Starting /dee2/code/volunteer_pipeline.sh SRR8846561 current disk space = 1515281956864 free memory = 1592726700 SRR8846561 SRAfilesize da5308b9e42d5c6965bfaa27d00aa7df SRR8846561.sra SRR8846561.sra file validated SRR8846561 is paired end SRR8846561 is conventional basespace SRR8846561 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846561_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.21625 25.0 18.0 32.0 18.0 33.0 2 30.21 31.0 29.0 33.0 27.0 33.0 3 30.607 33.0 29.0 33.0 27.0 33.0 4 31.79475 33.0 32.0 33.0 30.0 33.0 5 32.34225 33.0 33.0 33.0 31.0 34.0 6 36.63475 38.0 37.0 38.0 34.0 38.0 7 37.29475 38.0 38.0 38.0 36.0 38.0 8 37.22075 38.0 38.0 38.0 36.0 38.0 9 37.41925 38.0 38.0 38.0 37.0 38.0 10-14 37.27405 38.0 38.0 38.0 36.6 38.0 15-19 37.113 38.0 38.0 38.0 36.0 38.0 20-24 37.18375000000001 38.0 38.0 38.0 36.4 38.0 25-29 37.44064999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.36015 38.0 38.0 38.0 36.8 38.0 35-39 37.13590000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.9381 38.0 38.0 38.0 35.4 38.0 45-49 37.039750000000005 38.0 38.0 38.0 35.6 38.0 50-54 37.015550000000005 38.0 38.0 38.0 35.6 38.0 55-59 36.795249999999996 38.0 38.0 38.0 34.8 38.0 60-64 36.60705 38.0 38.0 38.0 34.0 38.0 65-69 36.580400000000004 38.0 37.8 38.0 34.0 38.0 70-74 36.44115 38.0 37.2 38.0 33.8 38.0 75-79 36.424400000000006 38.0 37.0 38.0 33.8 38.0 80-84 36.222300000000004 38.0 37.0 38.0 33.4 38.0 85-89 36.097300000000004 38.0 36.8 38.0 32.6 38.0 90-94 35.53255 38.0 36.0 38.0 30.2 38.0 95-99 35.26845 38.0 35.6 38.0 28.8 38.0 100-104 35.30159999999999 38.0 35.8 38.0 29.4 38.0 105-109 34.9455 38.0 34.8 38.0 28.0 38.0 110-114 33.9827 37.8 33.6 38.0 21.0 38.0 115-119 33.286 37.0 33.2 38.0 15.0 38.0 120-124 33.25545 37.0 32.8 38.0 17.8 38.0 125-129 33.0871 36.8 32.6 38.0 17.4 38.0 130-134 31.96295 35.8 31.0 38.0 15.0 38.0 135-139 30.5842 35.0 26.2 38.0 14.0 38.0 140-144 29.69445 34.8 24.4 38.0 13.4 38.0 145-149 28.44955 34.2 21.8 38.0 4.2 38.0 150-151 22.899625 30.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 2.0 17 3.0 18 1.0 19 3.0 20 2.0 21 7.0 22 4.0 23 10.0 24 16.0 25 20.0 26 26.0 27 36.0 28 49.0 29 74.0 30 107.0 31 141.0 32 205.0 33 275.0 34 446.0 35 715.0 36 1190.0 37 666.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.19017926734217 20.31696544557028 7.976097687711094 39.51675759937646 2 22.625 22.175 34.050000000000004 21.15 3 19.675 29.875 24.075 26.375 4 23.375 33.35 21.5 21.775 5 23.200000000000003 34.050000000000004 24.5 18.25 6 18.825 33.2 24.55 23.425 7 16.1 19.275000000000002 41.3 23.325000000000003 8 18.7 20.325 30.049999999999997 30.925000000000004 9 17.575 20.75 32.0 29.675 10-14 22.75 26.46 24.455 26.334999999999997 15-19 21.78 26.275 26.735 25.21 20-24 21.735 26.779999999999998 27.200000000000003 24.285 25-29 21.97 26.590000000000003 26.855 24.585 30-34 21.36 27.35 26.305 24.985 35-39 21.865000000000002 26.424999999999997 26.52 25.19 40-44 21.775 26.615 26.884999999999998 24.725 45-49 21.65 26.61 26.779999999999998 24.959999999999997 50-54 22.31 26.44 26.705000000000002 24.545 55-59 22.305 26.57 26.650000000000002 24.474999999999998 60-64 21.805 26.68 26.185000000000002 25.330000000000002 65-69 22.245 26.295 26.565 24.895 70-74 22.415 26.590000000000003 25.715 25.28 75-79 22.29 26.935 25.729999999999997 25.045 80-84 21.91 26.275 26.619999999999997 25.195 85-89 22.475 26.56 25.765 25.2 90-94 22.71 26.27 26.02 25.0 95-99 22.384999999999998 26.185000000000002 26.685 24.745 100-104 22.225 26.284999999999997 26.619999999999997 24.87 105-109 22.09 26.245 26.365 25.3 110-114 22.68 26.56 26.355 24.404999999999998 115-119 22.615 26.634999999999998 25.94 24.81 120-124 22.235 26.19 26.384999999999998 25.19 125-129 22.795 26.075 26.295 24.834999999999997 130-134 22.71 25.69 26.63 24.97 135-139 22.64 25.765 26.279999999999998 25.314999999999998 140-144 23.145 26.290000000000003 25.715 24.85 145-149 22.85 25.945 25.974999999999998 25.230000000000004 150-151 23.150000000000002 25.3 26.187500000000004 25.362499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 1.0 27 4.0 28 5.0 29 5.5 30 7.5 31 14.0 32 23.0 33 28.0 34 36.5 35 47.0 36 62.0 37 94.0 38 109.0 39 125.5 40 159.5 41 182.5 42 204.0 43 221.5 44 223.5 45 218.5 46 212.5 47 216.0 48 219.5 49 198.5 50 167.0 51 128.0 52 112.5 53 116.0 54 94.5 55 77.5 56 83.5 57 79.0 58 65.0 59 59.0 60 56.5 61 49.0 62 47.0 63 43.5 64 34.5 65 30.0 66 29.5 67 25.5 68 19.0 69 16.5 70 14.0 71 12.5 72 7.5 73 3.5 74 2.5 75 2.0 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.8999999999999999 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.5750000000000002 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.2750000000000004 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGTAC 10 0.005853838 152.57895 1 >>END_MODULE SRR8846561 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846561_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74125 33.0 33.0 34.0 32.0 34.0 2 32.7555 33.0 33.0 34.0 32.0 34.0 3 32.8525 33.0 33.0 34.0 32.0 34.0 4 32.827 33.0 33.0 34.0 32.0 34.0 5 32.80175 33.0 33.0 34.0 32.0 34.0 6 36.97525 38.0 38.0 38.0 36.0 38.0 7 37.07025 38.0 38.0 38.0 36.0 38.0 8 37.04925 38.0 38.0 38.0 36.0 38.0 9 37.078 38.0 38.0 38.0 36.0 38.0 10-14 37.032199999999996 38.0 38.0 38.0 36.0 38.0 15-19 37.010450000000006 38.0 38.0 38.0 36.0 38.0 20-24 36.98285 38.0 38.0 38.0 36.0 38.0 25-29 36.8471 38.0 38.0 38.0 35.4 38.0 30-34 36.81335 38.0 38.0 38.0 35.0 38.0 35-39 36.86635 38.0 38.0 38.0 35.6 38.0 40-44 36.8536 38.0 38.0 38.0 35.2 38.0 45-49 36.696000000000005 38.0 38.0 38.0 34.6 38.0 50-54 36.38875 38.0 38.0 38.0 33.8 38.0 55-59 36.310500000000005 38.0 38.0 38.0 33.8 38.0 60-64 36.3755 38.0 37.8 38.0 33.8 38.0 65-69 36.55884999999999 38.0 38.0 38.0 34.4 38.0 70-74 36.2781 38.0 37.4 38.0 33.4 38.0 75-79 35.96225 38.0 37.0 38.0 32.6 38.0 80-84 36.018649999999994 38.0 37.0 38.0 32.8 38.0 85-89 35.7282 38.0 36.8 38.0 30.8 38.0 90-94 35.590500000000006 38.0 36.4 38.0 30.2 38.0 95-99 35.18465 38.0 36.0 38.0 28.6 38.0 100-104 34.70465 38.0 35.0 38.0 26.8 38.0 105-109 34.77025 38.0 35.0 38.0 27.2 38.0 110-114 34.35555 38.0 34.6 38.0 24.6 38.0 115-119 33.83535 38.0 34.0 38.0 22.8 38.0 120-124 33.145500000000006 37.6 33.4 38.0 17.4 38.0 125-129 32.8797 37.0 32.2 38.0 17.4 38.0 130-134 32.22565 36.4 31.4 38.0 14.4 38.0 135-139 30.70485 35.0 28.6 38.0 13.4 38.0 140-144 29.3916 33.8 25.4 38.0 10.4 38.0 145-149 27.411849999999998 33.0 20.0 38.0 2.0 38.0 150-151 20.44725 25.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 3.0 9 1.0 10 3.0 11 1.0 12 2.0 13 2.0 14 4.0 15 1.0 16 4.0 17 4.0 18 10.0 19 4.0 20 8.0 21 13.0 22 13.0 23 16.0 24 23.0 25 30.0 26 31.0 27 41.0 28 51.0 29 71.0 30 101.0 31 117.0 32 172.0 33 235.0 34 359.0 35 569.0 36 1143.0 37 959.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.150000000000006 15.85 11.200000000000001 32.800000000000004 2 29.099999999999998 19.5 33.275 18.125 3 21.4 24.175 30.225 24.2 4 25.4 32.775 20.150000000000002 21.675 5 26.05 34.725 20.474999999999998 18.75 6 20.7 35.425000000000004 21.975 21.9 7 20.849999999999998 15.575 40.849999999999994 22.725 8 22.95 20.724999999999998 25.7 30.625000000000004 9 21.675 22.275 28.125 27.925 10-14 26.445 25.264999999999997 23.205000000000002 25.085 15-19 25.430000000000003 25.080000000000002 25.03 24.46 20-24 25.03 26.57 24.955 23.445 25-29 25.040000000000003 26.009999999999998 24.805 24.145 30-34 24.755 25.715 25.785000000000004 23.745 35-39 24.965 26.395000000000003 25.174999999999997 23.465 40-44 24.945 25.465 25.629999999999995 23.96 45-49 25.385 25.41 25.765 23.44 50-54 25.064999999999998 26.145000000000003 25.965 22.825 55-59 25.869999999999997 26.19 25.41 22.53 60-64 25.224999999999998 26.33 25.435000000000002 23.01 65-69 24.85 25.53 26.169999999999998 23.45 70-74 25.485000000000003 26.115 25.430000000000003 22.97 75-79 24.745 25.924999999999997 26.195 23.135 80-84 25.619999999999997 25.790000000000003 25.619999999999997 22.97 85-89 25.445 25.285000000000004 25.840000000000003 23.43 90-94 24.759999999999998 25.945 26.05 23.244999999999997 95-99 25.15 26.174999999999997 25.83 22.845 100-104 25.415 26.05 25.635 22.900000000000002 105-109 25.264999999999997 26.05 25.7 22.985 110-114 26.075 25.96 25.885 22.08 115-119 25.259999999999998 25.985000000000003 26.405 22.35 120-124 25.580000000000002 26.150000000000002 25.790000000000003 22.48 125-129 25.585 26.495 25.755 22.165000000000003 130-134 25.41 26.395000000000003 25.82 22.375 135-139 25.4 25.83 26.22 22.55 140-144 25.44 26.05 26.155 22.355 145-149 25.4 26.395000000000003 25.94 22.264999999999997 150-151 26.775 25.587500000000002 26.437500000000004 21.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 2.0 25 1.5 26 1.0 27 4.0 28 7.5 29 7.0 30 8.0 31 8.5 32 12.0 33 19.0 34 26.0 35 32.0 36 47.0 37 79.0 38 93.0 39 106.5 40 130.0 41 154.0 42 171.5 43 195.5 44 212.0 45 197.5 46 197.5 47 202.0 48 198.0 49 187.0 50 174.5 51 156.5 52 130.0 53 110.5 54 105.5 55 101.5 56 86.0 57 78.5 58 79.0 59 78.0 60 73.0 61 65.0 62 61.5 63 57.0 64 52.0 65 41.5 66 29.5 67 33.5 68 41.5 69 37.5 70 28.0 71 21.0 72 14.0 73 11.5 74 10.5 75 6.0 76 5.5 77 4.5 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4023133014835303 0.8 3 0.050289162685441285 0.15 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.55 0.0 0.0 0.0 0.0 138-139 2.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATTT 10 0.006830828 145.0 2 >>END_MODULE Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra Read 924373 spots for SRR8846561.sra Written 924373 spots for SRR8846561.sra Read 924367 spots for SRR8846561.sra Written 924367 spots for SRR8846561.sra SRR ids: ['SRR8846561.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y7sfpi7g SRR8846561.sra spots: 18487346 blocks: [[1, 924367], [924368, 1848734], [1848735, 2773101], [2773102, 3697468], [3697469, 4621835], [4621836, 5546202], [5546203, 6470569], [6470570, 7394936], [7394937, 8319303], [8319304, 9243670], [9243671, 10168037], [10168038, 11092404], [11092405, 12016771], [12016772, 12941138], [12941139, 13865505], [13865506, 14789872], [14789873, 15714239], [15714240, 16638606], [16638607, 17562973], [17562974, 18487346]] SRR8846561 file size 6243054 SRR8846561 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846561 SRR8846561_1.fastq SRR8846561_2.fastq Input file: SRR8846561_1.fastq Paired file: SRR8846561_2.fastq trimmed: SRR8846561-trimmed-pair1.fastq, SRR8846561-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:07:21 2024 >> started Thu Dec 12 03:07:49 2024 >> done (27.824s) 18487346 read pairs processed; of these: 15458 ( 0.08%) short read pairs filtered out after trimming by size control 14146 ( 0.08%) empty read pairs filtered out after trimming by size control 18457742 (99.84%) read pairs available; of these: 10568243 (57.26%) trimmed read pairs available after processing 7889499 (42.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 3 0.00% 21 6 0.00% 22 10 0.00% 23 7 0.00% 24 10 0.00% 25 12 0.00% 26 7 0.00% 27 9 0.00% 28 11 0.00% 29 7 0.00% 30 7 0.00% 31 8 0.00% 32 8 0.00% 33 8 0.00% 34 6 0.00% 35 16 0.00% 36 11 0.00% 37 13 0.00% 38 8 0.00% 39 9 0.00% 40 22 0.00% 41 16 0.00% 42 16 0.00% 43 23 0.00% 44 16 0.00% 45 18 0.00% 46 23 0.00% 47 16 0.00% 48 17 0.00% 49 21 0.00% 50 32 0.00% 51 37 0.00% 52 55 0.00% 53 46 0.00% 54 48 0.00% 55 41 0.00% 56 39 0.00% 57 50 0.00% 58 64 0.00% 59 73 0.00% 60 85 0.00% 61 89 0.00% 62 125 0.00% 63 97 0.00% 64 125 0.00% 65 142 0.00% 66 159 0.00% 67 179 0.00% 68 187 0.00% 69 255 0.00% 70 233 0.00% 71 280 0.00% 72 329 0.00% 73 394 0.00% 74 446 0.00% 75 457 0.00% 76 570 0.00% 77 597 0.00% 78 625 0.00% 79 718 0.00% 80 777 0.00% 81 909 0.00% 82 1110 0.01% 83 1266 0.01% 84 1992 0.01% 85 2333 0.01% 86 2449 0.01% 87 2530 0.01% 88 2726 0.01% 89 2852 0.02% 90 2973 0.02% 91 3197 0.02% 92 3414 0.02% 93 3710 0.02% 94 3989 0.02% 95 4224 0.02% 96 4613 0.02% 97 4889 0.03% 98 5260 0.03% 99 5575 0.03% 100 6068 0.03% 101 6336 0.03% 102 6971 0.04% 103 7426 0.04% 104 7977 0.04% 105 8406 0.05% 106 9228 0.05% 107 9809 0.05% 108 10405 0.06% 109 11019 0.06% 110 11740 0.06% 111 12741 0.07% 112 13439 0.07% 113 14297 0.08% 114 15209 0.08% 115 15918 0.09% 116 17338 0.09% 117 18455 0.10% 118 19499 0.11% 119 20456 0.11% 120 21795 0.12% 121 23202 0.13% 122 24732 0.13% 123 26489 0.14% 124 28032 0.15% 125 29936 0.16% 126 32130 0.17% 127 34186 0.19% 128 36367 0.20% 129 39176 0.21% 130 42576 0.23% 131 45781 0.25% 132 49573 0.27% 133 53797 0.29% 134 58635 0.32% 135 64985 0.35% 136 71194 0.39% 137 78697 0.43% 138 87513 0.47% 139 98997 0.54% 140 110722 0.60% 141 127316 0.69% 142 148960 0.81% 143 177481 0.96% 144 216289 1.17% 145 274567 1.49% 146 371318 2.01% 147 524114 2.84% 148 773789 4.19% 149 1421717 7.70% 150 5163702 27.98% 151 7889499 42.74% 18457742 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=8.98 fanout-score-rank=11 prefix-density=0.79 prefix-fanout=2.0 sequence=TCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=40.59 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.3 sequence=CCTTGATCTTCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=40 prefix-density=0.37 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=613.77 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=20.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR8846561 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:08:38 Started mapping on | Dec 12 03:08:39 Finished on | Dec 12 03:09:54 Mapping speed, Million of reads per hour | 885.97 Number of input reads | 18457742 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18132039 Uniquely mapped reads % | 98.24% Average mapped length | 296.09 Number of splices: Total | 21076161 Number of splices: Annotated (sjdb) | 19850916 Number of splices: GT/AG | 20802782 Number of splices: GC/AG | 248097 Number of splices: AT/AC | 10806 Number of splices: Non-canonical | 14476 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 150900 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 11568 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 184689 184689 184689 N_multimapping 150900 150900 150900 N_noFeature 803627 17614516 975197 N_ambiguous 403333 2550 58074 UnstrandedReadsAssigned:16925079 PositiveStrandReadsAssigned:514973 NegativeStrandReadsAssigned:17098768 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR8846561 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846561-trimmed-pair1.fastq SRR8846561-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,457,742 reads, 17,142,911 reads pseudoaligned [quant] estimated average fragment length: 276.652 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52973 SRR8846561.ke.tsv 35125 SRR8846561.se.tsv 88098 total ==> SRR8846561.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 660.819 0 0 PNS24247 1044 768.348 60.3516 6.79886 PNS24249 1928 1652.35 37.3777 1.95801 PNS24246 1044 768.348 60.3516 6.79886 PNS24248 1044 768.348 60.3516 6.79886 PNS24244 1471 1195.35 61.5674 4.45822 PNS24243 293 78.0861 0 0 KQK14069 1603 1327.35 4376.24 285.379 KQK14071 474 215.773 33.9909 13.6355 ==> SRR8846561.se.tsv <== BRADI_1g14170v3 4980 BRADI_1g53295v3 103 BRADI_1g59795v3 330 BRADI_1g07683v3 0 BRADI_1g00485v3 67 BRADI_1g20270v3 2489 BRADI_1g74790v3 98 BRADI_1g09890v3 0 BRADI_1g77505v3 320 BRADI_1g48960v3 0 SRR8846561 completed mapping pipeline successfully