Starting /dee2/code/volunteer_pipeline.sh SRR8846560 current disk space = 1515284873216 free memory = 1597791320 SRR8846560 SRAfilesize 5ace06bc809aa7fddf035258c2ccc097 SRR8846560.sra SRR8846560.sra file validated SRR8846560 is paired end SRR8846560 is conventional basespace SRR8846560 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846560_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.4435 25.0 18.0 32.0 18.0 33.0 2 22.94675 18.0 18.0 29.0 18.0 31.0 3 26.59775 27.0 25.0 30.0 18.0 31.0 4 30.74925 32.0 32.0 33.0 27.0 33.0 5 31.9185 33.0 32.0 33.0 31.0 33.0 6 36.48025 38.0 37.0 38.0 33.0 38.0 7 36.8315 38.0 38.0 38.0 35.0 38.0 8 36.92675 38.0 38.0 38.0 35.0 38.0 9 37.1485 38.0 38.0 38.0 36.0 38.0 10-14 37.10345 38.0 38.0 38.0 35.8 38.0 15-19 37.02239999999999 38.0 38.0 38.0 35.8 38.0 20-24 37.07525 38.0 38.0 38.0 35.8 38.0 25-29 37.325599999999994 38.0 38.0 38.0 36.8 38.0 30-34 37.25124999999999 38.0 38.0 38.0 36.6 38.0 35-39 37.07895 38.0 38.0 38.0 35.6 38.0 40-44 36.853899999999996 38.0 38.0 38.0 34.8 38.0 45-49 36.8928 38.0 38.0 38.0 35.0 38.0 50-54 36.91825000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.7511 38.0 38.0 38.0 34.6 38.0 60-64 36.476150000000004 38.0 38.0 38.0 34.0 38.0 65-69 36.366949999999996 38.0 37.0 38.0 33.6 38.0 70-74 36.28635 38.0 37.0 38.0 33.0 38.0 75-79 36.3022 38.0 37.0 38.0 33.4 38.0 80-84 36.10305 38.0 36.8 38.0 32.4 38.0 85-89 35.9169 38.0 36.8 38.0 31.8 38.0 90-94 35.253750000000004 38.0 35.6 38.0 28.8 38.0 95-99 35.0659 38.0 35.4 38.0 28.0 38.0 100-104 35.14215 38.0 35.0 38.0 28.8 38.0 105-109 34.6816 38.0 34.8 38.0 26.6 38.0 110-114 33.7099 37.6 33.6 38.0 20.0 38.0 115-119 33.047450000000005 37.0 32.8 38.0 15.0 38.0 120-124 32.9326 37.0 32.6 38.0 16.2 38.0 125-129 32.746 36.4 32.2 38.0 16.2 38.0 130-134 31.507550000000002 35.4 29.2 38.0 14.4 38.0 135-139 30.073050000000002 34.6 25.0 38.0 13.6 38.0 140-144 29.253000000000004 34.6 23.0 38.0 13.0 38.0 145-149 27.88285 34.2 20.2 38.0 2.0 38.0 150-151 22.71075 29.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 2.0 17 2.0 18 5.0 19 4.0 20 7.0 21 11.0 22 6.0 23 11.0 24 23.0 25 24.0 26 25.0 27 44.0 28 63.0 29 88.0 30 108.0 31 156.0 32 230.0 33 307.0 34 488.0 35 717.0 36 1147.0 37 529.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.1446249033256 13.921113689095128 9.590100541376643 35.34416086620263 2 28.625 19.650000000000002 35.25 16.475 3 21.3 26.05 26.35 26.3 4 22.825 33.800000000000004 22.025 21.349999999999998 5 23.625 33.25 22.8 20.325 6 19.275000000000002 33.875 23.175 23.674999999999997 7 15.775 18.95 42.1 23.175 8 20.225 21.475 27.175 31.125000000000004 9 19.7 19.400000000000002 31.85 29.049999999999997 10-14 23.075000000000003 25.34 24.759999999999998 26.825 15-19 22.52 26.095000000000002 26.105 25.28 20-24 22.25 26.700000000000003 25.985000000000003 25.064999999999998 25-29 21.865000000000002 26.435 26.400000000000002 25.3 30-34 22.505 26.179999999999996 25.985000000000003 25.330000000000002 35-39 21.77 26.179999999999996 26.56 25.490000000000002 40-44 22.345000000000002 26.22 26.384999999999998 25.05 45-49 22.825 25.874999999999996 26.125 25.174999999999997 50-54 21.895 26.845000000000002 25.735000000000003 25.525 55-59 22.54 26.784999999999997 25.865 24.81 60-64 22.46 26.245 26.115 25.180000000000003 65-69 22.07 26.375 25.995 25.56 70-74 22.54 25.729999999999997 26.43 25.3 75-79 22.994999999999997 25.805 25.75 25.45 80-84 22.665 25.995 25.97 25.369999999999997 85-89 22.95 25.635 25.915 25.5 90-94 22.925 25.985000000000003 25.545 25.545 95-99 22.545 25.430000000000003 26.5 25.525 100-104 23.395 25.965 25.724999999999998 24.915000000000003 105-109 23.135 25.85 26.125 24.89 110-114 22.900000000000002 25.979999999999997 25.7 25.419999999999998 115-119 23.494999999999997 25.465 26.150000000000002 24.89 120-124 22.900000000000002 25.319999999999997 25.86 25.919999999999998 125-129 23.015 25.679999999999996 26.005 25.3 130-134 22.91 25.685000000000002 25.759999999999998 25.645 135-139 23.005 25.455 26.145000000000003 25.395 140-144 22.88 25.495 26.33 25.295 145-149 23.075000000000003 25.845000000000002 25.455 25.624999999999996 150-151 22.875 25.2625 25.324999999999996 26.5375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 3.5 28 6.0 29 7.5 30 9.0 31 11.0 32 20.0 33 28.0 34 32.5 35 33.0 36 46.0 37 73.0 38 93.5 39 117.5 40 145.0 41 171.0 42 182.5 43 201.5 44 229.5 45 232.0 46 221.0 47 219.5 48 210.5 49 181.0 50 165.5 51 159.0 52 134.5 53 114.5 54 106.5 55 91.0 56 73.5 57 75.0 58 68.0 59 51.0 60 54.5 61 55.5 62 40.0 63 33.5 64 39.5 65 42.0 66 40.0 67 33.5 68 35.0 69 31.5 70 22.5 71 16.5 72 10.5 73 9.0 74 8.0 75 4.5 76 1.5 77 2.0 78 1.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.22567703109327986 0.44999999999999996 3 0.0 0.0 4 0.025075225677031094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1749999999999998 0.0 0.0 0.0 0.0 124-125 1.325 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 1.9874999999999998 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138-139 2.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACATG 10 0.006832588 144.9875 2 >>END_MODULE SRR8846560 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846560_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.591 33.0 33.0 34.0 32.0 34.0 2 32.59125 33.0 33.0 34.0 32.0 34.0 3 32.70725 33.0 33.0 34.0 32.0 34.0 4 32.59575 33.0 33.0 34.0 32.0 34.0 5 32.61775 33.0 33.0 34.0 32.0 34.0 6 36.76975 38.0 38.0 38.0 35.0 38.0 7 36.8665 38.0 38.0 38.0 35.0 38.0 8 36.88425 38.0 38.0 38.0 35.0 38.0 9 36.924 38.0 38.0 38.0 36.0 38.0 10-14 36.871050000000004 38.0 38.0 38.0 35.4 38.0 15-19 36.9126 38.0 38.0 38.0 35.6 38.0 20-24 36.87435000000001 38.0 38.0 38.0 35.4 38.0 25-29 36.769349999999996 38.0 38.0 38.0 35.0 38.0 30-34 36.611000000000004 38.0 38.0 38.0 34.6 38.0 35-39 36.674150000000004 38.0 38.0 38.0 35.0 38.0 40-44 36.57545 38.0 38.0 38.0 34.4 38.0 45-49 36.50735 38.0 38.0 38.0 34.0 38.0 50-54 36.24395 38.0 37.8 38.0 33.6 38.0 55-59 36.057 38.0 37.4 38.0 32.6 38.0 60-64 36.10145 38.0 37.4 38.0 32.6 38.0 65-69 36.3155 38.0 38.0 38.0 33.8 38.0 70-74 36.1258 38.0 37.4 38.0 33.0 38.0 75-79 35.735400000000006 38.0 37.0 38.0 31.0 38.0 80-84 35.8611 38.0 37.0 38.0 31.8 38.0 85-89 35.46695 38.0 36.2 38.0 29.8 38.0 90-94 35.40605 38.0 36.0 38.0 29.2 38.0 95-99 34.96145 38.0 35.6 38.0 27.6 38.0 100-104 34.47185 38.0 35.0 38.0 25.4 38.0 105-109 34.4233 38.0 34.6 38.0 25.0 38.0 110-114 34.1543 38.0 34.0 38.0 23.6 38.0 115-119 33.5501 38.0 34.0 38.0 17.8 38.0 120-124 32.8175 37.2 32.2 38.0 15.0 38.0 125-129 32.7046 37.0 32.0 38.0 15.0 38.0 130-134 31.818899999999996 36.0 31.0 38.0 14.2 38.0 135-139 30.3444 34.4 27.0 38.0 13.2 38.0 140-144 28.83925 33.2 23.4 38.0 8.6 38.0 145-149 26.801849999999995 33.0 15.2 38.0 2.0 38.0 150-151 19.920625 17.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 2.0 5 2.0 6 1.0 7 1.0 8 3.0 9 2.0 10 1.0 11 3.0 12 2.0 13 1.0 14 3.0 15 4.0 16 4.0 17 6.0 18 6.0 19 6.0 20 8.0 21 12.0 22 17.0 23 23.0 24 27.0 25 40.0 26 43.0 27 33.0 28 82.0 29 81.0 30 101.0 31 124.0 32 173.0 33 234.0 34 382.0 35 607.0 36 1078.0 37 882.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.824999999999996 12.950000000000001 13.075000000000001 36.15 2 29.15 19.325 32.375 19.15 3 21.7 23.724999999999998 29.15 25.424999999999997 4 26.375 31.275 19.45 22.900000000000002 5 25.3 35.05 19.3 20.349999999999998 6 21.425 33.95 21.95 22.675 7 20.9 15.25 38.75 25.1 8 22.55 21.525 24.325 31.6 9 22.650000000000002 20.974999999999998 27.625 28.749999999999996 10-14 25.77 25.324999999999996 22.770000000000003 26.135 15-19 25.635 25.180000000000003 24.92 24.265 20-24 25.8 25.88 24.545 23.775 25-29 25.385 26.155 25.064999999999998 23.395 30-34 25.28 25.965 25.1 23.655 35-39 25.095 26.325 24.68 23.9 40-44 26.21 25.31 25.130000000000003 23.35 45-49 25.585 25.64 25.240000000000002 23.535 50-54 25.790000000000003 25.369999999999997 25.52 23.32 55-59 26.39 25.27 24.884999999999998 23.455000000000002 60-64 25.525 26.02 25.55 22.905 65-69 25.264999999999997 25.865 25.465 23.405 70-74 26.05 25.27 25.285000000000004 23.395 75-79 25.419999999999998 25.46 25.545 23.575 80-84 26.035000000000004 25.21 25.335 23.419999999999998 85-89 25.430000000000003 25.845000000000002 25.290000000000003 23.435 90-94 25.124999999999996 26.075 25.44 23.36 95-99 25.61 25.619999999999997 25.474999999999998 23.294999999999998 100-104 25.75 25.91 25.424999999999997 22.915 105-109 25.545 25.825 25.71 22.919999999999998 110-114 25.15 25.729999999999997 26.22 22.900000000000002 115-119 26.195 25.985000000000003 25.025 22.795 120-124 25.724999999999998 26.115 25.135 23.025000000000002 125-129 26.165 26.31 24.54 22.985 130-134 25.88 26.669999999999998 25.205 22.245 135-139 25.590000000000003 26.279999999999998 25.255 22.875 140-144 26.284999999999997 26.11 25.759999999999998 21.845 145-149 25.97 26.21 25.52 22.3 150-151 26.35 26.3 25.525 21.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 1.5 25 0.5 26 1.5 27 2.0 28 2.5 29 6.5 30 9.0 31 9.5 32 13.5 33 21.0 34 31.5 35 35.0 36 41.5 37 59.0 38 78.5 39 105.0 40 119.5 41 122.0 42 155.5 43 196.5 44 219.5 45 222.0 46 209.5 47 207.5 48 194.5 49 170.0 50 156.0 51 151.5 52 132.5 53 103.0 54 92.0 55 91.0 56 86.0 57 81.5 58 83.0 59 86.0 60 78.5 61 69.5 62 62.5 63 56.5 64 57.5 65 56.0 66 52.0 67 50.5 68 44.0 69 38.5 70 36.0 71 27.5 72 21.0 73 14.5 74 12.0 75 9.5 76 6.0 77 4.0 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54739753583102 98.97500000000001 2 0.35202413879808897 0.7000000000000001 3 0.07543374402816193 0.22499999999999998 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.7 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.4375 0.0 0.0 0.0 0.0 138-139 2.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTATCC 10 0.006830828 145.0 2 CTATCCT 10 0.006830828 145.0 3 >>END_MODULE Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra Read 881871 spots for SRR8846560.sra Written 881871 spots for SRR8846560.sra Read 881863 spots for SRR8846560.sra Written 881863 spots for SRR8846560.sra SRR ids: ['SRR8846560.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tk9wdhsq SRR8846560.sra spots: 17637268 blocks: [[1, 881863], [881864, 1763726], [1763727, 2645589], [2645590, 3527452], [3527453, 4409315], [4409316, 5291178], [5291179, 6173041], [6173042, 7054904], [7054905, 7936767], [7936768, 8818630], [8818631, 9700493], [9700494, 10582356], [10582357, 11464219], [11464220, 12346082], [12346083, 13227945], [13227946, 14109808], [14109809, 14991671], [14991672, 15873534], [15873535, 16755397], [16755398, 17637268]] SRR8846560 file size 5954991 SRR8846560 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846560 SRR8846560_1.fastq SRR8846560_2.fastq Input file: SRR8846560_1.fastq Paired file: SRR8846560_2.fastq trimmed: SRR8846560-trimmed-pair1.fastq, SRR8846560-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:06:53 2024 >> started Thu Dec 12 03:07:13 2024 >> done (19.280s) 17637268 read pairs processed; of these: 13399 ( 0.08%) short read pairs filtered out after trimming by size control 11399 ( 0.06%) empty read pairs filtered out after trimming by size control 17612470 (99.86%) read pairs available; of these: 10371808 (58.89%) trimmed read pairs available after processing 7240662 (41.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 5 0.00% 21 7 0.00% 22 7 0.00% 23 9 0.00% 24 2 0.00% 25 6 0.00% 26 6 0.00% 27 5 0.00% 28 10 0.00% 29 11 0.00% 30 12 0.00% 31 17 0.00% 32 9 0.00% 33 9 0.00% 34 18 0.00% 35 12 0.00% 36 12 0.00% 37 15 0.00% 38 8 0.00% 39 10 0.00% 40 12 0.00% 41 15 0.00% 42 19 0.00% 43 16 0.00% 44 12 0.00% 45 16 0.00% 46 26 0.00% 47 27 0.00% 48 35 0.00% 49 28 0.00% 50 33 0.00% 51 35 0.00% 52 38 0.00% 53 26 0.00% 54 60 0.00% 55 56 0.00% 56 65 0.00% 57 64 0.00% 58 65 0.00% 59 79 0.00% 60 101 0.00% 61 103 0.00% 62 102 0.00% 63 128 0.00% 64 129 0.00% 65 162 0.00% 66 155 0.00% 67 182 0.00% 68 216 0.00% 69 182 0.00% 70 253 0.00% 71 275 0.00% 72 329 0.00% 73 402 0.00% 74 437 0.00% 75 469 0.00% 76 477 0.00% 77 557 0.00% 78 641 0.00% 79 737 0.00% 80 722 0.00% 81 841 0.00% 82 1026 0.01% 83 1170 0.01% 84 1672 0.01% 85 1997 0.01% 86 2030 0.01% 87 2264 0.01% 88 2316 0.01% 89 2488 0.01% 90 2620 0.01% 91 2709 0.02% 92 3009 0.02% 93 3219 0.02% 94 3473 0.02% 95 3914 0.02% 96 4004 0.02% 97 4409 0.03% 98 4627 0.03% 99 5067 0.03% 100 5411 0.03% 101 5889 0.03% 102 6215 0.04% 103 6653 0.04% 104 7276 0.04% 105 7846 0.04% 106 8366 0.05% 107 9040 0.05% 108 9608 0.05% 109 10426 0.06% 110 10927 0.06% 111 12071 0.07% 112 13075 0.07% 113 13606 0.08% 114 14789 0.08% 115 15695 0.09% 116 16772 0.10% 117 17628 0.10% 118 19197 0.11% 119 20172 0.11% 120 21721 0.12% 121 23285 0.13% 122 24785 0.14% 123 26534 0.15% 124 28290 0.16% 125 30501 0.17% 126 32622 0.19% 127 35054 0.20% 128 37231 0.21% 129 40151 0.23% 130 43864 0.25% 131 46925 0.27% 132 51333 0.29% 133 56008 0.32% 134 61559 0.35% 135 67332 0.38% 136 74704 0.42% 137 81893 0.46% 138 92534 0.53% 139 104445 0.59% 140 117418 0.67% 141 135603 0.77% 142 157583 0.89% 143 187367 1.06% 144 227352 1.29% 145 288563 1.64% 146 386002 2.19% 147 537640 3.05% 148 779502 4.43% 149 1412464 8.02% 150 4870337 27.65% 151 7240662 41.11% 17612470 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=8.15 fanout-score-rank=10 prefix-density=0.82 prefix-fanout=2.0 sequence=TCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=151.40 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=13.5 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=5.94 fanout-score-rank=12 prefix-density=0.62 prefix-fanout=4.1 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=134.57 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=19.7 sequence=CGCCGCCGCCGC SRR8846560 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:07:52 Started mapping on | Dec 12 03:07:52 Finished on | Dec 12 03:09:04 Mapping speed, Million of reads per hour | 880.62 Number of input reads | 17612470 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17163546 Uniquely mapped reads % | 97.45% Average mapped length | 295.82 Number of splices: Total | 19860934 Number of splices: Annotated (sjdb) | 18712593 Number of splices: GT/AG | 19600443 Number of splices: GC/AG | 234553 Number of splices: AT/AC | 10076 Number of splices: Non-canonical | 15862 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 147676 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 27908 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 309845 309845 309845 N_multimapping 147676 147676 147676 N_noFeature 748240 16697286 888683 N_ambiguous 380488 2595 55127 UnstrandedReadsAssigned:16034818 PositiveStrandReadsAssigned:463665 NegativeStrandReadsAssigned:16219736 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846560 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846560-trimmed-pair1.fastq SRR8846560-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,612,470 reads, 16,260,098 reads pseudoaligned [quant] estimated average fragment length: 283.097 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52973 SRR8846560.ke.tsv 35125 SRR8846560.se.tsv 88098 total ==> SRR8846560.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.492 0 0 PNS24247 1044 761.903 64.4421 7.68068 PNS24249 1928 1645.9 39.3409 2.17055 PNS24246 1044 761.903 64.4421 7.68068 PNS24248 1044 761.903 64.4421 7.68068 PNS24244 1471 1188.9 63.3327 4.83739 PNS24243 293 76.7631 0 0 KQK14069 1603 1320.9 5377.89 369.718 KQK14071 474 213.486 61.5248 26.1704 ==> SRR8846560.se.tsv <== BRADI_1g14170v3 6091 BRADI_1g53295v3 95 BRADI_1g59795v3 320 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 2200 BRADI_1g74790v3 89 BRADI_1g09890v3 0 BRADI_1g77505v3 291 BRADI_1g48960v3 0 SRR8846560 completed mapping pipeline successfully