; of these: 10078 ( 0.06%) short read pairs filtered out after trimming by size control 7791 ( 0.04%) empty read pairs filtered out after trimming by size control 17966739 (99.90%) read pairs available; of these: 10663092 (59.35%) trimmed read pairs available after processing 7303647 (40.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 6 0.00% 21 12 0.00% 22 6 0.00% 23 4 0.00% 24 9 0.00% 25 6 0.00% 26 6 0.00% 27 6 0.00% 28 5 0.00% 29 5 0.00% 30 4 0.00% 31 4 0.00% 32 5 0.00% 33 9 0.00% 34 7 0.00% 35 8 0.00% 36 7 0.00% 37 7 0.00% 38 10 0.00% 39 10 0.00% 40 13 0.00% 41 22 0.00% 42 17 0.00% 43 10 0.00% 44 20 0.00% 45 15 0.00% 46 23 0.00% 47 22 0.00% 48 29 0.00% 49 37 0.00% 50 38 0.00% 51 32 0.00% 52 49 0.00% 53 63 0.00% 54 55 0.00% 55 57 0.00% 56 65 0.00% 57 80 0.00% 58 83 0.00% 59 86 0.00% 60 115 0.00% 61 149 0.00% 62 168 0.00% 63 162 0.00% 64 185 0.00% 65 189 0.00% 66 249 0.00% 67 275 0.00% 68 297 0.00% 69 335 0.00% 70 362 0.00% 71 459 0.00% 72 516 0.00% 73 641 0.00% 74 664 0.00% 75 782 0.00% 76 915 0.01% 77 930 0.01% 78 1109 0.01% 79 1259 0.01% 80 1374 0.01% 81 1576 0.01% 82 1954 0.01% 83 2189 0.01% 84 2803 0.02% 85 3303 0.02% 86 3518 0.02% 87 3938 0.02% 88 4194 0.02% 89 4538 0.03% 90 4878 0.03% 91 5455 0.03% 92 5868 0.03% 93 6443 0.04% 94 7129 0.04% 95 7871 0.04% 96 8629 0.05% 97 9243 0.05% 98 10012 0.06% 99 10698 0.06% 100 11673 0.06% 101 12673 0.07% 102 13731 0.08% 103 14461 0.08% 104 15673 0.09% 105 16799 0.09% 106 18421 0.10% 107 19660 0.11% 108 20481 0.11% 109 22043 0.12% 110 23085 0.13% 111 23859 0.13% 112 25682 0.14% 113 26726 0.15% 114 28865 0.16% 115 30210 0.17% 116 31953 0.18% 117 33126 0.18% 118 34783 0.19% 119 36921 0.21% 120 38086 0.21% 121 40594 0.23% 122 42040 0.23% 123 44165 0.25% 124 46173 0.26% 125 47940 0.27% 126 50426 0.28% 127 52900 0.29% 128 55959 0.31% 129 58078 0.32% 130 61461 0.34% 131 65237 0.36% 132 68736 0.38% 133 72553 0.40% 134 77423 0.43% 135 82083 0.46% 136 88599 0.49% 137 95292 0.53% 138 103972 0.58% 139 114099 0.64% 140 125062 0.70% 141 140053 0.78% 142 159054 0.89% 143 183395 1.02% 144 217060 1.21% 145 271983 1.51% 146 356224 1.98% 147 492421 2.74% 148 715869 3.98% 149 1311760 7.30% 150 4807237 26.76% 151 7303647 40.65% 17966739 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=15 prefix-density=0.32 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=178.61 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=17.9 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=31 prefix-density=0.56 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=618.72 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=20.1 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846547 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 09:59:04 Started mapping on | Dec 09 09:59:05 Finished on | Dec 09 10:04:26 Mapping speed, Million of reads per hour | 201.50 Number of input reads | 17966739 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17693598 Uniquely mapped reads % | 98.48% Average mapped length | 293.83 Number of splices: Total | 19898584 Number of splices: Annotated (sjdb) | 18654200 Number of splices: GT/AG | 19637154 Number of splices: GC/AG | 234276 Number of splices: AT/AC | 11841 Number of splices: Non-canonical | 15313 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169198 % of reads mapped to multiple loci | 0.94% Number of reads mapped to too many loci | 9675 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.26% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 110618 110618 110618 N_multimapping 169198 169198 169198 N_noFeature 672754 17214093 822990 N_ambiguous 387140 2517 58076 UnstrandedReadsAssigned:16633704 PositiveStrandReadsAssigned:476988 NegativeStrandReadsAssigned:16812532 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR8846547 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846547-trimmed-pair1.fastq SRR8846547-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,966,739 reads, 16,903,329 reads pseudoaligned [quant] estimated average fragment length: 257.126 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52973 SRR8846547.ke.tsv 35125 SRR8846547.se.tsv 88098 total ==> SRR8846547.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 680.391 3.22062 0.408389 PNS24247 1044 787.874 73.5863 8.05812 PNS24249 1928 1671.87 53.5197 2.76187 PNS24246 1044 787.874 73.5863 8.05812 PNS24248 1044 787.874 73.5863 8.05812 PNS24244 1471 1214.87 52.5007 3.72844 PNS24243 293 91.9575 0 0 KQK14069 1603 1346.87 9079.52 581.606 KQK14071 474 233.78 120.889 44.6141 ==> SRR8846547.se.tsv <== BRADI_1g14170v3 10291 BRADI_1g53295v3 176 BRADI_1g59795v3 616 BRADI_1g07683v3 0 BRADI_1g00485v3 71 BRADI_1g20270v3 4195 BRADI_1g74790v3 140 BRADI_1g09890v3 6 BRADI_1g77505v3 314 BRADI_1g48960v3 1 SRR8846547 completed mapping pipeline successfully