Starting /dee2/code/volunteer_pipeline.sh SRR8846558 current disk space = 1527403192320 free memory = 1525581268 SRR8846558 SRAfilesize fb535c91aa875d3e1be4a924d31bbfe0 SRR8846558.sra SRR8846558.sra file validated SRR8846558 is single end SRR8846558 is conventional basespace SRR8846558 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846558_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 40 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.03 35.0 35.0 35.0 32.0 35.0 2 34.47575 35.0 35.0 35.0 35.0 35.0 3 34.47025 35.0 35.0 35.0 34.0 35.0 4 34.5275 35.0 35.0 35.0 34.0 35.0 5 34.613 35.0 35.0 35.0 35.0 35.0 6 39.3345 40.0 40.0 40.0 39.0 40.0 7 39.29075 40.0 40.0 40.0 39.0 40.0 8 39.30175 40.0 40.0 40.0 39.0 40.0 9 39.3035 40.0 40.0 40.0 39.0 40.0 10-14 39.341049999999996 40.0 40.0 40.0 39.0 40.0 15-19 39.182900000000004 40.0 39.8 40.0 38.8 40.0 20-24 38.92215 40.0 39.4 40.0 37.8 40.0 25-29 38.7609 40.0 39.8 40.0 37.4 40.0 30-34 38.60585 40.0 39.8 40.0 37.2 40.0 35-39 38.319 40.0 39.8 40.0 36.6 40.0 40-44 38.14515 40.0 39.2 40.0 36.4 40.0 45-49 37.89185 40.0 39.0 40.0 35.6 40.0 50-54 37.76649999999999 40.0 39.0 40.0 35.8 40.0 55-59 37.705349999999996 40.0 39.0 40.0 35.6 40.0 60-64 37.5531 40.0 39.0 40.0 34.8 40.0 65-69 37.493700000000004 40.0 39.0 40.0 34.0 40.0 70-74 37.2479 40.0 39.0 40.0 34.0 40.0 75-79 37.2856 40.0 39.0 40.0 34.0 40.0 80-84 37.248149999999995 40.0 39.0 40.0 34.0 40.0 85-89 37.266450000000006 40.0 39.0 40.0 34.0 40.0 90-94 37.218650000000004 40.0 39.0 40.0 34.0 40.0 95-99 37.04735 40.0 39.0 40.0 34.0 40.0 100-104 34.6707 37.0 35.4 38.4 29.4 38.6 105-109 36.916 39.8 39.0 40.0 34.0 40.0 110-114 37.03745 40.0 39.0 40.0 34.0 40.0 115-119 36.655950000000004 40.0 39.0 40.0 32.8 40.0 120-124 36.474050000000005 40.0 39.0 40.0 31.0 40.0 125-129 36.115750000000006 40.0 38.6 40.0 29.8 40.0 130-134 35.6516 39.8 38.0 40.0 24.8 40.0 135-139 35.156349999999996 39.4 38.0 40.0 17.0 40.0 140-144 34.4517 39.0 37.0 40.0 10.6 40.0 145-149 33.508649999999996 39.0 36.0 40.0 2.0 40.0 150-151 26.247875 33.0 19.0 38.0 2.0 39.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 5.0 7 6.0 8 16.0 9 14.0 10 24.0 11 20.0 12 23.0 13 18.0 14 10.0 15 2.0 16 9.0 17 5.0 18 1.0 19 6.0 20 10.0 21 6.0 22 8.0 23 12.0 24 12.0 25 11.0 26 14.0 27 20.0 28 26.0 29 38.0 30 37.0 31 41.0 32 59.0 33 69.0 34 68.0 35 97.0 36 168.0 37 221.0 38 531.0 39 2391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.283454682400205 37.459201606829026 1.4812955059000754 23.7760482048707 2 19.775000000000002 39.35 24.6 16.275000000000002 3 14.825 38.35 27.400000000000002 19.425 4 17.075000000000003 35.199999999999996 27.450000000000003 20.275000000000002 5 15.925 37.775 26.3 20.0 6 16.25 43.575 23.575 16.6 7 13.375 44.925 24.175 17.525 8 13.775 45.975 24.45 15.8 9 14.75 42.6 26.0 16.650000000000002 10-14 15.534999999999998 34.565 30.675 19.225 15-19 14.11 30.91 36.63 18.35 20-24 12.67 31.22 38.315 17.794999999999998 25-29 14.88074403720186 33.78668933446672 33.41667083354168 17.91589579478974 30-34 16.503300660132027 34.49689937987597 29.91098219643929 19.088817763552708 35-39 16.46994098229469 35.27058117435231 27.773331999599883 20.486145843753125 40-44 17.793006853083888 35.36591466159772 26.286829073082885 20.554249412235507 45-49 17.59175917591759 34.67346734673467 26.55765576557656 21.177117711771174 50-54 17.75831873905429 35.351513635226425 24.828621466099573 22.061546159619716 55-59 16.962722041531148 36.622466850137606 24.713535151363523 21.701275956967724 60-64 17.271044865702994 35.75251337968289 24.05341869654379 22.923023058070324 65-69 17.87446861715429 35.33383345836459 23.710927731932983 23.080770192548137 70-74 18.379703763010408 35.763610888710964 23.51381104883907 22.34287429943955 75-79 18.625243884136275 34.95922757516634 22.85757166441543 23.557956876281956 80-84 17.921649071896734 36.093460749487164 22.234452394056138 23.750437784559963 85-89 18.205 36.53 20.985 24.279999999999998 90-94 17.995 35.725 21.725 24.555 95-99 18.5 35.305 21.065 25.130000000000003 100-104 18.675 35.745 21.02 24.560000000000002 105-109 18.745 35.705 20.91 24.64 110-114 18.685 35.33 20.990000000000002 24.995 115-119 18.709999999999997 34.910000000000004 20.46 25.919999999999998 120-124 19.040000000000003 34.305 21.005 25.650000000000002 125-129 19.040000000000003 33.145 21.224999999999998 26.590000000000003 130-134 19.665 32.265 21.605 26.465 135-139 19.73 32.684999999999995 21.154999999999998 26.43 140-144 18.875 33.355000000000004 21.990000000000002 25.779999999999998 145-149 18.7 33.074999999999996 21.965 26.26 150-151 16.950000000000003 35.325 20.5875 27.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 1.0 7 4.0 8 5.0 9 3.5 10 3.5 11 8.0 12 7.0 13 3.5 14 5.5 15 4.5 16 5.0 17 6.5 18 7.5 19 6.5 20 5.0 21 7.0 22 7.5 23 7.0 24 7.0 25 9.0 26 16.5 27 23.5 28 30.0 29 37.5 30 57.5 31 82.0 32 97.5 33 130.5 34 173.0 35 196.0 36 241.0 37 286.0 38 290.0 39 298.5 40 295.0 41 288.5 42 260.5 43 235.0 44 212.5 45 155.5 46 123.5 47 107.5 48 84.5 49 60.0 50 37.0 51 22.5 52 18.0 53 12.0 54 4.5 55 2.0 56 2.5 57 1.0 58 0.5 59 0.5 60 0.5 61 0.5 62 0.5 63 0.5 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.02 35-39 0.03 40-44 0.045 45-49 0.01 50-54 0.075 55-59 0.075 60-64 0.034999999999999996 65-69 0.025 70-74 0.08 75-79 0.055 80-84 0.065 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.225 #Duplication Level Percentage of deduplicated Percentage of total 1 91.96868657581908 79.3 2 5.189910118875036 8.95 3 1.5366772977674688 3.975 4 0.5218904030153668 1.7999999999999998 5 0.2319512902290519 1.0 6 0.14496955639315745 0.75 7 0.11597564511452595 0.7000000000000001 8 0.05798782255726297 0.4 9 0.0 0.0 >10 0.2319512902290519 3.125 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCGAACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGA 39 0.975 No Hit CAAACATGTGGTAGATAAATATCAAGAGATGTGTAGCACATGACGTGTCT 16 0.4 No Hit CTAAATATTCAGTTAAGACCATTCCAAGGCTCCTTTTCGCCATGCATAAA 13 0.325 No Hit ATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTA 13 0.325 No Hit CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit GAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCGAGGGATATTAC 11 0.27499999999999997 No Hit GTATAACAAACACTTTTATTCCACGTATACCCAATGTATATGCATGTACA 11 0.27499999999999997 No Hit GCAGCAAATTTTCTCTTCCCGCTGATTTTCAATACCAAACGATAACAGAG 10 0.25 No Hit GTATAATATTACATGTATATGTGTGTATATGTGTAGTCAGGGTTCAAATG 8 0.2 No Hit GTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGA 8 0.2 No Hit GGCAGGGTAGCTTGGATGATTAATAAAGTTGAGCACACATACATAGAGAT 7 0.17500000000000002 No Hit GTAAAATTAACTTCAACTATTTGTATTATATCAAAATACTTCGGAGTTGA 7 0.17500000000000002 No Hit GGAATCAATGCTATGCGAATTACGTACATTTCATCAGCAAATACAAGTAC 7 0.17500000000000002 No Hit AGCACACAATTGGATGATTTATTATACAGACTGTATGTAGGAGTAAGTAC 7 0.17500000000000002 No Hit GATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGAT 6 0.15 No Hit TGCGAACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCG 6 0.15 No Hit CAGAAGGACAATAATGCTTATTTATTGCGGTTTTTGACAACTTTTCTTCA 6 0.15 No Hit ACTGGGCGGAAATCATTAATATCAAGGCATAAATGCATAATGCCTAGCAA 6 0.15 No Hit AAACATGTGGTAGATAAATATCAAGAGATGTGTAGCACATGACGTGTCTC 6 0.15 No Hit CAATAAATTAGACAGACAAACAGAGCCTCTGCCTTTCTTATATACTGATG 5 0.125 No Hit ATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTAC 5 0.125 No Hit AAAGCAAATGTAGCGCATCACATCACAGATTCACAAAGTTCAACAGTACA 5 0.125 No Hit CACGATTCTTCCGTCATTCATTCACTCGTGCACCTCATGCTTAATTACAT 5 0.125 No Hit AAGAAAGAAAGTGATTTTCTCAACTCTTTCAAACTTTTAGGAATTCACAT 5 0.125 No Hit CTTTATTCTGTCCCCTTATCTTTCATTCAGAAAAAGGAATGAATGGCTCG 5 0.125 No Hit AAACAACTAAATAACCTTTTTATTCGCTCCTCTAGTCCCAGAAGGATCCA 5 0.125 No Hit AGGGAAAGGAAAGCTGCGAATTCATCCATTATTACGAGTGATAGATCATT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.175 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.2625 0.0 0.0 0.0 0.0 32-33 0.275 0.0 0.0 0.0 0.0 34-35 0.30000000000000004 0.0 0.0 0.0 0.0 36-37 0.325 0.0 0.0 0.0 0.0 38-39 0.3875 0.0 0.0 0.0 0.0 40-41 0.4125 0.0 0.0 0.0 0.0 42-43 0.5249999999999999 0.0 0.0 0.0 0.0 44-45 0.725 0.0 0.0 0.0 0.0 46-47 0.8375 0.0 0.0 0.0 0.0 48-49 0.975 0.0 0.0 0.0 0.0 50-51 1.15 0.0 0.0 0.0 0.0 52-53 1.3125 0.0 0.0 0.0 0.0 54-55 1.5875 0.0 0.0 0.0 0.0 56-57 1.7875 0.0 0.0 0.0 0.0 58-59 2.05 0.0 0.0 0.0 0.0 60-61 2.3 0.0 0.0 0.0 0.0 62-63 2.5125 0.0 0.0 0.0 0.0 64-65 2.825 0.0 0.0 0.0 0.0 66-67 3.2875 0.0 0.0 0.0 0.0 68-69 3.6125 0.0 0.0 0.0 0.0 70-71 4.0875 0.0 0.0 0.0 0.0 72-73 4.574999999999999 0.0 0.0 0.0 0.0 74-75 5.2 0.0 0.0 0.0 0.0 76-77 5.8625 0.0 0.0 0.0 0.0 78-79 6.7875 0.0 0.0 0.0 0.0 80-81 7.4875 0.0 0.0 0.0 0.0 82-83 8.15 0.0 0.0 0.0 0.0 84-85 8.9625 0.0 0.0 0.0 0.0 86-87 10.025 0.0 0.0 0.0 0.0 88-89 11.337499999999999 0.0 0.0 0.0 0.0 90-91 12.05 0.0 0.0 0.0 0.0 92-93 12.8125 0.0 0.0 0.0 0.0 94-95 13.75 0.0 0.0 0.0 0.0 96-97 14.912500000000001 0.0 0.0 0.0 0.0 98-99 16.075 0.0 0.0 0.0 0.0 100-101 17.175 0.0 0.0 0.0 0.0 102-103 18.4625 0.0 0.0 0.0 0.0 104-105 19.8 0.0 0.0 0.0 0.0 106-107 21.225 0.0 0.0 0.0 0.0 108-109 22.325 0.0 0.0 0.0 0.0 110-111 23.5 0.0 0.0 0.0 0.0 112-113 24.8625 0.0 0.0 0.0 0.0 114-115 26.325 0.0 0.0 0.0 0.0 116-117 27.6625 0.0 0.0 0.0 0.0 118-119 28.924999999999997 0.0 0.0 0.0 0.0 120-121 30.1625 0.0 0.0 0.0 0.0 122-123 31.5875 0.0 0.0 0.0 0.0 124-125 32.85 0.0 0.0 0.0 0.0 126-127 34.45 0.0 0.0 0.0 0.0 128-129 35.6875 0.0 0.0 0.0 0.0 130-131 36.9375 0.0 0.0 0.0 0.0 132-133 38.15 0.0 0.0 0.0 0.0 134-135 39.3125 0.0 0.0 0.0 0.0 136-137 40.5 0.0 0.0 0.0 0.0 138-139 41.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTTT 25 8.283309E-4 88.09367 1 TTTTTTT 420 8.558345E-9 8.630209 3 AAAAAAA 410 7.53594E-4 5.3044205 125-129 >>END_MODULE Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479146 READS because READLEN < 1 Read 1479146 spots for SRR8846558.sra Written 1479146 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra Rejected 1479141 READS because READLEN < 1 Read 1479141 spots for SRR8846558.sra Written 1479141 spots for SRR8846558.sra SRR ids: ['SRR8846558.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zssaguo5 SRR8846558.sra spots: 29582825 blocks: [[1, 1479141], [1479142, 2958282], [2958283, 4437423], [4437424, 5916564], [5916565, 7395705], [7395706, 8874846], [8874847, 10353987], [10353988, 11833128], [11833129, 13312269], [13312270, 14791410], [14791411, 16270551], [16270552, 17749692], [17749693, 19228833], [19228834, 20707974], [20707975, 22187115], [22187116, 23666256], [23666257, 25145397], [25145398, 26624538], [26624539, 28103679], [28103680, 29582825]] SRR8846558 file size 10002948 SRR8846558 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846558 SRR8846558_1.fastq Input file: SRR8846558_1.fastq trimmed: SRR8846558-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 11:25:13 2024 >> started Mon Dec 9 11:25:38 2024 >> done (24.946s) 29582825 reads processed; of these: 19143 ( 0.06%) short reads filtered out after trimming by size control 3992 ( 0.01%) empty reads filtered out after trimming by size control 29559690 (99.92%) reads available; of these: 18465895 (62.47%) trimmed reads available after processing 11093795 (37.53%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3979 0.01% 19 13958 0.05% 20 4258 0.01% 21 4998 0.02% 22 6654 0.02% 23 8683 0.03% 24 11648 0.04% 25 14432 0.05% 26 15757 0.05% 27 16509 0.06% 28 20321 0.07% 29 21367 0.07% 30 25724 0.09% 31 31540 0.11% 32 33251 0.11% 33 36036 0.12% 34 38835 0.13% 35 40953 0.14% 36 47510 0.16% 37 45334 0.15% 38 48663 0.16% 39 51222 0.17% 40 53333 0.18% 41 56294 0.19% 42 56173 0.19% 43 57107 0.19% 44 59765 0.20% 45 58963 0.20% 46 59860 0.20% 47 60373 0.20% 48 60280 0.20% 49 60881 0.21% 50 61302 0.21% 51 59978 0.20% 52 61452 0.21% 53 61662 0.21% 54 62623 0.21% 55 62885 0.21% 56 64566 0.22% 57 66755 0.23% 58 67959 0.23% 59 69730 0.24% 60 71575 0.24% 61 73880 0.25% 62 76062 0.26% 63 78519 0.27% 64 79364 0.27% 65 82426 0.28% 66 82064 0.28% 67 84524 0.29% 68 87372 0.30% 69 91631 0.31% 70 94943 0.32% 71 99650 0.34% 72 101562 0.34% 73 108292 0.37% 74 113772 0.38% 75 118417 0.40% 76 119407 0.40% 77 124431 0.42% 78 125137 0.42% 79 131089 0.44% 80 131152 0.44% 81 134105 0.45% 82 135385 0.46% 83 138377 0.47% 84 142711 0.48% 85 147684 0.50% 86 151945 0.51% 87 155269 0.53% 88 158277 0.54% 89 159358 0.54% 90 160366 0.54% 91 162168 0.55% 92 164051 0.55% 93 166819 0.56% 94 169299 0.57% 95 174299 0.59% 96 179106 0.61% 97 182696 0.62% 98 186030 0.63% 99 191743 0.65% 100 197146 0.67% 101 204400 0.69% 102 196064 0.66% 103 195745 0.66% 104 199899 0.68% 105 203894 0.69% 106 205643 0.70% 107 207099 0.70% 108 206641 0.70% 109 210713 0.71% 110 208756 0.71% 111 213614 0.72% 112 207601 0.70% 113 210739 0.71% 114 206942 0.70% 115 209708 0.71% 116 208492 0.71% 117 208640 0.71% 118 202892 0.69% 119 194458 0.66% 120 7457 0.03% 121 7791 0.03% 122 8255 0.03% 123 8215 0.03% 124 8560 0.03% 125 9196 0.03% 126 9489 0.03% 127 10474 0.04% 128 10993 0.04% 129 11225 0.04% 130 11861 0.04% 131 12511 0.04% 132 13341 0.05% 133 13709 0.05% 134 14659 0.05% 135 15645 0.05% 136 17543 0.06% 137 19102 0.06% 138 23410 0.08% 139 23273 0.08% 140 26738 0.09% 141 31286 0.11% 142 34555 0.12% 143 41733 0.14% 144 52374 0.18% 145 68447 0.23% 146 86963 0.29% 147 118524 0.40% 148 208103 0.70% 149 405641 1.37% 150 6137206 20.76% 151 11093795 37.53% 29559690 reads passed initial QC criterion=sequence-density sequence-density=10.65 sequence-density-rank=1 fanout-score=35.36 fanout-score-rank=7 prefix-density=11.83 prefix-fanout=31.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGCGTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=15 fanout-score=193.08 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=6.0 sequence=GAAACACACAAACACGTACCGGTAAATTATCATAATCAGAATTTGTCGACGAATTTGATATTCTTTTACAAAATATACTTATCTTAATATGTATAACCGGAGTTTATATTACATGCCCCTCTCCCAACGATAGTTGTAGTACTCTTATAATAGTAGTACTCATGAATACAGTTAATCCGGGTTGTTGGGAGAGATCACATGCATAAATACAACATGAAACAAACGTGTGAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATCAACTTGCTTAGGCCTTGCCGGACTCCTCACAACCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCACTTGCCTGGTGTTGTCGAAGCCGATGATGCGGACATAG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGCGTATCTCGTATGCCGTCTTCTGCTTGAAAA -o SRR8846558 - Input file: STDIN trimmed: SRR8846558-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGCGTATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Mon Dec 9 11:35:45 2024 >> started Mon Dec 9 11:36:21 2024 >> done (36.471s) 24185201 reads processed; of these: 302 ( 0.00%) short reads filtered out after trimming by size control 5 ( 0.00%) empty reads filtered out after trimming by size control 24184894 (100.00%) reads available; of these: 4793837 (19.82%) trimmed reads available after processing 19391057 (80.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3275 0.01% 19 11398 0.05% 20 3467 0.01% 21 4168 0.02% 22 5448 0.02% 23 7171 0.03% 24 9646 0.04% 25 11816 0.05% 26 12885 0.05% 27 13563 0.06% 28 16763 0.07% 29 17627 0.07% 30 21037 0.09% 31 25733 0.11% 32 27300 0.11% 33 29549 0.12% 34 31729 0.13% 35 33552 0.14% 36 38997 0.16% 37 37127 0.15% 38 39893 0.16% 39 42178 0.17% 40 43929 0.18% 41 46086 0.19% 42 46134 0.19% 43 46874 0.19% 44 49136 0.20% 45 48373 0.20% 46 49350 0.20% 47 49602 0.21% 48 49301 0.20% 49 49887 0.21% 50 50290 0.21% 51 49235 0.20% 52 50656 0.21% 53 50893 0.21% 54 51598 0.21% 55 51791 0.21% 56 53124 0.22% 57 55522 0.23% 58 55948 0.23% 59 57368 0.24% 60 58619 0.24% 61 60734 0.25% 62 62856 0.26% 63 64841 0.27% 64 65994 0.27% 65 68218 0.28% 66 67431 0.28% 67 69617 0.29% 68 72231 0.30% 69 75815 0.31% 70 78336 0.32% 71 82113 0.34% 72 83871 0.35% 73 89547 0.37% 74 94006 0.39% 75 97775 0.40% 76 98471 0.41% 77 102434 0.42% 78 103102 0.43% 79 108297 0.45% 80 107973 0.45% 81 111360 0.46% 82 111931 0.46% 83 114175 0.47% 84 117051 0.48% 85 121902 0.50% 86 125528 0.52% 87 128170 0.53% 88 131173 0.54% 89 131497 0.54% 90 132206 0.55% 91 133685 0.55% 92 135392 0.56% 93 137920 0.57% 94 139434 0.58% 95 143843 0.59% 96 147387 0.61% 97 150664 0.62% 98 153035 0.63% 99 158068 0.65% 100 162446 0.67% 101 168359 0.70% 102 161482 0.67% 103 161703 0.67% 104 165477 0.68% 105 168213 0.70% 106 170228 0.70% 107 170051 0.70% 108 170421 0.70% 109 172661 0.71% 110 171070 0.71% 111 175987 0.73% 112 172378 0.71% 113 174119 0.72% 114 170243 0.70% 115 170762 0.71% 116 169574 0.70% 117 167673 0.69% 118 164635 0.68% 119 160075 0.66% 120 166266 0.69% 121 167325 0.69% 122 166187 0.69% 123 169807 0.70% 124 177214 0.73% 125 173732 0.72% 126 171738 0.71% 127 168328 0.70% 128 165931 0.69% 129 165474 0.68% 130 160802 0.66% 131 160201 0.66% 132 158426 0.66% 133 154233 0.64% 134 149774 0.62% 135 149590 0.62% 136 148994 0.62% 137 149378 0.62% 138 151558 0.63% 139 151350 0.63% 140 153407 0.63% 141 153461 0.63% 142 159447 0.66% 143 163739 0.68% 144 167981 0.69% 145 177400 0.73% 146 207530 0.86% 147 303549 1.26% 148 466277 1.93% 149 241164 1.00% 150 3421135 14.15% 151 6289818 26.01% criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=40 prefix-density=0.74 prefix-fanout=2.9 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=457.90 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.1 sequence=ACAAAAAACAGAATTCAGAAGGACAATAATGCTTATTTATTGCGGTTTTTGACAACTTTTCTTCAGACATATGCTCATTGTGGTAGACGCAGCTGACCACCTAGAGCTATTAGACTTATTCAGAGCAACAATAGCCTGGCTGGCTGCTTCACAGAATAACCGAAGGGAAATA Started job on | Dec 09 11:40:20 Started mapping on | Dec 09 11:40:20 Finished on | Dec 09 11:42:26 Mapping speed, Million of reads per hour | 844.55 Number of input reads | 29559383 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 27222420 Uniquely mapped reads % | 92.09% Average mapped length | 125.59 Number of splices: Total | 161497 Number of splices: Annotated (sjdb) | 25827 Number of splices: GT/AG | 77705 Number of splices: GC/AG | 7970 Number of splices: AT/AC | 224 Number of splices: Non-canonical | 75598 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1413052 % of reads mapped to multiple loci | 4.78% Number of reads mapped to too many loci | 307193 % of reads mapped to too many loci | 1.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.03% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 923911 923911 923911 N_multimapping 1413052 1413052 1413052 N_noFeature 1293933 26139920 1640764 N_ambiguous 810477 1996 80190 UnstrandedReadsAssigned:25118010 PositiveStrandReadsAssigned:1080504 NegativeStrandReadsAssigned:25501466 Dataset is classified negative stranded MeadianReadLen=138 20thPercentileLength=94 echo kmer=89 SRR8846558 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8846558-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,559,383 reads, 26,051,000 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52973 SRR8846558.ke.tsv 35125 SRR8846558.se.tsv 88098 total ==> SRR8846558.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 787 28.6231 PNS24243 293 194 0 0 KQK14069 1603 1504 7512 249.232 KQK14071 474 375 0 0 ==> SRR8846558.se.tsv <== BRADI_1g14170v3 7467 BRADI_1g53295v3 81 BRADI_1g59795v3 190 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 1332 BRADI_1g74790v3 182 BRADI_1g09890v3 15 BRADI_1g77505v3 438 BRADI_1g48960v3 0 SRR8846558 completed mapping pipeline successfully