Starting /dee2/code/volunteer_pipeline.sh SRR8846562 current disk space = 1526959144960 free memory = 1544354412 SRR8846562 SRAfilesize 3d3d42fa5ea113c5924d73f34851cdd8 SRR8846562.sra SRR8846562.sra file validated SRR8846562 is paired end SRR8846562 is conventional basespace SRR8846562 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846562_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.11325 33.0 32.0 33.0 18.0 34.0 2 32.143 33.0 32.0 34.0 28.0 34.0 3 31.46375 33.0 31.0 33.0 27.0 34.0 4 32.23975 33.0 33.0 34.0 30.0 34.0 5 32.70825 33.0 33.0 34.0 32.0 34.0 6 37.1695 38.0 38.0 38.0 36.0 38.0 7 37.328 38.0 38.0 38.0 37.0 38.0 8 37.37725 38.0 38.0 38.0 37.0 38.0 9 37.42625 38.0 38.0 38.0 37.0 38.0 10-14 37.2571 38.0 38.0 38.0 36.6 38.0 15-19 37.07075 38.0 38.0 38.0 36.2 38.0 20-24 37.037099999999995 38.0 38.0 38.0 35.8 38.0 25-29 37.24205 38.0 38.0 38.0 36.6 38.0 30-34 37.1194 38.0 38.0 38.0 36.0 38.0 35-39 36.90945000000001 38.0 38.0 38.0 35.4 38.0 40-44 36.59974999999999 38.0 38.0 38.0 34.2 38.0 45-49 36.518950000000004 38.0 38.0 38.0 33.8 38.0 50-54 36.7933 38.0 38.0 38.0 34.6 38.0 55-59 36.5319 38.0 38.0 38.0 33.8 38.0 60-64 36.2547 38.0 37.6 38.0 32.8 38.0 65-69 36.08055 38.0 37.0 38.0 31.6 38.0 70-74 35.93945 38.0 37.0 38.0 30.8 38.0 75-79 36.08540000000001 38.0 36.8 38.0 32.2 38.0 80-84 36.00965000000001 38.0 37.0 38.0 32.2 38.0 85-89 35.6528 38.0 36.2 38.0 30.2 38.0 90-94 34.99829999999999 38.0 35.2 38.0 27.8 38.0 95-99 34.83845 38.0 35.2 38.0 27.0 38.0 100-104 35.154199999999996 38.0 35.2 38.0 28.6 38.0 105-109 34.6644 38.0 34.6 38.0 26.8 38.0 110-114 32.95375 37.2 32.0 38.0 16.6 38.0 115-119 32.71485 36.8 31.4 38.0 16.2 38.0 120-124 33.169799999999995 36.8 32.6 38.0 19.8 38.0 125-129 32.7934 36.6 32.2 38.0 17.4 38.0 130-134 31.60285 35.4 29.4 38.0 14.4 38.0 135-139 30.06235 34.8 25.2 38.0 13.6 38.0 140-144 29.248399999999997 34.4 23.6 38.0 13.0 38.0 145-149 27.936649999999997 34.0 19.2 38.0 4.2 38.0 150-151 22.57875 28.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 4.0 17 4.0 18 2.0 19 5.0 20 2.0 21 3.0 22 11.0 23 12.0 24 28.0 25 33.0 26 41.0 27 53.0 28 67.0 29 82.0 30 106.0 31 154.0 32 189.0 33 277.0 34 451.0 35 736.0 36 1097.0 37 639.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.66553436111837 15.67807682257643 8.021949307551607 36.634439508753594 2 24.525 20.7 35.75 19.025 3 20.525 25.7 26.150000000000002 27.625 4 23.849999999999998 32.25 21.725 22.175 5 23.986993496748372 34.092046023011505 22.136068034017008 19.78489244622311 6 21.175 33.2 22.900000000000002 22.725 7 16.900000000000002 20.375 40.400000000000006 22.325 8 19.475 19.650000000000002 29.299999999999997 31.574999999999996 9 20.424999999999997 20.025000000000002 30.4 29.15 10-14 23.57 25.36 24.33 26.740000000000002 15-19 22.66 25.85 26.169999999999998 25.319999999999997 20-24 22.045 26.58 26.340000000000003 25.035 25-29 22.384999999999998 26.495 26.11 25.009999999999998 30-34 22.470000000000002 26.240000000000002 25.895000000000003 25.395 35-39 22.625 26.06 25.97 25.345000000000002 40-44 22.830000000000002 26.145000000000003 25.729999999999997 25.295 45-49 22.575 25.900000000000002 25.840000000000003 25.685000000000002 50-54 22.564999999999998 25.674999999999997 26.075 25.685000000000002 55-59 22.85 26.13 25.745 25.275 60-64 22.59 26.16 25.369999999999997 25.88 65-69 22.95 25.840000000000003 25.929999999999996 25.28 70-74 23.1 25.72 25.56 25.619999999999997 75-79 23.455000000000002 25.900000000000002 25.435000000000002 25.21 80-84 23.0 25.385 26.06 25.555 85-89 23.525 25.85 25.835 24.79 90-94 23.47 25.729999999999997 25.419999999999998 25.380000000000003 95-99 23.205000000000002 25.7 25.355 25.740000000000002 100-104 23.575 25.785000000000004 25.619999999999997 25.019999999999996 105-109 23.49 25.865 25.509999999999998 25.135 110-114 23.28 25.185000000000002 26.505000000000003 25.03 115-119 23.830000000000002 25.674999999999997 25.575 24.92 120-124 22.869999999999997 26.08 25.56 25.490000000000002 125-129 22.975 25.169999999999998 26.224999999999998 25.629999999999995 130-134 23.810000000000002 25.21 25.874999999999996 25.105 135-139 24.12 25.019999999999996 25.240000000000002 25.619999999999997 140-144 23.97 25.790000000000003 24.815 25.424999999999997 145-149 23.215 25.345000000000002 25.324999999999996 26.115 150-151 23.325000000000003 25.2875 26.174999999999997 25.2125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.0 28 4.0 29 7.5 30 10.5 31 12.0 32 17.5 33 31.0 34 36.5 35 45.0 36 66.5 37 81.0 38 94.5 39 122.0 40 138.0 41 152.5 42 178.5 43 183.5 44 196.0 45 214.5 46 204.0 47 203.5 48 213.5 49 184.0 50 144.5 51 142.0 52 140.0 53 114.0 54 99.0 55 85.5 56 73.5 57 84.0 58 83.0 59 64.5 60 56.0 61 51.5 62 54.0 63 59.5 64 54.5 65 50.5 66 49.0 67 44.0 68 33.5 69 29.0 70 23.0 71 18.0 72 15.5 73 9.0 74 6.0 75 6.0 76 5.5 77 2.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.324999999999999 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.525 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCAGG 10 0.0068343505 144.975 9 >>END_MODULE SRR8846562 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846562_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6595 33.0 33.0 34.0 32.0 34.0 2 32.73625 33.0 33.0 34.0 32.0 34.0 3 32.75975 33.0 33.0 34.0 32.0 34.0 4 32.80475 33.0 33.0 34.0 32.0 34.0 5 32.61075 33.0 33.0 34.0 32.0 34.0 6 36.8815 38.0 38.0 38.0 35.0 38.0 7 36.8565 38.0 38.0 38.0 35.0 38.0 8 36.96875 38.0 38.0 38.0 36.0 38.0 9 36.889 38.0 38.0 38.0 35.0 38.0 10-14 36.88225 38.0 38.0 38.0 35.4 38.0 15-19 36.96405 38.0 38.0 38.0 36.0 38.0 20-24 36.9244 38.0 38.0 38.0 35.6 38.0 25-29 36.75575 38.0 38.0 38.0 34.8 38.0 30-34 36.5931 38.0 38.0 38.0 34.4 38.0 35-39 36.774950000000004 38.0 38.0 38.0 35.2 38.0 40-44 36.72885 38.0 38.0 38.0 35.0 38.0 45-49 36.474599999999995 38.0 38.0 38.0 34.0 38.0 50-54 36.3012 38.0 37.8 38.0 33.0 38.0 55-59 36.0411 38.0 37.2 38.0 32.6 38.0 60-64 36.25335 38.0 37.6 38.0 33.4 38.0 65-69 36.31805 38.0 38.0 38.0 33.8 38.0 70-74 36.1562 38.0 37.2 38.0 33.2 38.0 75-79 35.76165 38.0 37.0 38.0 30.6 38.0 80-84 35.9386 38.0 37.0 38.0 32.6 38.0 85-89 35.89045 38.0 37.0 38.0 31.8 38.0 90-94 35.420100000000005 38.0 36.2 38.0 29.6 38.0 95-99 34.82625 38.0 35.2 38.0 27.2 38.0 100-104 34.7082 38.0 35.0 38.0 26.6 38.0 105-109 34.7367 38.0 35.0 38.0 27.0 38.0 110-114 34.22955 38.0 34.6 38.0 24.6 38.0 115-119 33.6813 38.0 34.0 38.0 21.8 38.0 120-124 33.1256 37.6 33.2 38.0 15.0 38.0 125-129 32.96295 37.0 33.0 38.0 15.0 38.0 130-134 32.0543 36.0 31.0 38.0 14.0 38.0 135-139 30.90735 35.0 29.2 38.0 13.2 38.0 140-144 29.31875 33.0 24.4 38.0 10.8 38.0 145-149 27.797499999999996 33.0 21.2 38.0 2.0 38.0 150-151 20.679000000000002 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 1.0 5 3.0 6 1.0 7 2.0 8 1.0 9 0.0 10 2.0 11 1.0 12 2.0 13 3.0 14 5.0 15 3.0 16 6.0 17 4.0 18 11.0 19 3.0 20 13.0 21 19.0 22 16.0 23 13.0 24 18.0 25 36.0 26 27.0 27 39.0 28 80.0 29 71.0 30 90.0 31 117.0 32 166.0 33 231.0 34 320.0 35 647.0 36 1084.0 37 961.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.125 16.25 10.549999999999999 33.074999999999996 2 29.599999999999998 19.6 30.599999999999998 20.200000000000003 3 22.425 24.224999999999998 27.825 25.525 4 27.250000000000004 31.4 19.675 21.675 5 26.125 33.625 19.475 20.775 6 21.3 35.85 19.900000000000002 22.95 7 21.075 15.2 39.75 23.974999999999998 8 21.65 21.675 24.85 31.825 9 22.875 20.575 26.174999999999997 30.375000000000004 10-14 26.245 25.0 23.005 25.75 15-19 25.865 25.305 24.455 24.375 20-24 25.650000000000002 25.235000000000003 24.81 24.305 25-29 26.13 25.03 24.8 24.04 30-34 25.395 25.44 24.759999999999998 24.404999999999998 35-39 26.115 25.82 24.525 23.54 40-44 25.929999999999996 25.285000000000004 24.485 24.3 45-49 26.14 25.264999999999997 24.495 24.099999999999998 50-54 25.665 25.41 25.165 23.76 55-59 26.02 25.215 25.074999999999996 23.69 60-64 25.619999999999997 24.985 25.005 24.39 65-69 25.71 25.91 24.66 23.72 70-74 25.330000000000002 25.779999999999998 25.205 23.685000000000002 75-79 26.035000000000004 25.275 24.635 24.055 80-84 25.6 25.885 24.38 24.135 85-89 25.585 25.255 24.84 24.32 90-94 25.785000000000004 25.629999999999995 25.235000000000003 23.35 95-99 25.900000000000002 25.28 25.275 23.544999999999998 100-104 26.05 24.95 25.155 23.845 105-109 25.259999999999998 25.53 25.155 24.055 110-114 25.124999999999996 25.355 25.27 24.25 115-119 25.6 25.755 24.955 23.69 120-124 25.71 25.44 25.405 23.445 125-129 25.915 25.264999999999997 25.695 23.125 130-134 26.240000000000002 25.645 25.495 22.62 135-139 25.69 25.595000000000002 25.41 23.305 140-144 26.090000000000003 25.96 25.11 22.84 145-149 26.179999999999996 26.029999999999998 25.035 22.755 150-151 26.525 25.6 24.8125 23.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 2.5 28 3.0 29 3.5 30 6.5 31 8.5 32 14.5 33 22.5 34 27.0 35 24.0 36 34.0 37 55.0 38 65.0 39 89.0 40 117.0 41 141.5 42 163.5 43 183.0 44 203.0 45 219.0 46 205.5 47 180.0 48 170.5 49 170.0 50 152.5 51 130.5 52 134.5 53 124.0 54 103.0 55 94.0 56 93.5 57 90.5 58 86.5 59 90.5 60 97.5 61 85.0 62 79.0 63 76.5 64 62.0 65 57.5 66 59.0 67 56.5 68 53.0 69 46.0 70 33.0 71 24.0 72 19.5 73 14.5 74 7.0 75 6.5 76 6.0 77 2.5 78 0.5 79 0.0 80 0.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29399899142713 98.45 2 0.5799293998991427 1.15 3 0.10085728693898136 0.3 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7125 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.05 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.525 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.5250000000000004 0.0 0.0 0.0 0.0 138-139 2.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCTGAT 10 0.006830828 145.0 9 CCGCTGA 10 0.006830828 145.0 8 CAGATGT 10 0.006830828 145.0 8 >>END_MODULE Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347995 spots for SRR8846562.sra Written 1347995 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra Read 1347990 spots for SRR8846562.sra Written 1347990 spots for SRR8846562.sra SRR ids: ['SRR8846562.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jamiiq9h SRR8846562.sra spots: 26959805 blocks: [[1, 1347990], [1347991, 2695980], [2695981, 4043970], [4043971, 5391960], [5391961, 6739950], [6739951, 8087940], [8087941, 9435930], [9435931, 10783920], [10783921, 12131910], [12131911, 13479900], [13479901, 14827890], [14827891, 16175880], [16175881, 17523870], [17523871, 18871860], [18871861, 20219850], [20219851, 21567840], [21567841, 22915830], [22915831, 24263820], [24263821, 25611810], [25611811, 26959805]] SRR8846562 file size 9114092 SRR8846562 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846562 SRR8846562_1.fastq SRR8846562_2.fastq Input file: SRR8846562_1.fastq Paired file: SRR8846562_2.fastq trimmed: SRR8846562-trimmed-pair1.fastq, SRR8846562-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 11:40:48 2024 >> started Mon Dec 9 11:41:36 2024 >> done (48.152s) 26959805 read pairs processed; of these: 19363 ( 0.07%) short read pairs filtered out after trimming by size control 12508 ( 0.05%) empty read pairs filtered out after trimming by size control 26927934 (99.88%) read pairs available; of these: 15003838 (55.72%) trimmed read pairs available after processing 11924096 (44.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 6 0.00% 20 12 0.00% 21 9 0.00% 22 11 0.00% 23 15 0.00% 24 15 0.00% 25 18 0.00% 26 16 0.00% 27 12 0.00% 28 9 0.00% 29 16 0.00% 30 13 0.00% 31 21 0.00% 32 20 0.00% 33 14 0.00% 34 10 0.00% 35 12 0.00% 36 21 0.00% 37 17 0.00% 38 19 0.00% 39 22 0.00% 40 21 0.00% 41 14 0.00% 42 25 0.00% 43 20 0.00% 44 21 0.00% 45 34 0.00% 46 25 0.00% 47 46 0.00% 48 39 0.00% 49 50 0.00% 50 49 0.00% 51 53 0.00% 52 53 0.00% 53 76 0.00% 54 48 0.00% 55 70 0.00% 56 79 0.00% 57 94 0.00% 58 108 0.00% 59 131 0.00% 60 135 0.00% 61 136 0.00% 62 171 0.00% 63 160 0.00% 64 196 0.00% 65 197 0.00% 66 246 0.00% 67 282 0.00% 68 265 0.00% 69 314 0.00% 70 388 0.00% 71 415 0.00% 72 478 0.00% 73 514 0.00% 74 598 0.00% 75 629 0.00% 76 761 0.00% 77 856 0.00% 78 924 0.00% 79 1080 0.00% 80 1211 0.00% 81 1319 0.00% 82 1515 0.01% 83 1809 0.01% 84 2800 0.01% 85 3297 0.01% 86 3358 0.01% 87 3617 0.01% 88 3774 0.01% 89 3996 0.01% 90 4135 0.02% 91 4414 0.02% 92 4829 0.02% 93 5258 0.02% 94 5647 0.02% 95 6206 0.02% 96 6595 0.02% 97 7189 0.03% 98 7701 0.03% 99 8283 0.03% 100 8755 0.03% 101 9662 0.04% 102 10281 0.04% 103 11153 0.04% 104 12038 0.04% 105 12913 0.05% 106 14079 0.05% 107 14896 0.06% 108 15994 0.06% 109 17172 0.06% 110 18268 0.07% 111 19572 0.07% 112 21016 0.08% 113 22220 0.08% 114 23792 0.09% 115 25474 0.09% 116 26913 0.10% 117 28423 0.11% 118 30297 0.11% 119 32271 0.12% 120 34260 0.13% 121 36309 0.13% 122 38212 0.14% 123 40945 0.15% 124 44146 0.16% 125 46955 0.17% 126 49990 0.19% 127 52857 0.20% 128 56422 0.21% 129 60399 0.22% 130 65227 0.24% 131 69518 0.26% 132 75355 0.28% 133 81255 0.30% 134 87614 0.33% 135 95571 0.35% 136 104308 0.39% 137 115075 0.43% 138 127526 0.47% 139 142937 0.53% 140 159474 0.59% 141 179880 0.67% 142 209097 0.78% 143 245425 0.91% 144 296035 1.10% 145 368393 1.37% 146 484031 1.80% 147 682644 2.54% 148 1000438 3.72% 149 1925886 7.15% 150 7555393 28.06% 151 11924096 44.28% 26927934 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=10 prefix-density=0.94 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=32.36 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.7 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAG criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=12 prefix-density=0.84 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=173.69 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=11.5 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR8846562 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 11:46:42 Started mapping on | Dec 09 11:46:42 Finished on | Dec 09 11:49:09 Mapping speed, Million of reads per hour | 659.46 Number of input reads | 26927934 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 26377388 Uniquely mapped reads % | 97.96% Average mapped length | 296.10 Number of splices: Total | 30099905 Number of splices: Annotated (sjdb) | 28451291 Number of splices: GT/AG | 29710711 Number of splices: GC/AG | 352720 Number of splices: AT/AC | 14363 Number of splices: Non-canonical | 22111 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231618 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 20097 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 332556 332556 332556 N_multimapping 231618 231618 231618 N_noFeature 900481 25670240 1083912 N_ambiguous 612314 3543 89564 UnstrandedReadsAssigned:24864593 PositiveStrandReadsAssigned:703605 NegativeStrandReadsAssigned:25203912 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR8846562 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8846562-trimmed-pair1.fastq SRR8846562-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,927,934 reads, 25,290,618 reads pseudoaligned [quant] estimated average fragment length: 272.562 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52973 SRR8846562.ke.tsv 35125 SRR8846562.se.tsv 88098 total ==> SRR8846562.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.95 0 0 PNS24247 1044 772.438 74.5735 5.4221 PNS24249 1928 1656.44 39.4551 1.33775 PNS24246 1044 772.438 74.5735 5.4221 PNS24248 1044 772.438 74.5735 5.4221 PNS24244 1471 1199.44 65.8244 3.08217 PNS24243 293 79.3007 0 0 KQK14069 1603 1331.44 3200.68 135.011 KQK14071 474 218.773 126.432 32.457 ==> SRR8846562.se.tsv <== BRADI_1g14170v3 4630 BRADI_1g53295v3 102 BRADI_1g59795v3 1008 BRADI_1g07683v3 0 BRADI_1g00485v3 66 BRADI_1g20270v3 4434 BRADI_1g74790v3 102 BRADI_1g09890v3 8 BRADI_1g77505v3 332 BRADI_1g48960v3 0 SRR8846562 completed mapping pipeline successfully