Starting /dee2/code/volunteer_pipeline.sh SRR8846557 current disk space = 1527829299200 free memory = 1530829548 SRR8846557 SRAfilesize 1c112522123a5c071e462aea0c768edb SRR8846557.sra SRR8846557.sra file validated SRR8846557 is paired end SRR8846557 is conventional basespace SRR8846557 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846557_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.1625 33.0 31.0 33.0 18.0 34.0 2 32.045 33.0 32.0 33.0 28.0 34.0 3 32.01725 33.0 31.0 34.0 29.0 34.0 4 32.5595 33.0 33.0 34.0 31.0 34.0 5 32.8345 33.0 33.0 34.0 32.0 34.0 6 37.3125 38.0 38.0 38.0 36.0 38.0 7 37.399 38.0 38.0 38.0 37.0 38.0 8 37.44425 38.0 38.0 38.0 37.0 38.0 9 37.45025 38.0 38.0 38.0 37.0 38.0 10-14 37.33710000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.14295 38.0 38.0 38.0 36.2 38.0 20-24 37.0979 38.0 38.0 38.0 36.0 38.0 25-29 37.21724999999999 38.0 38.0 38.0 36.4 38.0 30-34 37.1081 38.0 38.0 38.0 36.0 38.0 35-39 36.9358 38.0 38.0 38.0 35.4 38.0 40-44 36.67229999999999 38.0 38.0 38.0 34.6 38.0 45-49 36.534949999999995 38.0 38.0 38.0 34.0 38.0 50-54 36.80225 38.0 38.0 38.0 34.8 38.0 55-59 36.63255 38.0 38.0 38.0 34.0 38.0 60-64 36.2946 38.0 37.6 38.0 33.2 38.0 65-69 36.0858 38.0 37.0 38.0 31.8 38.0 70-74 35.9976 38.0 37.0 38.0 31.6 38.0 75-79 36.111599999999996 38.0 36.8 38.0 32.2 38.0 80-84 35.97105 38.0 37.0 38.0 32.0 38.0 85-89 35.7042 38.0 36.2 38.0 30.2 38.0 90-94 35.00815 38.0 35.2 38.0 27.8 38.0 95-99 34.78145 38.0 35.0 38.0 26.8 38.0 100-104 35.18095 38.0 35.2 38.0 28.8 38.0 105-109 34.66925 38.0 34.8 38.0 26.8 38.0 110-114 33.2963 37.4 32.6 38.0 17.8 38.0 115-119 32.60085 36.8 31.4 38.0 15.0 38.0 120-124 32.907650000000004 36.8 32.4 38.0 16.2 38.0 125-129 32.7324 36.6 32.2 38.0 16.2 38.0 130-134 31.37115 35.4 28.6 38.0 14.2 38.0 135-139 29.93145 34.6 24.8 38.0 13.4 38.0 140-144 28.980849999999997 34.2 23.2 38.0 13.0 38.0 145-149 27.675 34.0 18.8 38.0 2.0 38.0 150-151 22.379 28.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 3.0 15 1.0 16 3.0 17 1.0 18 2.0 19 3.0 20 5.0 21 6.0 22 7.0 23 14.0 24 17.0 25 26.0 26 42.0 27 58.0 28 67.0 29 86.0 30 117.0 31 146.0 32 210.0 33 308.0 34 457.0 35 709.0 36 1065.0 37 646.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.373056994818654 14.585492227979275 10.569948186528498 38.47150259067357 2 24.0 19.925 36.175000000000004 19.900000000000002 3 21.5 26.0 24.825 27.675 4 25.474999999999998 33.2 21.075 20.25 5 23.730932733183295 33.983495873968494 22.630657664416105 19.654913728432106 6 19.75 33.475 24.224999999999998 22.55 7 16.925 19.0 41.5 22.575 8 20.974999999999998 20.4 27.875 30.75 9 20.05 19.575 31.825 28.549999999999997 10-14 23.189999999999998 25.295 24.54 26.974999999999998 15-19 22.355 25.305 25.924999999999997 26.415 20-24 22.75 25.75 25.91 25.590000000000003 25-29 23.035 25.814999999999998 25.91 25.240000000000002 30-34 22.869999999999997 25.985000000000003 25.840000000000003 25.305 35-39 22.62 26.015 26.14 25.224999999999998 40-44 23.235 26.215 25.4 25.15 45-49 22.785 26.27 25.385 25.56 50-54 22.88 25.755 26.224999999999998 25.14 55-59 23.65 26.334999999999997 24.89 25.124999999999996 60-64 23.674999999999997 25.34 25.745 25.240000000000002 65-69 23.195 25.75 25.52 25.535000000000004 70-74 22.95 25.805 25.545 25.7 75-79 23.34 25.55 25.61 25.5 80-84 23.36 25.374999999999996 25.985000000000003 25.28 85-89 23.115 25.419999999999998 25.424999999999997 26.040000000000003 90-94 23.674999999999997 25.455 25.15 25.72 95-99 23.47 25.509999999999998 25.77 25.25 100-104 23.415 25.865 25.330000000000002 25.39 105-109 23.66 25.575 25.735000000000003 25.03 110-114 23.580000000000002 25.585 24.98 25.855 115-119 23.205000000000002 25.374999999999996 25.64 25.779999999999998 120-124 24.125 25.72 24.535 25.619999999999997 125-129 23.35 26.009999999999998 24.955 25.685000000000002 130-134 24.115000000000002 25.840000000000003 24.474999999999998 25.569999999999997 135-139 24.185000000000002 25.39 24.65 25.775 140-144 24.09 25.88 25.06 24.97 145-149 24.025 25.865 24.995 25.115 150-151 24.1375 25.624999999999996 24.55 25.687500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.5 26 1.5 27 2.5 28 2.5 29 4.0 30 12.0 31 19.5 32 24.0 33 24.0 34 29.0 35 41.5 36 58.0 37 71.5 38 79.0 39 97.0 40 129.5 41 162.5 42 180.5 43 190.5 44 194.5 45 206.0 46 227.5 47 226.0 48 199.0 49 181.5 50 161.0 51 139.5 52 127.0 53 104.5 54 96.0 55 92.0 56 77.0 57 75.0 58 77.0 59 71.5 60 71.0 61 67.5 62 57.5 63 57.5 64 55.0 65 48.5 66 40.5 67 32.0 68 37.0 69 35.0 70 25.0 71 21.5 72 16.0 73 10.5 74 11.5 75 11.0 76 6.5 77 3.5 78 2.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5000000000000004 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57264957264957 99.02499999999999 2 0.35193564605329314 0.7000000000000001 3 0.025138260432378077 0.075 4 0.050276520864756154 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.2125 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.0625 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.7 0.0 0.0 0.0 0.0 134-135 6.1875 0.0 0.0 0.0 0.0 136-137 6.6125 0.0 0.0 0.0 0.0 138-139 7.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTTGT 10 0.006836113 144.9625 9 AGCACAC 25 8.7222434E-4 86.97751 145 >>END_MODULE SRR8846557 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846557_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6825 33.0 33.0 34.0 32.0 34.0 2 32.6925 33.0 33.0 34.0 32.0 34.0 3 32.7025 33.0 33.0 34.0 32.0 34.0 4 32.7195 33.0 33.0 34.0 32.0 34.0 5 32.6315 33.0 33.0 34.0 32.0 34.0 6 36.87 38.0 38.0 38.0 36.0 38.0 7 36.91475 38.0 38.0 38.0 36.0 38.0 8 36.891 38.0 38.0 38.0 36.0 38.0 9 36.83675 38.0 38.0 38.0 36.0 38.0 10-14 36.863 38.0 38.0 38.0 35.4 38.0 15-19 36.93195 38.0 38.0 38.0 36.0 38.0 20-24 36.91225 38.0 38.0 38.0 35.8 38.0 25-29 36.787499999999994 38.0 38.0 38.0 35.2 38.0 30-34 36.58995 38.0 38.0 38.0 34.6 38.0 35-39 36.73465 38.0 38.0 38.0 35.0 38.0 40-44 36.65075 38.0 38.0 38.0 34.8 38.0 45-49 36.48505 38.0 38.0 38.0 34.0 38.0 50-54 36.30825 38.0 38.0 38.0 33.6 38.0 55-59 36.1562 38.0 37.8 38.0 32.8 38.0 60-64 36.2127 38.0 38.0 38.0 33.2 38.0 65-69 36.30165 38.0 37.8 38.0 33.6 38.0 70-74 36.13525 38.0 37.2 38.0 32.8 38.0 75-79 35.7196 38.0 37.0 38.0 30.8 38.0 80-84 35.800799999999995 38.0 37.0 38.0 31.4 38.0 85-89 35.717349999999996 38.0 37.0 38.0 31.0 38.0 90-94 35.3374 38.0 36.2 38.0 29.2 38.0 95-99 34.73865 38.0 35.2 38.0 26.4 38.0 100-104 34.609 38.0 35.0 38.0 25.8 38.0 105-109 34.4491 38.0 34.6 38.0 25.2 38.0 110-114 34.137350000000005 38.0 34.0 38.0 23.6 38.0 115-119 33.461349999999996 38.0 33.4 38.0 18.2 38.0 120-124 32.8825 37.2 33.0 38.0 15.0 38.0 125-129 32.50745 36.8 31.6 38.0 15.0 38.0 130-134 31.6781 36.0 31.0 38.0 13.8 38.0 135-139 30.568899999999996 35.0 28.2 38.0 13.2 38.0 140-144 28.8157 33.0 23.4 38.0 8.6 38.0 145-149 26.8875 33.0 15.8 38.0 2.0 38.0 150-151 20.028750000000002 25.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 2.0 5 2.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 5.0 14 6.0 15 2.0 16 2.0 17 5.0 18 12.0 19 6.0 20 14.0 21 15.0 22 15.0 23 25.0 24 27.0 25 34.0 26 46.0 27 44.0 28 61.0 29 77.0 30 106.0 31 117.0 32 153.0 33 242.0 34 363.0 35 575.0 36 1123.0 37 907.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45 13.475000000000001 13.775 34.300000000000004 2 29.5 18.05 32.425 20.025000000000002 3 22.725 22.725 29.825000000000003 24.725 4 28.249999999999996 29.049999999999997 19.325 23.375 5 26.5 33.825 19.650000000000002 20.025000000000002 6 20.275000000000002 33.875 22.35 23.5 7 20.925 15.024999999999999 40.050000000000004 24.0 8 22.175 22.45 22.675 32.7 9 23.0 21.75 27.400000000000002 27.85 10-14 25.679999999999996 24.47 23.53 26.32 15-19 25.5 24.805 24.759999999999998 24.935 20-24 25.345000000000002 25.330000000000002 25.045 24.279999999999998 25-29 25.415 25.145 24.77 24.67 30-34 25.665 25.755 24.495 24.085 35-39 25.674999999999997 25.22 24.95 24.154999999999998 40-44 25.755 25.285000000000004 24.654999999999998 24.305 45-49 25.935000000000002 24.765 24.93 24.37 50-54 25.480000000000004 25.055 25.27 24.195 55-59 26.595000000000002 24.815 24.86 23.73 60-64 25.465 25.195 25.064999999999998 24.275 65-69 25.885 24.77 25.635 23.71 70-74 26.305 24.665 24.675 24.355 75-79 25.455 25.064999999999998 25.31 24.169999999999998 80-84 25.919999999999998 25.014999999999997 25.335 23.73 85-89 25.75 25.430000000000003 25.4 23.419999999999998 90-94 25.895000000000003 25.085 25.46 23.56 95-99 25.619999999999997 25.75 24.95 23.68 100-104 25.919999999999998 25.995 24.875 23.21 105-109 26.035000000000004 25.245 25.19 23.53 110-114 25.985000000000003 25.230000000000004 24.965 23.82 115-119 25.679999999999996 25.835 25.014999999999997 23.47 120-124 26.3 26.165 24.6 22.935 125-129 26.534999999999997 25.115 25.575 22.775000000000002 130-134 26.889999999999997 26.325 24.610000000000003 22.175 135-139 26.215 26.07 25.27 22.445 140-144 27.250000000000004 25.82 24.9 22.03 145-149 27.07 25.825 24.995 22.11 150-151 27.675 25.124999999999996 25.2125 21.987499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 2.0 26 4.0 27 3.5 28 3.0 29 6.5 30 9.0 31 11.0 32 17.0 33 20.5 34 24.0 35 30.5 36 39.0 37 51.5 38 62.5 39 78.5 40 112.5 41 147.5 42 159.5 43 175.5 44 202.0 45 204.0 46 193.0 47 196.5 48 190.0 49 172.0 50 154.0 51 135.0 52 123.5 53 108.0 54 102.5 55 105.5 56 96.0 57 83.5 58 93.0 59 100.0 60 85.5 61 77.0 62 68.5 63 64.0 64 66.5 65 60.5 66 60.5 67 57.0 68 50.0 69 46.5 70 33.5 71 26.0 72 27.5 73 22.0 74 13.0 75 10.5 76 6.0 77 2.0 78 1.5 79 0.5 80 1.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.395008822788 98.575 2 0.4285354171918326 0.8500000000000001 3 0.12603982858583312 0.375 4 0.050415931434333254 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 2.9 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.7874999999999996 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.637499999999999 0.0 0.0 0.0 0.0 130-131 5.1625 0.0 0.0 0.0 0.0 132-133 5.775 0.0 0.0 0.0 0.0 134-135 6.325 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCGTCG 20 3.5877043E-4 108.75 145 >>END_MODULE Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014034 spots for SRR8846557.sra Written 1014034 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra Read 1014015 spots for SRR8846557.sra Written 1014015 spots for SRR8846557.sra SRR ids: ['SRR8846557.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2pvq9nec SRR8846557.sra spots: 20280319 blocks: [[1, 1014015], [1014016, 2028030], [2028031, 3042045], [3042046, 4056060], [4056061, 5070075], [5070076, 6084090], [6084091, 7098105], [7098106, 8112120], [8112121, 9126135], [9126136, 10140150], [10140151, 11154165], [11154166, 12168180], [12168181, 13182195], [13182196, 14196210], [14196211, 15210225], [15210226, 16224240], [16224241, 17238255], [17238256, 18252270], [18252271, 19266285], [19266286, 20280319]] SRR8846557 file size 6850634 SRR8846557 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846557 SRR8846557_1.fastq SRR8846557_2.fastq Input file: SRR8846557_1.fastq Paired file: SRR8846557_2.fastq trimmed: SRR8846557-trimmed-pair1.fastq, SRR8846557-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 11:15:45 2024 >> started Mon Dec 9 11:16:12 2024 >> done (27.003s) 20280319 read pairs processed; of these: 12726 ( 0.06%) short read pairs filtered out after trimming by size control 9237 ( 0.05%) empty read pairs filtered out after trimming by size control 20258356 (99.89%) read pairs available; of these: 12085321 (59.66%) trimmed read pairs available after processing 8173035 (40.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 4 0.00% 21 11 0.00% 22 11 0.00% 23 4 0.00% 24 8 0.00% 25 9 0.00% 26 4 0.00% 27 9 0.00% 28 12 0.00% 29 14 0.00% 30 8 0.00% 31 9 0.00% 32 10 0.00% 33 9 0.00% 34 13 0.00% 35 17 0.00% 36 14 0.00% 37 13 0.00% 38 24 0.00% 39 18 0.00% 40 16 0.00% 41 15 0.00% 42 26 0.00% 43 23 0.00% 44 28 0.00% 45 26 0.00% 46 28 0.00% 47 55 0.00% 48 49 0.00% 49 44 0.00% 50 46 0.00% 51 57 0.00% 52 64 0.00% 53 94 0.00% 54 73 0.00% 55 75 0.00% 56 77 0.00% 57 121 0.00% 58 121 0.00% 59 145 0.00% 60 165 0.00% 61 223 0.00% 62 253 0.00% 63 258 0.00% 64 252 0.00% 65 322 0.00% 66 332 0.00% 67 395 0.00% 68 405 0.00% 69 487 0.00% 70 592 0.00% 71 642 0.00% 72 681 0.00% 73 808 0.00% 74 949 0.00% 75 1114 0.01% 76 1242 0.01% 77 1419 0.01% 78 1551 0.01% 79 1734 0.01% 80 1922 0.01% 81 2203 0.01% 82 2517 0.01% 83 2947 0.01% 84 3634 0.02% 85 4220 0.02% 86 4717 0.02% 87 4999 0.02% 88 5455 0.03% 89 5971 0.03% 90 6403 0.03% 91 7105 0.04% 92 7714 0.04% 93 8597 0.04% 94 9653 0.05% 95 10438 0.05% 96 11300 0.06% 97 12253 0.06% 98 13140 0.06% 99 14280 0.07% 100 15474 0.08% 101 16194 0.08% 102 17496 0.09% 103 19220 0.09% 104 20216 0.10% 105 21975 0.11% 106 23974 0.12% 107 25523 0.13% 108 26856 0.13% 109 28380 0.14% 110 29953 0.15% 111 31639 0.16% 112 33305 0.16% 113 35108 0.17% 114 36899 0.18% 115 39109 0.19% 116 40508 0.20% 117 42640 0.21% 118 44874 0.22% 119 46899 0.23% 120 48660 0.24% 121 51527 0.25% 122 53745 0.27% 123 55429 0.27% 124 58704 0.29% 125 61095 0.30% 126 63188 0.31% 127 66447 0.33% 128 69024 0.34% 129 72565 0.36% 130 77104 0.38% 131 80424 0.40% 132 84822 0.42% 133 89522 0.44% 134 95140 0.47% 135 100319 0.50% 136 107241 0.53% 137 115947 0.57% 138 124199 0.61% 139 136143 0.67% 140 149017 0.74% 141 163494 0.81% 142 186500 0.92% 143 212983 1.05% 144 249061 1.23% 145 303513 1.50% 146 384866 1.90% 147 533418 2.63% 148 763050 3.77% 149 1429135 7.05% 150 5348088 26.40% 151 8173035 40.34% 20258356 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=37 prefix-density=0.27 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=43.19 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.4 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=36 prefix-density=0.44 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=149.44 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.3 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR8846557 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 11:22:20 Started mapping on | Dec 09 11:22:21 Finished on | Dec 09 11:24:23 Mapping speed, Million of reads per hour | 597.79 Number of input reads | 20258356 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 19971966 Uniquely mapped reads % | 98.59% Average mapped length | 293.14 Number of splices: Total | 22364885 Number of splices: Annotated (sjdb) | 21033478 Number of splices: GT/AG | 22077561 Number of splices: GC/AG | 258083 Number of splices: AT/AC | 11459 Number of splices: Non-canonical | 17782 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 156320 % of reads mapped to multiple loci | 0.77% Number of reads mapped to too many loci | 10872 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.31% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 138583 138583 138583 N_multimapping 156320 156320 156320 N_noFeature 811252 19442499 974622 N_ambiguous 423146 2635 58018 UnstrandedReadsAssigned:18737568 PositiveStrandReadsAssigned:526832 NegativeStrandReadsAssigned:18939326 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR8846557 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846557-trimmed-pair1.fastq SRR8846557-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,258,356 reads, 18,990,332 reads pseudoaligned [quant] estimated average fragment length: 251.126 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52973 SRR8846557.ke.tsv 35125 SRR8846557.se.tsv 88098 total ==> SRR8846557.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.296 0 0 PNS24247 1044 793.874 72.1445 7.06542 PNS24249 1928 1677.87 45.331 2.1005 PNS24246 1044 793.874 72.1445 7.06542 PNS24248 1044 793.874 72.1445 7.06542 PNS24244 1471 1220.87 76.2355 4.85482 PNS24243 293 94.5652 0 0 KQK14069 1603 1352.87 4289.03 246.483 KQK14071 474 238.706 37.0819 12.0777 ==> SRR8846557.se.tsv <== BRADI_1g14170v3 4660 BRADI_1g53295v3 86 BRADI_1g59795v3 309 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 2589 BRADI_1g74790v3 154 BRADI_1g09890v3 1 BRADI_1g77505v3 379 BRADI_1g48960v3 0 SRR8846557 completed mapping pipeline successfully