Starting /dee2/code/volunteer_pipeline.sh SRR8846564 current disk space = 1526776098816 free memory = 1355355552 SRR8846564 SRAfilesize 40dd20265972cdcbd8afa3420f5f23fa SRR8846564.sra SRR8846564.sra file validated SRR8846564 is single end SRR8846564 is conventional basespace SRR8846564 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846564_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 40 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9405 33.0 32.0 33.0 18.0 34.0 2 32.19075 33.0 32.0 34.0 29.0 34.0 3 32.301 33.0 32.0 34.0 32.0 34.0 4 32.63375 33.0 32.0 34.0 32.0 34.0 5 32.621 33.0 32.0 34.0 32.0 34.0 6 35.018 37.0 33.0 37.0 32.0 37.0 7 35.01175 37.0 33.0 37.0 32.0 37.0 8 35.0395 37.0 33.0 37.0 32.0 37.0 9 35.08275 37.0 33.0 37.0 32.0 37.0 10 35.108 37.0 34.0 37.0 33.0 37.0 11 35.14675 37.0 34.0 37.0 33.0 37.0 12 35.25825 37.0 34.0 37.0 33.0 37.0 13 36.992 38.0 38.0 38.0 36.0 38.0 14 37.157 38.0 38.0 38.0 37.0 38.0 15 37.18675 38.0 38.0 38.0 37.0 38.0 16 37.0685 38.0 38.0 38.0 36.0 38.0 17 37.0895 38.0 38.0 38.0 36.0 38.0 18 37.0285 38.0 38.0 38.0 36.0 38.0 19 37.0345 38.0 38.0 38.0 36.0 38.0 20 37.134 38.0 38.0 38.0 37.0 38.0 21 37.0105 38.0 38.0 38.0 36.0 38.0 22 36.9325 38.0 38.0 38.0 36.0 38.0 23 37.59475 39.0 38.0 39.0 37.0 39.0 24 37.497 39.0 38.0 39.0 36.0 39.0 25 37.6385 39.0 38.0 39.0 36.0 39.0 26 37.37 39.0 38.0 39.0 36.0 39.0 27 37.484 39.0 38.0 39.0 36.0 39.0 28 37.6025 39.0 38.0 39.0 36.0 39.0 29 37.5715 39.0 38.0 39.0 36.0 39.0 30 37.4945 39.0 38.0 39.0 36.0 39.0 31 37.57925 39.0 38.0 39.0 36.0 39.0 32 37.3775 39.0 38.0 39.0 36.0 39.0 33 37.381 39.0 38.0 39.0 35.0 39.0 34 37.43425 39.0 38.0 39.0 36.0 39.0 35 37.39775 39.0 38.0 39.0 36.0 39.0 36 37.28325 39.0 38.0 39.0 35.0 39.0 37 37.355 39.0 38.0 39.0 35.0 39.0 38 37.32375 39.0 38.0 39.0 35.0 39.0 39 37.27775 39.0 38.0 39.0 35.0 39.0 40 37.3215 39.0 38.0 39.0 35.0 39.0 41 37.3505 39.0 38.0 39.0 36.0 39.0 42 37.30725 39.0 38.0 39.0 36.0 39.0 43 37.33375 39.0 38.0 39.0 36.0 39.0 44 37.264 39.0 38.0 39.0 36.0 39.0 45 37.428 39.0 38.0 39.0 36.0 39.0 46 37.47725 39.0 38.0 39.0 36.0 39.0 47 37.352 39.0 38.0 39.0 36.0 39.0 48 37.282 39.0 38.0 39.0 36.0 39.0 49 37.21725 39.0 38.0 39.0 36.0 39.0 50 37.19225 39.0 38.0 39.0 36.0 39.0 51 36.919 39.0 38.0 39.0 35.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 6.0 24 7.0 25 5.0 26 15.0 27 11.0 28 25.0 29 41.0 30 52.0 31 70.0 32 65.0 33 108.0 34 153.0 35 229.0 36 663.0 37 2466.0 38 78.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.175 15.675 42.6 13.55 2 33.125 17.375 35.725 13.775 3 36.0 16.075 35.475 12.45 4 34.0 15.75 36.4 13.850000000000001 5 33.925 15.525 36.25 14.299999999999999 6 34.2 15.425 37.6 12.775 7 31.7 14.774999999999999 37.525 16.0 8 30.8 14.899999999999999 38.074999999999996 16.225 9 30.775000000000002 16.150000000000002 38.25 14.825 10 29.925 16.575 37.225 16.275000000000002 11 26.275 17.45 39.25 17.025000000000002 12 27.0 21.025 36.199999999999996 15.775 13 23.974999999999998 23.3 38.025 14.7 14 22.15 22.875 39.225 15.75 15 21.575 25.3 36.525 16.6 16 22.425 24.325 35.225 18.025 17 22.95 25.25 35.05 16.75 18 22.650000000000002 24.75 35.8 16.8 19 22.425 25.7 35.35 16.525000000000002 20 24.025 25.35 34.0 16.625 21 22.15 25.1 36.175000000000004 16.575 22 23.875 24.5 34.125 17.5 23 23.075000000000003 25.900000000000002 33.475 17.549999999999997 24 23.275000000000002 26.700000000000003 33.0 17.025000000000002 25 22.125 26.650000000000002 33.650000000000006 17.575 26 23.225 25.224999999999998 33.825 17.724999999999998 27 22.575 26.35 34.150000000000006 16.925 28 22.95 27.224999999999998 33.1 16.725 29 22.875 26.025 34.35 16.75 30 24.275 27.0 31.7 17.025000000000002 31 22.225 27.0 33.475 17.299999999999997 32 22.025 26.125 34.025 17.825 33 23.150000000000002 27.55 32.675 16.625 34 22.375 28.075 33.2 16.35 35 21.425 27.375 34.875 16.325 36 23.05 26.900000000000002 32.975 17.075000000000003 37 20.95 27.875 33.85 17.325 38 23.025000000000002 27.325 32.625 17.025000000000002 39 21.925 28.65 33.025 16.400000000000002 40 21.7 28.275 33.625 16.400000000000002 41 21.6 29.075 32.1 17.224999999999998 42 20.724999999999998 28.999999999999996 32.625 17.65 43 21.25 28.050000000000004 32.6 18.099999999999998 44 21.65 28.675 31.775 17.9 45 21.025 29.625 32.225 17.125 46 21.4 29.625 32.85 16.125 47 21.175 29.95 32.300000000000004 16.575 48 21.224999999999998 30.225 32.1 16.45 49 20.325 31.2 32.324999999999996 16.150000000000002 50 21.4 30.95 30.625000000000004 17.025000000000002 51 20.3 31.8 30.95 16.950000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 27.0 1 15.0 2 3.0 3 3.5 4 4.0 5 6.0 6 8.0 7 8.0 8 8.0 9 9.0 10 10.0 11 8.5 12 7.0 13 7.0 14 7.0 15 11.5 16 16.0 17 14.0 18 12.0 19 13.5 20 15.0 21 19.5 22 24.0 23 30.0 24 36.0 25 47.0 26 68.0 27 78.0 28 93.0 29 108.0 30 131.5 31 155.0 32 207.0 33 259.0 34 288.0 35 317.0 36 327.5 37 338.0 38 364.0 39 390.0 40 396.5 41 403.0 42 364.5 43 326.0 44 317.0 45 308.0 46 282.5 47 257.0 48 235.0 49 213.0 50 194.5 51 176.0 52 153.5 53 131.0 54 111.0 55 91.0 56 79.0 57 67.0 58 55.0 59 43.0 60 37.5 61 32.0 62 28.0 63 24.0 64 18.5 65 13.0 66 13.0 67 13.0 68 12.5 69 12.0 70 8.5 71 5.0 72 3.5 73 2.0 74 2.0 75 2.0 76 2.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44346066278776 98.275 2 0.4553503668100177 0.8999999999999999 3 0.05059448520111307 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025297242600556536 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025297242600556536 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 21 0.525 No Hit TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.15 0.0 0.0 0.0 0.0 26 0.15 0.0 0.0 0.0 0.0 27 0.175 0.0 0.0 0.0 0.0 28 0.225 0.0 0.0 0.0 0.0 29 0.25 0.0 0.0 0.0 0.0 30 0.275 0.0 0.0 0.0 0.0 31 0.325 0.0 0.0 0.0 0.0 32 0.35 0.0 0.0 0.0 0.0 33 0.375 0.0 0.0 0.0 0.0 34 0.4 0.0 0.0 0.0 0.0 35 0.4 0.0 0.0 0.0 0.0 36 0.45 0.0 0.0 0.0 0.0 37 0.45 0.0 0.0 0.0 0.0 38 0.475 0.0 0.0 0.0 0.0 39 0.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443592 READS because READLEN < 1 Read 443592 spots for SRR8846564.sra Written 443592 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra Rejected 443586 READS because READLEN < 1 Read 443586 spots for SRR8846564.sra Written 443586 spots for SRR8846564.sra SRR ids: ['SRR8846564.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_leafxlqt SRR8846564.sra spots: 8871726 blocks: [[1, 443586], [443587, 887172], [887173, 1330758], [1330759, 1774344], [1774345, 2217930], [2217931, 2661516], [2661517, 3105102], [3105103, 3548688], [3548689, 3992274], [3992275, 4435860], [4435861, 4879446], [4879447, 5323032], [5323033, 5766618], [5766619, 6210204], [6210205, 6653790], [6653791, 7097376], [7097377, 7540962], [7540963, 7984548], [7984549, 8428134], [8428135, 8871726]] SRR8846564 file size 1245417 SRR8846564 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846564 SRR8846564_1.fastq Input file: SRR8846564_1.fastq trimmed: SRR8846564-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 11:36:05 2024 >> started Mon Dec 9 11:36:24 2024 >> done (19.560s) 8871726 reads processed; of these: 2527 ( 0.03%) short reads filtered out after trimming by size control 244 ( 0.00%) empty reads filtered out after trimming by size control 8868955 (99.97%) reads available; of these: 123523 ( 1.39%) trimmed reads available after processing 8745432 (98.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1163 0.01% 19 1814 0.02% 20 38 0.00% 21 81 0.00% 22 118 0.00% 23 170 0.00% 24 182 0.00% 25 215 0.00% 26 260 0.00% 27 313 0.00% 28 423 0.00% 29 498 0.01% 30 619 0.01% 31 735 0.01% 32 857 0.01% 33 983 0.01% 34 1247 0.01% 35 1310 0.01% 36 1559 0.02% 37 1756 0.02% 38 1882 0.02% 39 2150 0.02% 40 2567 0.03% 41 2898 0.03% 42 3093 0.03% 43 3656 0.04% 44 4332 0.05% 45 5271 0.06% 46 6823 0.08% 47 8741 0.10% 48 11628 0.13% 49 19442 0.22% 50 36699 0.41% 51 8745432 98.61% 8868955 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=12.66 fanout-score-rank=18 prefix-density=0.34 prefix-fanout=10.2 sequence=GTGTGTGTGTGCGGGCTGGATGCCCTGTTCTACTACTATCGTTCGTGTTTCCAGATGTTTTACTCCGTGTGGAGCAGGGCTTGTACTACCTTTTGCTTGTATTCCGCTTAATGATCTATCACTCGTAATAATGGATGAATTCGCAGCTTTCCTTTCCCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=83.12 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.7 sequence=TTGTTTGTTTGCTTGTTCCAAATTTAACGTCGGTCTCGTCATGAATTCGGGTTCAGTCGGTCAGGGAGTAAGTGAGTAGTTTTGTTGCGTGTGTTCATTTCGTATATGCATTGGTTTTAATTTATATTTGGGTGTAAAAGACATATATATGGTGGGTCTCTGTGGTTGAGCAATAATCTCATTGGTTAAGCATGTAACAGTACTTGTATTTGCTGATGAAATGTACG Started job on | Dec 09 11:37:49 Started mapping on | Dec 09 11:37:50 Finished on | Dec 09 11:39:03 Mapping speed, Million of reads per hour | 437.37 Number of input reads | 8868955 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 7824065 Uniquely mapped reads % | 88.22% Average mapped length | 49.16 Number of splices: Total | 101493 Number of splices: Annotated (sjdb) | 63303 Number of splices: GT/AG | 85030 Number of splices: GC/AG | 2562 Number of splices: AT/AC | 54 Number of splices: Non-canonical | 13847 Mismatch rate per base, % | 0.61% Deletion rate per base | 0.00% Deletion average length | 1.25 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 679794 % of reads mapped to multiple loci | 7.66% Number of reads mapped to too many loci | 62067 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 365096 365096 365096 N_multimapping 679794 679794 679794 N_noFeature 420485 513429 7569548 N_ambiguous 174591 13041 986 UnstrandedReadsAssigned:7228989 PositiveStrandReadsAssigned:7297595 NegativeStrandReadsAssigned:253531 Dataset is classified positive stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR8846564 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8846564-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,868,955 reads, 7,135,026 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52973 SRR8846564.ke.tsv 35125 SRR8846564.se.tsv 88098 total ==> SRR8846564.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 157 20.3571 PNS24243 293 194 0 0 KQK14069 1603 1504 14455.8 1709.87 KQK14071 474 375 4.095 1.94264 ==> SRR8846564.se.tsv <== BRADI_1g14170v3 14442 BRADI_1g53295v3 50 BRADI_1g59795v3 159 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 608 BRADI_1g74790v3 26 BRADI_1g09890v3 12 BRADI_1g77505v3 200 BRADI_1g48960v3 3 SRR8846564 completed mapping pipeline successfully