Starting /dee2/code/volunteer_pipeline.sh SRR8846565 current disk space = 1526544617472 free memory = 1370045528 SRR8846565 SRAfilesize 50a65a5949e1ae97b9caaed75275f939 SRR8846565.sra SRR8846565.sra file validated SRR8846565 is single end SRR8846565 is conventional basespace SRR8846565 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8846565_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8295 33.0 32.0 33.0 30.0 34.0 2 32.5915 33.0 32.0 34.0 32.0 34.0 3 32.731 33.0 32.0 34.0 32.0 34.0 4 32.75525 33.0 32.0 34.0 32.0 34.0 5 32.54475 33.0 32.0 34.0 32.0 34.0 6 34.87325 37.0 33.0 37.0 32.0 37.0 7 34.8125 37.0 33.0 37.0 32.0 37.0 8 34.9435 37.0 33.0 37.0 32.0 37.0 9 34.9725 37.0 33.0 37.0 32.0 37.0 10 34.94375 37.0 33.0 37.0 32.0 37.0 11 34.98425 37.0 33.0 37.0 32.0 37.0 12 35.09425 37.0 34.0 37.0 32.0 37.0 13 37.05 38.0 38.0 38.0 36.0 38.0 14 36.97075 38.0 38.0 38.0 36.0 38.0 15 37.06325 38.0 38.0 38.0 36.0 38.0 16 37.0095 38.0 38.0 38.0 36.0 38.0 17 37.09 38.0 38.0 38.0 36.0 38.0 18 37.09575 38.0 38.0 38.0 36.0 38.0 19 37.094 38.0 38.0 38.0 36.0 38.0 20 37.009 38.0 38.0 38.0 36.0 38.0 21 37.012 38.0 38.0 38.0 36.0 38.0 22 36.96175 38.0 38.0 38.0 36.0 38.0 23 37.4865 39.0 38.0 39.0 36.0 39.0 24 37.50725 39.0 38.0 39.0 36.0 39.0 25 37.579 39.0 38.0 39.0 36.0 39.0 26 37.51575 39.0 38.0 39.0 36.0 39.0 27 37.5385 39.0 38.0 39.0 36.0 39.0 28 37.57025 39.0 38.0 39.0 36.0 39.0 29 37.50425 39.0 38.0 39.0 36.0 39.0 30 37.45825 39.0 38.0 39.0 36.0 39.0 31 37.4665 39.0 38.0 39.0 36.0 39.0 32 37.433 39.0 38.0 39.0 36.0 39.0 33 37.4185 39.0 38.0 39.0 36.0 39.0 34 37.43175 39.0 38.0 39.0 36.0 39.0 35 37.3725 39.0 38.0 39.0 36.0 39.0 36 37.2505 39.0 38.0 39.0 35.0 39.0 37 37.4555 39.0 38.0 39.0 35.0 39.0 38 37.4155 39.0 38.0 39.0 36.0 39.0 39 37.4595 39.0 38.0 39.0 36.0 39.0 40 37.383 39.0 38.0 39.0 35.0 39.0 41 37.301 39.0 38.0 39.0 36.0 39.0 42 37.33175 39.0 38.0 39.0 35.0 39.0 43 37.53525 39.0 38.0 39.0 36.0 39.0 44 37.40925 39.0 38.0 39.0 36.0 39.0 45 37.42775 39.0 38.0 39.0 36.0 39.0 46 37.35675 39.0 38.0 39.0 36.0 39.0 47 37.36175 39.0 38.0 39.0 36.0 39.0 48 37.53725 39.0 38.0 39.0 36.0 39.0 49 37.30525 39.0 38.0 39.0 36.0 39.0 50 37.198 39.0 38.0 39.0 36.0 39.0 51 36.83 39.0 37.0 39.0 34.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 1.0 23 2.0 24 2.0 25 3.0 26 8.0 27 15.0 28 30.0 29 40.0 30 44.0 31 62.0 32 71.0 33 113.0 34 162.0 35 282.0 36 594.0 37 2528.0 38 41.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.349999999999998 15.65 41.15 12.85 2 36.15 15.675 34.625 13.55 3 37.175000000000004 15.525 33.825 13.475000000000001 4 37.574999999999996 16.125 33.6 12.7 5 37.425000000000004 15.375 34.35 12.85 6 37.574999999999996 15.049999999999999 34.275 13.100000000000001 7 36.625 15.275 34.1 14.000000000000002 8 34.675 13.275 37.875 14.174999999999999 9 33.650000000000006 13.825000000000001 37.75 14.774999999999999 10 31.2 14.274999999999999 38.800000000000004 15.725 11 29.7 16.85 37.1 16.35 12 29.125 20.775 34.849999999999994 15.25 13 24.95 22.525000000000002 38.875 13.65 14 24.099999999999998 24.05 38.025 13.825000000000001 15 25.074999999999996 22.875 35.925000000000004 16.125 16 23.825 24.0 37.35 14.825 17 24.85 23.200000000000003 35.775 16.175 18 24.25 24.425 35.099999999999994 16.225 19 24.925 23.225 35.725 16.125 20 24.4 24.474999999999998 34.5 16.625 21 23.3 22.975 35.449999999999996 18.275 22 25.025 24.075 34.9 16.0 23 25.4 23.3 33.95 17.349999999999998 24 23.325000000000003 24.95 33.85 17.875 25 25.650000000000002 23.225 33.675 17.45 26 23.425 24.175 35.05 17.349999999999998 27 23.875 24.825 33.300000000000004 18.0 28 22.825 25.224999999999998 34.825 17.125 29 23.849999999999998 25.224999999999998 33.775 17.150000000000002 30 26.55 23.674999999999997 33.025 16.75 31 23.875 24.775 33.175 18.175 32 22.575 25.074999999999996 35.15 17.2 33 24.6 24.5 33.800000000000004 17.1 34 23.674999999999997 25.45 32.9 17.974999999999998 35 23.45 26.200000000000003 33.225 17.125 36 24.625 24.55 34.8 16.025 37 23.35 25.650000000000002 34.35 16.650000000000002 38 22.7 25.575 34.325 17.4 39 22.85 25.174999999999997 33.925 18.05 40 23.200000000000003 26.275 33.25 17.275 41 23.1 25.374999999999996 34.975 16.55 42 21.45 26.3 34.475 17.775 43 21.75 25.95 33.900000000000006 18.4 44 22.6 26.450000000000003 32.25 18.7 45 22.85 27.3 32.550000000000004 17.299999999999997 46 23.125 26.825 32.625 17.424999999999997 47 22.675 25.374999999999996 34.75 17.2 48 22.925 26.55 32.300000000000004 18.224999999999998 49 21.4 27.125 33.45 18.025 50 22.7 27.1 32.800000000000004 17.4 51 21.9 28.7 32.65 16.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 4.5 2 2.0 3 1.0 4 0.0 5 0.5 6 1.0 7 3.0 8 5.0 9 2.5 10 0.0 11 0.5 12 1.0 13 4.0 14 7.0 15 5.5 16 4.0 17 4.0 18 4.0 19 6.5 20 9.0 21 8.5 22 8.0 23 12.5 24 17.0 25 19.5 26 44.5 27 67.0 28 83.0 29 99.0 30 130.0 31 161.0 32 191.0 33 221.0 34 253.5 35 286.0 36 302.0 37 318.0 38 359.5 39 401.0 40 407.0 41 413.0 42 400.5 43 388.0 44 355.5 45 323.0 46 306.5 47 290.0 48 264.0 49 238.0 50 208.0 51 178.0 52 158.0 53 138.0 54 118.5 55 99.0 56 95.0 57 91.0 58 75.0 59 59.0 60 50.0 61 41.0 62 39.0 63 37.0 64 26.5 65 16.0 66 17.0 67 18.0 68 15.5 69 13.0 70 10.0 71 7.0 72 6.0 73 5.0 74 4.0 75 2.5 76 2.0 77 1.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14206409285894 98.225 2 0.8327024981074944 1.6500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.125 0.0 0.0 0.0 0.0 39 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345343 READS because READLEN < 1 Read 345343 spots for SRR8846565.sra Written 345343 spots for SRR8846565.sra Rejected 345360 READS because READLEN < 1 Read 345360 spots for SRR8846565.sra Written 345360 spots for SRR8846565.sra SRR ids: ['SRR8846565.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5kj6jpct SRR8846565.sra spots: 6906877 blocks: [[1, 345343], [345344, 690686], [690687, 1036029], [1036030, 1381372], [1381373, 1726715], [1726716, 2072058], [2072059, 2417401], [2417402, 2762744], [2762745, 3108087], [3108088, 3453430], [3453431, 3798773], [3798774, 4144116], [4144117, 4489459], [4489460, 4834802], [4834803, 5180145], [5180146, 5525488], [5525489, 5870831], [5870832, 6216174], [6216175, 6561517], [6561518, 6906877]] SRR8846565 file size 969110 SRR8846565 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8846565 SRR8846565_1.fastq Input file: SRR8846565_1.fastq trimmed: SRR8846565-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 11:46:14 2024 >> started Mon Dec 9 11:46:28 2024 >> done (14.060s) 6906877 reads processed; of these: 682 ( 0.01%) short reads filtered out after trimming by size control 134 ( 0.00%) empty reads filtered out after trimming by size control 6906061 (99.99%) reads available; of these: 82293 ( 1.19%) trimmed reads available after processing 6823768 (98.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 168 0.00% 19 265 0.00% 20 37 0.00% 21 49 0.00% 22 68 0.00% 23 82 0.00% 24 107 0.00% 25 141 0.00% 26 183 0.00% 27 232 0.00% 28 253 0.00% 29 338 0.00% 30 364 0.01% 31 431 0.01% 32 468 0.01% 33 558 0.01% 34 601 0.01% 35 744 0.01% 36 781 0.01% 37 938 0.01% 38 1105 0.02% 39 1335 0.02% 40 1461 0.02% 41 1614 0.02% 42 1808 0.03% 43 2297 0.03% 44 2566 0.04% 45 3263 0.05% 46 4417 0.06% 47 5928 0.09% 48 7257 0.11% 49 13498 0.20% 50 28936 0.42% 51 6823768 98.81% 6906061 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=13.54 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=8.7 sequence=GTGTTGTGTTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=109.27 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=1.0 sequence=GTCTGGGTTCACAAGTCTGGTTCAGGGTGTCCTCCGGTGGAGTTGTCGCGTGTCTGAGTCTTATCTTTGATCTGATCGTGTGTTTGTTCCTACAGTACTGTCGTCAGTGTTATGCCTGTGTACCAGAACTTCTGCTGCGGTAGCAGCGTTATGAACTATTA Started job on | Dec 09 11:47:08 Started mapping on | Dec 09 11:47:09 Finished on | Dec 09 11:47:54 Mapping speed, Million of reads per hour | 552.48 Number of input reads | 6906061 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 6354692 Uniquely mapped reads % | 92.02% Average mapped length | 49.36 Number of splices: Total | 94087 Number of splices: Annotated (sjdb) | 72875 Number of splices: GT/AG | 86391 Number of splices: GC/AG | 1783 Number of splices: AT/AC | 53 Number of splices: Non-canonical | 5860 Mismatch rate per base, % | 0.64% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398505 % of reads mapped to multiple loci | 5.77% Number of reads mapped to too many loci | 31447 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 152864 152864 152864 N_multimapping 398505 398505 398505 N_noFeature 311723 383864 6153877 N_ambiguous 137210 8659 414 UnstrandedReadsAssigned:5905759 PositiveStrandReadsAssigned:5962169 NegativeStrandReadsAssigned:200401 Dataset is classified positive stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR8846565 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8846565-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,906,061 reads, 5,827,186 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52973 SRR8846565.ke.tsv 35125 SRR8846565.se.tsv 88098 total ==> SRR8846565.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 121 19.0744 PNS24243 293 194 0 0 KQK14069 1603 1504 1851.25 266.217 KQK14071 474 375 1.05182 0.606637 ==> SRR8846565.se.tsv <== BRADI_1g14170v3 1878 BRADI_1g53295v3 17 BRADI_1g59795v3 32 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 276 BRADI_1g74790v3 34 BRADI_1g09890v3 1 BRADI_1g77505v3 104 BRADI_1g48960v3 1 SRR8846565 completed mapping pipeline successfully