Starting /dee2/code/volunteer_pipeline.sh SRR8846548 current disk space = 1528961622016 free memory = 1597679856 SRR8846548 SRAfilesize cf77cba842218dfa28e823fd1ae92560 SRR8846548.sra SRR8846548.sra file validated SRR8846548 is single end SRR8846548 is conventional basespace SRR8846548 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846548_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.72925 33.0 32.0 33.0 29.0 34.0 2 32.662 33.0 32.0 34.0 32.0 34.0 3 32.88875 33.0 32.0 34.0 32.0 34.0 4 32.9135 33.0 32.0 34.0 32.0 34.0 5 32.50225 33.0 32.0 34.0 32.0 34.0 6 35.14225 37.0 33.0 37.0 32.0 37.0 7 35.08275 37.0 33.0 37.0 32.0 37.0 8 35.23375 37.0 33.0 37.0 33.0 37.0 9 35.27675 37.0 34.0 37.0 33.0 37.0 10 35.353 37.0 34.0 37.0 33.0 37.0 11 35.4835 37.0 34.0 37.0 33.0 37.0 12 35.5845 37.0 34.0 37.0 33.0 37.0 13 37.4665 38.0 38.0 38.0 37.0 38.0 14 37.54025 38.0 38.0 38.0 37.0 38.0 15 37.5195 38.0 38.0 38.0 37.0 38.0 16 37.51975 38.0 38.0 38.0 37.0 38.0 17 37.51225 38.0 38.0 38.0 37.0 38.0 18 37.56625 38.0 38.0 38.0 37.0 38.0 19 37.48125 38.0 38.0 38.0 37.0 38.0 20 37.4765 38.0 38.0 38.0 37.0 38.0 21 37.4475 38.0 38.0 38.0 37.0 38.0 22 37.49275 38.0 38.0 38.0 37.0 38.0 23 38.248 39.0 38.0 39.0 37.0 39.0 24 38.244 39.0 38.0 39.0 37.0 39.0 25 38.1385 39.0 38.0 39.0 37.0 39.0 26 38.22175 39.0 38.0 39.0 37.0 39.0 27 38.136 39.0 38.0 39.0 37.0 39.0 28 38.0885 39.0 38.0 39.0 37.0 39.0 29 38.21875 39.0 38.0 39.0 37.0 39.0 30 38.09525 39.0 38.0 39.0 37.0 39.0 31 38.16325 39.0 38.0 39.0 37.0 39.0 32 38.14025 39.0 38.0 39.0 37.0 39.0 33 38.00175 39.0 38.0 39.0 37.0 39.0 34 38.0025 39.0 38.0 39.0 37.0 39.0 35 38.0365 39.0 38.0 39.0 37.0 39.0 36 37.975 39.0 38.0 39.0 37.0 39.0 37 37.968 39.0 38.0 39.0 37.0 39.0 38 38.065 39.0 38.0 39.0 37.0 39.0 39 38.007 39.0 38.0 39.0 37.0 39.0 40 38.06575 39.0 38.0 39.0 37.0 39.0 41 38.1095 39.0 38.0 39.0 37.0 39.0 42 38.065 39.0 38.0 39.0 37.0 39.0 43 38.04075 39.0 38.0 39.0 37.0 39.0 44 37.9735 39.0 38.0 39.0 37.0 39.0 45 37.92975 39.0 38.0 39.0 37.0 39.0 46 37.95375 39.0 38.0 39.0 37.0 39.0 47 37.973 39.0 38.0 39.0 37.0 39.0 48 37.86475 39.0 38.0 39.0 37.0 39.0 49 37.82575 39.0 38.0 39.0 37.0 39.0 50 37.9215 39.0 38.0 39.0 37.0 39.0 51 37.45575 39.0 38.0 39.0 37.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 0.0 23 0.0 24 1.0 25 4.0 26 1.0 27 10.0 28 9.0 29 13.0 30 25.0 31 27.0 32 45.0 33 62.0 34 95.0 35 143.0 36 462.0 37 3041.0 38 59.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.725 13.225000000000001 42.8 13.25 2 35.099999999999994 14.149999999999999 36.775000000000006 13.975000000000001 3 36.75 14.424999999999999 36.449999999999996 12.375 4 36.475 14.149999999999999 36.05 13.325000000000001 5 36.275 14.75 35.35 13.625000000000002 6 36.475 13.675 37.175000000000004 12.675 7 36.15 12.049999999999999 38.05 13.750000000000002 8 33.650000000000006 13.275 38.925 14.149999999999999 9 32.775 13.100000000000001 39.225 14.899999999999999 10 30.175 12.925 41.025 15.875 11 28.7 16.05 38.9 16.35 12 29.599999999999998 18.525 36.375 15.5 13 24.75 21.675 39.050000000000004 14.524999999999999 14 23.0 22.400000000000002 40.225 14.374999999999998 15 24.15 22.0 37.574999999999996 16.275000000000002 16 22.775000000000002 23.0 37.775 16.45 17 25.124999999999996 22.95 36.375 15.55 18 24.275 23.724999999999998 36.3 15.7 19 25.074999999999996 22.85 36.9 15.174999999999999 20 24.325 25.224999999999998 34.65 15.8 21 24.075 23.825 34.275 17.825 22 23.375 24.95 34.775 16.900000000000002 23 23.125 23.799999999999997 34.9 18.175 24 24.224999999999998 24.224999999999998 34.050000000000004 17.5 25 24.5 23.65 33.775 18.075 26 24.3 24.349999999999998 34.625 16.725 27 24.325 23.599999999999998 34.075 18.0 28 22.95 25.224999999999998 34.75 17.075000000000003 29 23.974999999999998 23.825 34.975 17.224999999999998 30 24.875 23.150000000000002 35.375 16.6 31 23.5 25.45 34.4 16.650000000000002 32 22.45 25.3 34.8 17.45 33 23.05 25.025 34.2 17.724999999999998 34 23.45 25.5 34.575 16.475 35 23.35 24.55 34.9 17.2 36 23.674999999999997 24.6 33.825 17.9 37 22.650000000000002 24.825 35.275 17.25 38 23.275000000000002 25.775 33.425 17.525 39 22.0 25.674999999999997 34.525 17.8 40 22.8 26.174999999999997 34.2 16.825000000000003 41 22.1 25.7 34.225 17.974999999999998 42 22.525000000000002 26.05 33.95 17.474999999999998 43 22.425 26.55 32.725 18.3 44 21.9 27.250000000000004 33.1 17.75 45 22.1 27.525 33.425 16.950000000000003 46 21.2 28.65 33.125 17.025000000000002 47 20.7 27.525 33.925 17.849999999999998 48 23.175 26.724999999999998 31.025000000000002 19.075 49 21.45 28.1 32.95 17.5 50 21.9 27.875 32.975 17.25 51 21.45 28.625 32.05 17.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 2.0 14 3.0 15 2.0 16 1.0 17 4.0 18 7.0 19 8.5 20 10.0 21 12.0 22 14.0 23 21.5 24 29.0 25 32.0 26 50.5 27 66.0 28 75.0 29 84.0 30 115.5 31 147.0 32 196.0 33 245.0 34 283.5 35 322.0 36 335.5 37 349.0 38 360.5 39 372.0 40 385.0 41 398.0 42 406.0 43 414.0 44 381.5 45 349.0 46 329.5 47 310.0 48 271.5 49 233.0 50 209.0 51 185.0 52 152.5 53 120.0 54 95.5 55 71.0 56 74.0 57 77.0 58 65.5 59 54.0 60 41.5 61 29.0 62 24.5 63 20.0 64 18.0 65 16.0 66 15.0 67 14.0 68 12.5 69 11.0 70 9.0 71 7.0 72 4.0 73 1.0 74 2.0 75 1.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24337957124843 98.375 2 0.6809583858764187 1.35 3 0.025220680958385876 0.075 4 0.05044136191677175 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.125 0.0 0.0 0.0 0.0 29 0.25 0.0 0.0 0.0 0.0 30 0.275 0.0 0.0 0.0 0.0 31 0.325 0.0 0.0 0.0 0.0 32 0.4 0.0 0.0 0.0 0.0 33 0.425 0.0 0.0 0.0 0.0 34 0.5 0.0 0.0 0.0 0.0 35 0.575 0.0 0.0 0.0 0.0 36 0.575 0.0 0.0 0.0 0.0 37 0.575 0.0 0.0 0.0 0.0 38 0.575 0.0 0.0 0.0 0.0 39 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270939 READS because READLEN < 1 Read 270939 spots for SRR8846548.sra Written 270939 spots for SRR8846548.sra Rejected 270943 READS because READLEN < 1 Read 270943 spots for SRR8846548.sra Written 270943 spots for SRR8846548.sra SRR ids: ['SRR8846548.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nsm00w87 SRR8846548.sra spots: 5418784 blocks: [[1, 270939], [270940, 541878], [541879, 812817], [812818, 1083756], [1083757, 1354695], [1354696, 1625634], [1625635, 1896573], [1896574, 2167512], [2167513, 2438451], [2438452, 2709390], [2709391, 2980329], [2980330, 3251268], [3251269, 3522207], [3522208, 3793146], [3793147, 4064085], [4064086, 4335024], [4335025, 4605963], [4605964, 4876902], [4876903, 5147841], [5147842, 5418784]] SRR8846548 file size 759847 SRR8846548 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846548 SRR8846548_1.fastq Input file: SRR8846548_1.fastq trimmed: SRR8846548-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 09:49:13 2024 >> started Mon Dec 9 09:49:16 2024 >> done (2.553s) 5418784 reads processed; of these: 1618 ( 0.03%) short reads filtered out after trimming by size control 180 ( 0.00%) empty reads filtered out after trimming by size control 5416986 (99.97%) reads available; of these: 68500 ( 1.26%) trimmed reads available after processing 5348486 (98.74%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 567 0.01% 19 829 0.02% 20 46 0.00% 21 46 0.00% 22 65 0.00% 23 81 0.00% 24 104 0.00% 25 117 0.00% 26 158 0.00% 27 196 0.00% 28 234 0.00% 29 326 0.01% 30 357 0.01% 31 419 0.01% 32 540 0.01% 33 580 0.01% 34 670 0.01% 35 815 0.02% 36 935 0.02% 37 1132 0.02% 38 1343 0.02% 39 1595 0.03% 40 1652 0.03% 41 1944 0.04% 42 2026 0.04% 43 2511 0.05% 44 2697 0.05% 45 3153 0.06% 46 3852 0.07% 47 5372 0.10% 48 6640 0.12% 49 10187 0.19% 50 17311 0.32% 51 5348486 98.74% 5416986 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=11.17 fanout-score-rank=21 prefix-density=0.48 prefix-fanout=7.4 sequence=GTGTGTGTGTGCGGGCTGGATGCCCTGTTCTACTACTATCGTTCGTGTTTCCAGATGTTTTACTCCGTGTGGAGCAGGGCTTGTACTACCTTTTGCTTGTATTCCGCTTAATGATCTATCACTCGTAATAATGGATGAATTCGCAGCTTTCCTTTCCCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=104.81 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=11.1 sequence=TTTGTTTGTTTGCTTGTTCCAAATTTAACGTCGGTCTCGTCATGAATTCGGGTTCAGTCGGTCAGGGAGTAAGTGAGTAGTTTTGTTGCGTGTGTTCATTTCGTATATGCATTGGTTTTAATTTATATTTGGGTGTAAAAGACATATATATGGTGGGTCTCTGTGGTTGAGCAATAATCTCATTGGTTAAGCATGTAACAGTACTTGTATTTGCTGATGAAATGTACG Started job on | Dec 09 09:49:26 Started mapping on | Dec 09 09:49:26 Finished on | Dec 09 09:49:33 Mapping speed, Million of reads per hour | 2785.88 Number of input reads | 5416986 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 4956834 Uniquely mapped reads % | 91.51% Average mapped length | 49.23 Number of splices: Total | 46692 Number of splices: Annotated (sjdb) | 28907 Number of splices: GT/AG | 37953 Number of splices: GC/AG | 1231 Number of splices: AT/AC | 23 Number of splices: Non-canonical | 7485 Mismatch rate per base, % | 0.61% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256672 % of reads mapped to multiple loci | 4.74% Number of reads mapped to too many loci | 26165 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.25% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 203480 203480 203480 N_multimapping 256672 256672 256672 N_noFeature 263474 314456 4809696 N_ambiguous 103341 7391 335 UnstrandedReadsAssigned:4590019 PositiveStrandReadsAssigned:4634987 NegativeStrandReadsAssigned:146803 Dataset is classified positive stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR8846548 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8846548-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,416,986 reads, 4,464,944 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52973 SRR8846548.ke.tsv 35125 SRR8846548.se.tsv 88098 total ==> SRR8846548.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 71 14.5828 PNS24243 293 194 0 0 KQK14069 1603 1504 7960.92 1491.6 KQK14071 474 375 1.02043 0.766817 ==> SRR8846548.se.tsv <== BRADI_1g14170v3 7972 BRADI_1g53295v3 22 BRADI_1g59795v3 84 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 323 BRADI_1g74790v3 28 BRADI_1g09890v3 9 BRADI_1g77505v3 93 BRADI_1g48960v3 0 SRR8846548 completed mapping pipeline successfully