Starting /dee2/code/volunteer_pipeline.sh SRR8846556 current disk space = 1527855509504 free memory = 1393130484 SRR8846556 SRAfilesize 63e5fbeabc7bee15758e0e569616024d SRR8846556.sra SRR8846556.sra file validated SRR8846556 is paired end SRR8846556 is conventional basespace SRR8846556 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846556_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.37225 32.0 30.0 33.0 18.0 33.0 2 31.84725 33.0 32.0 33.0 27.0 34.0 3 31.76825 33.0 31.0 33.0 29.0 34.0 4 30.2285 31.0 30.0 33.0 25.0 33.0 5 32.099 33.0 32.0 33.0 31.0 34.0 6 36.78525 38.0 37.0 38.0 34.0 38.0 7 37.1505 38.0 38.0 38.0 36.0 38.0 8 37.05375 38.0 38.0 38.0 35.0 38.0 9 37.25475 38.0 38.0 38.0 36.0 38.0 10-14 37.16835 38.0 38.0 38.0 36.0 38.0 15-19 36.968399999999995 38.0 38.0 38.0 35.4 38.0 20-24 36.9905 38.0 38.0 38.0 35.4 38.0 25-29 37.1634 38.0 38.0 38.0 36.2 38.0 30-34 37.05905 38.0 38.0 38.0 36.0 38.0 35-39 36.9178 38.0 38.0 38.0 35.4 38.0 40-44 36.6411 38.0 38.0 38.0 34.2 38.0 45-49 36.4574 38.0 38.0 38.0 33.6 38.0 50-54 36.71995 38.0 38.0 38.0 34.4 38.0 55-59 36.54965 38.0 38.0 38.0 34.0 38.0 60-64 36.2548 38.0 37.4 38.0 33.0 38.0 65-69 36.1387 38.0 37.0 38.0 32.4 38.0 70-74 35.85039999999999 38.0 36.8 38.0 30.6 38.0 75-79 35.908699999999996 38.0 36.6 38.0 31.4 38.0 80-84 35.86065 38.0 36.4 38.0 31.2 38.0 85-89 35.61365 38.0 36.0 38.0 30.2 38.0 90-94 34.9062 38.0 35.0 38.0 27.6 38.0 95-99 34.635000000000005 38.0 34.8 38.0 26.4 38.0 100-104 34.92335 38.0 35.0 38.0 27.6 38.0 105-109 34.3147 38.0 34.2 38.0 25.4 38.0 110-114 33.07145 37.2 32.4 38.0 16.6 38.0 115-119 32.4992 36.2 31.2 38.0 15.0 38.0 120-124 32.7752 36.8 32.6 38.0 15.0 38.0 125-129 32.49715 36.6 32.0 38.0 15.0 38.0 130-134 31.165249999999997 35.2 28.2 38.0 14.4 38.0 135-139 29.50695 34.6 24.0 38.0 13.2 38.0 140-144 28.5522 33.8 22.2 38.0 10.8 38.0 145-149 27.228050000000003 33.8 18.4 38.0 2.0 38.0 150-151 21.856749999999998 28.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 2.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 2.0 19 7.0 20 6.0 21 10.0 22 12.0 23 17.0 24 22.0 25 28.0 26 40.0 27 67.0 28 69.0 29 96.0 30 116.0 31 150.0 32 224.0 33 347.0 34 461.0 35 720.0 36 1031.0 37 568.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.935018050541515 14.543579164517793 9.2573491490459 42.2640536358948 2 23.599999999999998 21.55 37.8 17.05 3 21.0 26.55 26.775 25.674999999999997 4 25.1 31.624999999999996 21.224999999999998 22.05 5 23.93098274568642 33.9584896224056 23.755938984746187 18.35458864716179 6 19.15 33.425 25.525 21.9 7 17.625 18.6 41.6 22.175 8 20.849999999999998 20.3 28.875 29.975 9 19.125 19.900000000000002 32.25 28.725 10-14 23.5 25.509999999999998 24.52 26.47 15-19 22.875 25.575 26.245 25.305 20-24 23.075000000000003 25.995 25.715 25.215 25-29 22.68 26.029999999999998 26.16 25.130000000000003 30-34 22.825 25.52 25.91 25.745 35-39 22.195 25.564999999999998 26.334999999999997 25.905 40-44 23.0 26.11 25.86 25.03 45-49 22.615 25.955000000000002 26.08 25.35 50-54 22.865 25.6 26.43 25.105 55-59 22.71 26.13 25.765 25.395 60-64 22.865 25.745 25.585 25.805 65-69 23.080000000000002 25.990000000000002 25.395 25.535000000000004 70-74 23.380000000000003 25.590000000000003 25.924999999999997 25.105 75-79 22.689999999999998 25.259999999999998 26.674999999999997 25.374999999999996 80-84 23.380000000000003 25.53 26.040000000000003 25.05 85-89 23.265 25.655 26.21 24.87 90-94 23.24 25.290000000000003 25.82 25.650000000000002 95-99 23.49 25.455 25.735000000000003 25.319999999999997 100-104 23.59 25.924999999999997 25.22 25.264999999999997 105-109 23.93 25.775 25.145 25.15 110-114 23.46 25.855 25.665 25.019999999999996 115-119 24.02 25.345000000000002 25.44 25.195 120-124 23.505000000000003 25.91 25.165 25.419999999999998 125-129 23.785 25.174999999999997 25.435000000000002 25.605 130-134 23.185 26.365 24.865000000000002 25.585 135-139 23.895 26.11 24.355 25.64 140-144 23.51 26.91 24.104999999999997 25.474999999999998 145-149 23.150000000000002 25.745 25.540000000000003 25.564999999999998 150-151 23.275000000000002 24.4 26.0 26.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.5 25 3.0 26 2.5 27 2.5 28 4.5 29 5.5 30 8.0 31 13.0 32 20.5 33 30.0 34 36.5 35 42.5 36 53.5 37 75.5 38 109.5 39 131.0 40 131.5 41 146.0 42 167.5 43 190.0 44 204.5 45 204.5 46 205.0 47 216.0 48 210.5 49 180.5 50 161.0 51 135.0 52 123.0 53 123.5 54 102.0 55 91.5 56 90.5 57 76.0 58 67.0 59 66.5 60 60.0 61 55.5 62 58.5 63 49.0 64 45.5 65 55.0 66 47.5 67 35.0 68 33.0 69 28.0 70 25.5 71 20.5 72 14.0 73 14.5 74 8.5 75 2.5 76 5.0 77 4.0 78 0.5 79 2.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54728370221329 98.95 2 0.3269617706237425 0.65 3 0.1006036217303823 0.3 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 1.9875 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.9749999999999996 0.0 0.0 0.0 0.0 114-115 3.2375 0.0 0.0 0.0 0.0 116-117 3.5875000000000004 0.0 0.0 0.0 0.0 118-119 3.85 0.0 0.0 0.0 0.0 120-121 4.325 0.0 0.0 0.0 0.0 122-123 4.862500000000001 0.0 0.0 0.0 0.0 124-125 5.2875 0.0 0.0 0.0 0.0 126-127 5.762499999999999 0.0 0.0 0.0 0.0 128-129 6.25 0.0 0.0 0.0 0.0 130-131 6.725 0.0 0.0 0.0 0.0 132-133 7.2875 0.0 0.0 0.0 0.0 134-135 7.8125 0.0 0.0 0.0 0.0 136-137 8.25 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGCAG 10 0.006836113 144.9625 6 >>END_MODULE SRR8846556 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846556_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7315 33.0 33.0 34.0 32.0 34.0 2 32.77675 33.0 33.0 34.0 32.0 34.0 3 32.79375 33.0 33.0 34.0 32.0 34.0 4 32.82575 33.0 33.0 34.0 32.0 34.0 5 32.7105 33.0 33.0 34.0 32.0 34.0 6 36.9965 38.0 38.0 38.0 36.0 38.0 7 37.00225 38.0 38.0 38.0 36.0 38.0 8 37.05725 38.0 38.0 38.0 36.0 38.0 9 36.971 38.0 38.0 38.0 36.0 38.0 10-14 36.95119999999999 38.0 38.0 38.0 35.6 38.0 15-19 36.99425 38.0 38.0 38.0 36.0 38.0 20-24 36.95875 38.0 38.0 38.0 35.8 38.0 25-29 36.8696 38.0 38.0 38.0 35.6 38.0 30-34 36.698449999999994 38.0 38.0 38.0 34.6 38.0 35-39 36.812799999999996 38.0 38.0 38.0 35.4 38.0 40-44 36.747699999999995 38.0 38.0 38.0 35.0 38.0 45-49 36.590500000000006 38.0 38.0 38.0 34.4 38.0 50-54 36.4209 38.0 38.0 38.0 33.8 38.0 55-59 36.2856 38.0 37.8 38.0 33.6 38.0 60-64 36.3583 38.0 38.0 38.0 33.8 38.0 65-69 36.44275 38.0 38.0 38.0 33.8 38.0 70-74 36.207350000000005 38.0 37.2 38.0 33.0 38.0 75-79 35.86195000000001 38.0 37.0 38.0 31.4 38.0 80-84 35.94715 38.0 37.0 38.0 32.2 38.0 85-89 35.855000000000004 38.0 37.0 38.0 31.6 38.0 90-94 35.538799999999995 38.0 36.2 38.0 30.0 38.0 95-99 34.96275 38.0 35.4 38.0 27.8 38.0 100-104 34.671800000000005 38.0 34.8 38.0 26.4 38.0 105-109 34.6651 38.0 35.0 38.0 26.2 38.0 110-114 34.195049999999995 38.0 34.2 38.0 23.8 38.0 115-119 33.6501 38.0 33.8 38.0 21.0 38.0 120-124 33.0324 37.2 33.2 38.0 15.0 38.0 125-129 32.48350000000001 36.8 32.0 38.0 15.0 38.0 130-134 31.80695 36.0 31.0 38.0 13.8 38.0 135-139 30.641849999999998 35.2 28.8 38.0 13.2 38.0 140-144 28.745799999999996 33.0 23.0 38.0 8.6 38.0 145-149 27.0082 33.0 18.6 38.0 2.0 38.0 150-151 20.124375 25.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 1.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 3.0 15 1.0 16 5.0 17 3.0 18 8.0 19 12.0 20 11.0 21 9.0 22 13.0 23 21.0 24 28.0 25 41.0 26 38.0 27 49.0 28 53.0 29 77.0 30 90.0 31 138.0 32 193.0 33 237.0 34 377.0 35 558.0 36 1098.0 37 923.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.775 14.000000000000002 12.575 40.65 2 28.625 19.025 33.225 19.125 3 21.825 23.45 29.675 25.05 4 25.275 31.15 20.5 23.075000000000003 5 27.450000000000003 32.824999999999996 20.225 19.5 6 20.599999999999998 34.325 22.425 22.650000000000002 7 18.975 16.35 39.675 25.0 8 22.45 21.375 24.224999999999998 31.95 9 22.400000000000002 22.3 28.849999999999998 26.450000000000003 10-14 25.835 24.834999999999997 23.43 25.900000000000002 15-19 25.405 25.305 24.675 24.615000000000002 20-24 25.724999999999998 25.430000000000003 24.845 24.0 25-29 24.959999999999997 25.665 25.2 24.175 30-34 25.345000000000002 25.155 25.174999999999997 24.325 35-39 25.215 25.555 25.014999999999997 24.215 40-44 25.135 25.430000000000003 24.834999999999997 24.6 45-49 25.465 25.46 24.95 24.125 50-54 25.385 25.31 25.45 23.855 55-59 25.69 25.480000000000004 25.3 23.53 60-64 25.16 26.265 24.515 24.060000000000002 65-69 25.435000000000002 25.845000000000002 24.945 23.775 70-74 25.855 25.11 25.064999999999998 23.97 75-79 25.645 25.94 25.045 23.369999999999997 80-84 25.174999999999997 26.21 24.725 23.89 85-89 25.535000000000004 25.94 25.3 23.225 90-94 25.740000000000002 25.919999999999998 24.84 23.5 95-99 25.525 25.575 25.180000000000003 23.72 100-104 25.705 25.765 24.779999999999998 23.75 105-109 26.07 25.645 24.834999999999997 23.45 110-114 25.25 26.090000000000003 24.87 23.79 115-119 25.814999999999998 25.915 25.025 23.244999999999997 120-124 26.105 26.040000000000003 24.560000000000002 23.294999999999998 125-129 26.5 26.265 24.875 22.36 130-134 26.284999999999997 26.174999999999997 25.255 22.285 135-139 26.66 26.02 24.715 22.605 140-144 26.834999999999997 25.545 25.419999999999998 22.2 145-149 26.68 26.38 24.740000000000002 22.2 150-151 27.075 25.5375 25.4625 21.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.0 25 0.5 26 1.5 27 4.0 28 5.0 29 5.0 30 8.5 31 12.0 32 15.0 33 16.5 34 22.5 35 33.0 36 44.5 37 59.0 38 79.5 39 105.0 40 133.5 41 158.5 42 169.5 43 174.0 44 186.5 45 206.5 46 203.0 47 202.0 48 187.5 49 164.5 50 156.5 51 127.5 52 110.5 53 106.0 54 101.5 55 92.0 56 92.5 57 98.0 58 86.0 59 77.0 60 76.5 61 82.5 62 78.0 63 72.0 64 71.5 65 59.0 66 46.5 67 51.0 68 54.0 69 45.5 70 35.0 71 26.0 72 19.0 73 10.5 74 7.0 75 4.5 76 4.5 77 4.5 78 1.0 79 0.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24299772899319 98.32499999999999 2 0.6056018168054504 1.2 3 0.12616704516780217 0.375 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.7625 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.625 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.3375 0.0 0.0 0.0 0.0 116-117 3.6875 0.0 0.0 0.0 0.0 118-119 3.95 0.0 0.0 0.0 0.0 120-121 4.425 0.0 0.0 0.0 0.0 122-123 4.975 0.0 0.0 0.0 0.0 124-125 5.3875 0.0 0.0 0.0 0.0 126-127 5.85 0.0 0.0 0.0 0.0 128-129 6.324999999999999 0.0 0.0 0.0 0.0 130-131 6.8125 0.0 0.0 0.0 0.0 132-133 7.387499999999999 0.0 0.0 0.0 0.0 134-135 7.9125 0.0 0.0 0.0 0.0 136-137 8.325 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCGA 10 0.006830828 145.0 4 >>END_MODULE Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994365 spots for SRR8846556.sra Written 994365 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra Read 994361 spots for SRR8846556.sra Written 994361 spots for SRR8846556.sra SRR ids: ['SRR8846556.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0wxf5ubp SRR8846556.sra spots: 19887224 blocks: [[1, 994361], [994362, 1988722], [1988723, 2983083], [2983084, 3977444], [3977445, 4971805], [4971806, 5966166], [5966167, 6960527], [6960528, 7954888], [7954889, 8949249], [8949250, 9943610], [9943611, 10937971], [10937972, 11932332], [11932333, 12926693], [12926694, 13921054], [13921055, 14915415], [14915416, 15909776], [15909777, 16904137], [16904138, 17898498], [17898499, 18892859], [18892860, 19887224]] SRR8846556 file size 6717427 SRR8846556 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846556 SRR8846556_1.fastq SRR8846556_2.fastq Input file: SRR8846556_1.fastq Paired file: SRR8846556_2.fastq trimmed: SRR8846556-trimmed-pair1.fastq, SRR8846556-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 11:16:53 2024 >> started Mon Dec 9 11:18:40 2024 >> done (107.433s) 19887224 read pairs processed; of these: 10916 ( 0.05%) short read pairs filtered out after trimming by size control 8655 ( 0.04%) empty read pairs filtered out after trimming by size control 19867653 (99.90%) read pairs available; of these: 12129653 (61.05%) trimmed read pairs available after processing 7738000 (38.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 10 0.00% 20 7 0.00% 21 9 0.00% 22 8 0.00% 23 13 0.00% 24 9 0.00% 25 10 0.00% 26 10 0.00% 27 14 0.00% 28 10 0.00% 29 10 0.00% 30 10 0.00% 31 13 0.00% 32 16 0.00% 33 16 0.00% 34 15 0.00% 35 15 0.00% 36 19 0.00% 37 16 0.00% 38 15 0.00% 39 22 0.00% 40 22 0.00% 41 28 0.00% 42 34 0.00% 43 34 0.00% 44 34 0.00% 45 27 0.00% 46 38 0.00% 47 41 0.00% 48 73 0.00% 49 54 0.00% 50 91 0.00% 51 98 0.00% 52 112 0.00% 53 99 0.00% 54 114 0.00% 55 130 0.00% 56 131 0.00% 57 157 0.00% 58 187 0.00% 59 247 0.00% 60 264 0.00% 61 319 0.00% 62 380 0.00% 63 388 0.00% 64 478 0.00% 65 457 0.00% 66 521 0.00% 67 595 0.00% 68 742 0.00% 69 758 0.00% 70 903 0.00% 71 1063 0.01% 72 1105 0.01% 73 1344 0.01% 74 1513 0.01% 75 1722 0.01% 76 1920 0.01% 77 2227 0.01% 78 2367 0.01% 79 2660 0.01% 80 3013 0.02% 81 3452 0.02% 82 3990 0.02% 83 4470 0.02% 84 5487 0.03% 85 6140 0.03% 86 6595 0.03% 87 7389 0.04% 88 8038 0.04% 89 8633 0.04% 90 9202 0.05% 91 10442 0.05% 92 11247 0.06% 93 12151 0.06% 94 13621 0.07% 95 14691 0.07% 96 15723 0.08% 97 17384 0.09% 98 17970 0.09% 99 19575 0.10% 100 20669 0.10% 101 21714 0.11% 102 23281 0.12% 103 24875 0.13% 104 26362 0.13% 105 28233 0.14% 106 30039 0.15% 107 31941 0.16% 108 33322 0.17% 109 34890 0.18% 110 35849 0.18% 111 37282 0.19% 112 39705 0.20% 113 40904 0.21% 114 42785 0.22% 115 44921 0.23% 116 46349 0.23% 117 47918 0.24% 118 50238 0.25% 119 52076 0.26% 120 53701 0.27% 121 56455 0.28% 122 58084 0.29% 123 59593 0.30% 124 62532 0.31% 125 64720 0.33% 126 66969 0.34% 127 69491 0.35% 128 72375 0.36% 129 76345 0.38% 130 79478 0.40% 131 83318 0.42% 132 87008 0.44% 133 91483 0.46% 134 96380 0.49% 135 102793 0.52% 136 108865 0.55% 137 116831 0.59% 138 125553 0.63% 139 136972 0.69% 140 149478 0.75% 141 164637 0.83% 142 186650 0.94% 143 213858 1.08% 144 248251 1.25% 145 304035 1.53% 146 386697 1.95% 147 531750 2.68% 148 764149 3.85% 149 1419033 7.14% 150 5155846 25.95% 151 7738000 38.95% 19867653 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=31 prefix-density=0.98 prefix-fanout=1.7 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGGAAGCTTCCACATTGTCCAGTACCTGCCGTCGTAGTACCCGGGAGAGTTGCCGTGCTCACGGAAGACGAAACCGACCTTGCTGAACTCGAGGCAAGGAACCCACTTGGAGCGGATGAGATACTCGATCTGCTTCAAGAGGGACTCCACGGTGAGAGGCGGCAGGTAGGAAAGGGTTTCGAACTTCTTGATGCCCTCAATTGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGGAGACGCTGCCGAGACCAGCGCTGGCTGAGCGGCGGCCGATGGGGAGCCCGGCGGTGGACTTGAGGCCCTGGAAAGGAGCAACGGCAGTAGCCGCTGACGACATCACTGTGGGAGCCATCGTACACGTACGTAGATAGCTAACAAGAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=42.84 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.7 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=27 prefix-density=0.70 prefix-fanout=2.5 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=134.84 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.5 sequence=CTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGTTTAAATTGACATCTTCATAAGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTCTAAAACTTTAACTGCTTCCCAAATTTCCCCAATATCAGACATTCCTGTAGATAAAATCACCGGCTTGCCTGTTTTTGCCACTTTTTCTAATAAGGGATAAAA SRR8846556 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 11:22:06 Started mapping on | Dec 09 11:22:07 Finished on | Dec 09 11:30:54 Mapping speed, Million of reads per hour | 135.72 Number of input reads | 19867653 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 19274579 Uniquely mapped reads % | 97.01% Average mapped length | 291.94 Number of splices: Total | 21396138 Number of splices: Annotated (sjdb) | 20115145 Number of splices: GT/AG | 21113661 Number of splices: GC/AG | 254297 Number of splices: AT/AC | 10406 Number of splices: Non-canonical | 17774 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 157736 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 20084 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.55% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 442218 442218 442218 N_multimapping 157736 157736 157736 N_noFeature 790120 18734659 962084 N_ambiguous 428866 2681 61525 UnstrandedReadsAssigned:18055593 PositiveStrandReadsAssigned:537239 NegativeStrandReadsAssigned:18250970 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR8846556 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846556-trimmed-pair1.fastq SRR8846556-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,867,653 reads, 18,300,704 reads pseudoaligned [quant] estimated average fragment length: 252.937 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR8846556.ke.tsv 35125 SRR8846556.se.tsv 88098 total ==> SRR8846556.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 684.544 0 0 PNS24247 1044 792.063 76.086 7.69882 PNS24249 1928 1676.06 58.439 2.79442 PNS24246 1044 792.063 76.086 7.69882 PNS24248 1044 792.063 76.086 7.69882 PNS24244 1471 1219.06 55.3031 3.63582 PNS24243 293 97.1322 0 0 KQK14069 1603 1351.06 6124.66 363.317 KQK14071 474 239.102 61.4105 20.5844 ==> SRR8846556.se.tsv <== BRADI_1g14170v3 6877 BRADI_1g53295v3 123 BRADI_1g59795v3 276 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 2018 BRADI_1g74790v3 136 BRADI_1g09890v3 0 BRADI_1g77505v3 340 BRADI_1g48960v3 0 SRR8846556 completed mapping pipeline successfully