Starting /dee2/code/volunteer_pipeline.sh SRR9103008 current disk space = 1548270764032 free memory = 1603778316 SRR9103008 SRAfilesize 351e72c1112a96040bf49cef2a9b2f22 SRR9103008.sra SRR9103008.sra file validated SRR9103008 is paired end SRR9103008 is conventional basespace SRR9103008 read1 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103008_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.026 33.0 33.0 33.0 33.0 33.0 2 32.534 33.0 33.0 33.0 33.0 33.0 3 32.66025 33.0 33.0 33.0 33.0 33.0 4 33.02375 33.0 33.0 33.0 33.0 33.0 5 33.92025 33.0 33.0 37.0 33.0 37.0 6 36.36525 37.0 37.0 37.0 37.0 37.0 7 36.43775 37.0 37.0 37.0 37.0 37.0 8 36.47975 37.0 37.0 37.0 37.0 37.0 9 36.52525 37.0 37.0 37.0 37.0 37.0 10 36.51725 37.0 37.0 37.0 37.0 37.0 11 36.5475 37.0 37.0 37.0 37.0 37.0 12 36.62325 37.0 37.0 37.0 37.0 37.0 13 36.51925 37.0 37.0 37.0 37.0 37.0 14 36.568 37.0 37.0 37.0 37.0 37.0 15 36.59175 37.0 37.0 37.0 37.0 37.0 16 36.49925 37.0 37.0 37.0 37.0 37.0 17 36.5125 37.0 37.0 37.0 37.0 37.0 18 36.57725 37.0 37.0 37.0 37.0 37.0 19 36.54675 37.0 37.0 37.0 37.0 37.0 20 36.58825 37.0 37.0 37.0 37.0 37.0 21 36.55725 37.0 37.0 37.0 37.0 37.0 22 36.64475 37.0 37.0 37.0 37.0 37.0 23 36.5535 37.0 37.0 37.0 37.0 37.0 24 36.542 37.0 37.0 37.0 37.0 37.0 25 36.5705 37.0 37.0 37.0 37.0 37.0 26 36.51975 37.0 37.0 37.0 37.0 37.0 27 36.60275 37.0 37.0 37.0 37.0 37.0 28 36.58525 37.0 37.0 37.0 37.0 37.0 29 36.55 37.0 37.0 37.0 37.0 37.0 30 36.51725 37.0 37.0 37.0 37.0 37.0 31 36.5695 37.0 37.0 37.0 37.0 37.0 32 36.51775 37.0 37.0 37.0 37.0 37.0 33 36.5795 37.0 37.0 37.0 37.0 37.0 34 36.61025 37.0 37.0 37.0 37.0 37.0 35 36.611805902951474 37.0 37.0 37.0 37.0 37.0 36 36.61105552776388 37.0 37.0 37.0 37.0 37.0 37 36.65432716358179 37.0 37.0 37.0 37.0 37.0 38 36.63347510632975 37.0 37.0 37.0 37.0 37.0 39 36.64873655241431 37.0 37.0 37.0 37.0 37.0 40 36.613960470352765 37.0 37.0 37.0 37.0 37.0 41 36.630037546933664 37.0 37.0 37.0 37.0 37.0 42 36.64529058116233 37.0 37.0 37.0 37.0 37.0 43 36.63672854992473 37.0 37.0 37.0 37.0 37.0 44 36.62371004278882 37.0 37.0 37.0 37.0 37.0 45 36.67553191489362 37.0 37.0 37.0 37.0 37.0 46 36.65005112474438 37.0 37.0 37.0 37.0 37.0 47 36.74789695057834 37.0 37.0 37.0 37.0 37.0 48 36.837739032620924 37.0 37.0 37.0 37.0 37.0 49 36.85633333333333 37.0 37.0 37.0 37.0 37.0 50 36.93643586833144 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 1.0 27 3.0 28 7.0 29 26.0 30 24.0 31 28.0 32 43.0 33 71.0 34 85.0 35 232.0 36 3476.0 37 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.924999999999997 11.450000000000001 17.925 38.7 2 24.025 15.0 27.825 33.15 3 25.324999999999996 20.05 21.224999999999998 33.4 4 26.400000000000002 23.35 23.1 27.150000000000002 5 26.8 27.224999999999998 23.125 22.85 6 23.724999999999998 26.525 27.1 22.650000000000002 7 21.55 23.75 32.2 22.5 8 22.575 22.45 29.925 25.05 9 22.6 24.15 27.900000000000002 25.35 10 23.674999999999997 29.549999999999997 22.650000000000002 24.125 11 26.450000000000003 22.35 22.725 28.475 12 25.374999999999996 21.975 24.825 27.825 13 24.525 24.224999999999998 24.05 27.200000000000003 14 24.575 23.3 25.85 26.275 15 24.875 23.9 24.775 26.450000000000003 16 26.05 23.0 24.65 26.3 17 24.15 24.85 24.0 27.0 18 24.474999999999998 24.375 23.849999999999998 27.3 19 24.15 25.224999999999998 24.95 25.674999999999997 20 24.325 24.45 25.224999999999998 26.0 21 24.275 23.5 25.95 26.275 22 24.775 25.45 24.099999999999998 25.674999999999997 23 24.825 24.775 24.675 25.724999999999998 24 24.825 24.025 24.9 26.25 25 25.025 24.875 23.125 26.974999999999998 26 24.825 24.375 23.400000000000002 27.400000000000002 27 25.0 23.35 24.725 26.924999999999997 28 25.074999999999996 22.95 24.625 27.35 29 24.775 25.05 24.65 25.525 30 25.974999999999998 24.15 24.275 25.6 31 25.174999999999997 23.75 23.275000000000002 27.800000000000004 32 24.55 24.025 24.375 27.05 33 24.3 23.724999999999998 24.4 27.575 34 25.775 22.975 24.025 27.224999999999998 35 25.162581290645324 23.836918459229615 23.486743371685844 27.51375687843922 36 24.512256128064035 23.686843421710854 25.312656328164078 26.488244122061033 37 25.337668834417208 23.71185592796398 24.83741870935468 26.113056528264135 38 24.943707780835627 23.267450587940957 24.143107330497873 27.645734300725543 39 24.96872654490868 23.317488116087066 23.692769577182887 28.021015761821367 40 25.093820365273956 24.59344508381286 24.06805103827871 26.244683512634477 41 25.33166458072591 24.105131414267834 23.979974968710888 26.583229036295368 42 23.12124248496994 24.298597194388776 24.67434869739479 27.90581162324649 43 25.539387857501257 24.310085298544905 23.733065730055195 26.417461113898643 44 24.968537628995723 24.087591240875913 23.91140196325195 27.032469166876417 45 25.455927051671733 24.544072948328267 23.809523809523807 26.190476190476193 46 25.408997955010225 24.130879345603272 23.38957055214724 27.070552147239262 47 25.10515247108307 22.844374342797057 24.579390115667717 27.471083070452156 48 25.30933633295838 20.078740157480315 24.268841394825646 30.343082114735658 49 25.8 15.766666666666667 27.3 31.133333333333336 50 24.801362088535754 0.0 35.8683314415437 39.330306469920544 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 3.5 23 3.5 24 3.0 25 4.0 26 7.5 27 9.5 28 13.0 29 22.0 30 25.5 31 28.0 32 40.0 33 51.0 34 66.0 35 88.5 36 106.5 37 135.0 38 158.5 39 168.5 40 190.5 41 218.5 42 239.0 43 268.5 44 286.5 45 271.0 46 277.5 47 309.5 48 314.5 49 303.5 50 302.0 51 281.0 52 264.0 53 271.0 54 267.0 55 249.5 56 230.5 57 212.5 58 194.0 59 185.5 60 181.5 61 163.0 62 151.0 63 154.5 64 147.0 65 138.0 66 139.5 67 139.5 68 132.5 69 112.5 70 99.5 71 94.0 72 74.5 73 58.0 74 49.0 75 42.0 76 39.0 77 33.5 78 28.0 79 23.5 80 19.0 81 13.5 82 8.0 83 6.5 84 5.0 85 3.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 2.0 35 0.0 36 0.0 37 1.0 38 0.0 39 0.0 40 2.0 41 3.0 42 6.0 43 13.0 44 25.0 45 36.0 46 108.0 47 248.0 48 556.0 49 1238.0 50 1762.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103008 read2 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103008_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.005 33.0 33.0 33.0 33.0 33.0 2 32.59425 33.0 33.0 33.0 33.0 33.0 3 32.62675 33.0 33.0 33.0 33.0 33.0 4 32.7135 33.0 33.0 33.0 33.0 33.0 5 32.726 33.0 33.0 33.0 33.0 33.0 6 36.27525 37.0 37.0 37.0 37.0 37.0 7 36.252 37.0 37.0 37.0 37.0 37.0 8 36.3015 37.0 37.0 37.0 37.0 37.0 9 36.351 37.0 37.0 37.0 37.0 37.0 10 36.24625 37.0 37.0 37.0 37.0 37.0 11 36.26925 37.0 37.0 37.0 37.0 37.0 12 36.26675 37.0 37.0 37.0 37.0 37.0 13 36.298 37.0 37.0 37.0 37.0 37.0 14 36.29825 37.0 37.0 37.0 37.0 37.0 15 36.29475 37.0 37.0 37.0 37.0 37.0 16 36.32225 37.0 37.0 37.0 37.0 37.0 17 36.3375 37.0 37.0 37.0 37.0 37.0 18 36.34875 37.0 37.0 37.0 37.0 37.0 19 36.29975 37.0 37.0 37.0 37.0 37.0 20 36.28725 37.0 37.0 37.0 37.0 37.0 21 36.3115 37.0 37.0 37.0 37.0 37.0 22 36.33625 37.0 37.0 37.0 37.0 37.0 23 36.30825 37.0 37.0 37.0 37.0 37.0 24 36.255 37.0 37.0 37.0 37.0 37.0 25 36.31675 37.0 37.0 37.0 37.0 37.0 26 36.341 37.0 37.0 37.0 37.0 37.0 27 36.2325 37.0 37.0 37.0 37.0 37.0 28 36.32575 37.0 37.0 37.0 37.0 37.0 29 36.3865 37.0 37.0 37.0 37.0 37.0 30 36.30875 37.0 37.0 37.0 37.0 37.0 31 36.35825 37.0 37.0 37.0 37.0 37.0 32 36.456 37.0 37.0 37.0 37.0 37.0 33 36.44825 37.0 37.0 37.0 37.0 37.0 34 36.40675 37.0 37.0 37.0 37.0 37.0 35 36.360951188986235 37.0 37.0 37.0 37.0 37.0 36 36.39684526790185 37.0 37.0 37.0 37.0 37.0 37 36.46695042563846 37.0 37.0 37.0 37.0 37.0 38 36.50663661407463 37.0 37.0 37.0 37.0 37.0 39 36.46827188362177 37.0 37.0 37.0 37.0 37.0 40 36.45744413758474 37.0 37.0 37.0 37.0 37.0 41 36.41794420708721 37.0 37.0 37.0 37.0 37.0 42 36.454476861167 37.0 37.0 37.0 37.0 37.0 43 36.47759315206445 37.0 37.0 37.0 37.0 37.0 44 36.56901763224182 37.0 37.0 37.0 37.0 37.0 45 36.52788291698209 37.0 37.0 37.0 37.0 37.0 46 36.484763839512446 37.0 37.0 37.0 37.0 37.0 47 36.561363054060976 37.0 37.0 37.0 37.0 37.0 48 36.586945031712474 37.0 37.0 37.0 37.0 37.0 49 36.73844387022682 37.0 37.0 37.0 37.0 37.0 50 36.8846305807981 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 4.0 23 7.0 24 4.0 25 8.0 26 11.0 27 20.0 28 23.0 29 31.0 30 24.0 31 36.0 32 49.0 33 71.0 34 100.0 35 269.0 36 3342.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.7 17.625 12.35 33.324999999999996 2 28.625 23.9 25.724999999999998 21.75 3 23.75 26.424999999999997 22.650000000000002 27.175 4 27.474999999999998 28.499999999999996 20.025000000000002 24.0 5 28.475 30.75 18.85 21.925 6 24.4 30.349999999999998 20.525 24.725 7 24.825 19.6 30.075000000000003 25.5 8 25.1 21.75 24.099999999999998 29.049999999999997 9 24.525 22.35 25.650000000000002 27.474999999999998 10 24.95 30.099999999999998 21.125 23.825 11 28.95 21.925 19.7 29.425 12 28.475 20.575 22.575 28.375 13 26.3 22.95 23.25 27.500000000000004 14 27.075 24.5 22.400000000000002 26.025 15 26.85 22.625 24.2 26.325 16 26.700000000000003 23.400000000000002 23.025000000000002 26.875 17 27.150000000000002 25.275 22.825 24.75 18 26.75 23.849999999999998 22.75 26.650000000000002 19 27.375 24.224999999999998 21.175 27.224999999999998 20 27.725 23.625 22.95 25.7 21 26.35 24.65 22.05 26.950000000000003 22 27.025 23.25 23.849999999999998 25.874999999999996 23 28.075 25.624999999999996 21.475 24.825 24 26.525 24.975 22.625 25.874999999999996 25 27.175 24.6 22.55 25.674999999999997 26 26.85 24.349999999999998 22.325 26.474999999999998 27 26.200000000000003 25.4 23.25 25.15 28 27.825 23.45 21.2 27.525 29 26.400000000000002 25.5 22.45 25.650000000000002 30 25.825 24.15 24.425 25.6 31 28.15 23.825 21.95 26.075 32 27.150000000000002 24.925 22.45 25.474999999999998 33 26.674999999999997 24.275 23.05 26.0 34 27.650000000000002 24.65 21.4 26.3 35 28.510638297872344 24.705882352941178 22.503128911138923 24.28035043804756 36 25.838758137205808 23.810716074111166 23.910866299449175 26.43965948923385 37 26.364546820230345 23.810716074111166 22.8342513770656 26.99048572859289 38 26.446280991735538 24.267468069120962 23.215627347858753 26.070623591284747 39 26.285427639829447 23.401053423626784 24.103335841484828 26.21018309505894 40 26.914386141099673 24.22796886768767 23.07306050715541 25.784584484057245 41 27.846192510681078 23.573762251822068 22.56848454385524 26.011560693641616 42 26.408450704225352 24.49698189134809 23.440643863179076 25.653923541247487 43 27.0392749244713 23.615307150050352 23.187311178247736 26.158106747230615 44 27.95969773299748 24.937027707808564 22.418136020151135 24.68513853904282 45 26.06611153166793 24.04743880898309 23.31566994700984 26.57077971233914 46 26.510919248349417 22.854240731335704 22.905027932960895 27.729812087353988 47 26.364335126825516 23.39226236228542 23.520368946963874 26.723033563925185 48 27.854122621564482 22.330866807610995 23.863636363636363 25.95137420718816 49 26.586276198679297 17.800746482917027 24.921045076083836 30.69193224231984 50 28.13117344922955 0.0 33.623073883840384 38.245752666930066 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 2.0 25 5.0 26 7.5 27 7.0 28 5.0 29 6.5 30 10.5 31 14.0 32 20.5 33 35.0 34 47.5 35 60.5 36 85.5 37 108.5 38 120.0 39 148.5 40 180.5 41 194.0 42 211.0 43 234.5 44 248.5 45 268.0 46 294.5 47 299.0 48 295.5 49 310.5 50 319.0 51 297.0 52 279.0 53 275.5 54 273.0 55 250.0 56 226.0 57 221.5 58 216.5 59 198.5 60 178.0 61 172.5 62 172.5 63 173.0 64 170.0 65 156.0 66 149.0 67 157.0 68 157.0 69 132.0 70 103.0 71 91.0 72 89.0 73 80.5 74 69.5 75 58.0 76 46.5 77 37.0 78 27.0 79 22.0 80 19.5 81 15.0 82 10.0 83 8.0 84 6.0 85 3.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 5.0 35 1.0 36 0.0 37 1.0 38 6.0 39 4.0 40 4.0 41 3.0 42 4.0 43 2.0 44 7.0 45 25.0 46 35.0 47 119.0 48 301.0 49 952.0 50 2531.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231576 spots for SRR9103008.sra Written 1231576 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra Read 1231566 spots for SRR9103008.sra Written 1231566 spots for SRR9103008.sra SRR ids: ['SRR9103008.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__3bde536 SRR9103008.sra spots: 24631330 blocks: [[1, 1231566], [1231567, 2463132], [2463133, 3694698], [3694699, 4926264], [4926265, 6157830], [6157831, 7389396], [7389397, 8620962], [8620963, 9852528], [9852529, 11084094], [11084095, 12315660], [12315661, 13547226], [13547227, 14778792], [14778793, 16010358], [16010359, 17241924], [17241925, 18473490], [18473491, 19705056], [19705057, 20936622], [20936623, 22168188], [22168189, 23399754], [23399755, 24631330]] SRR9103008 file size 3394686 SRR9103008 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103008 SRR9103008_1.fastq SRR9103008_2.fastq Input file: SRR9103008_1.fastq Paired file: SRR9103008_2.fastq trimmed: SRR9103008-trimmed-pair1.fastq, SRR9103008-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:23:18 2024 >> started Sat Dec 7 01:23:37 2024 >> done (18.827s) 24631330 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 24631330 (100.00%) read pairs available; of these: 175 ( 0.00%) trimmed read pairs available after processing 24631155 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 33 1 0.00% 34 208 0.00% 35 381 0.00% 36 612 0.00% 37 903 0.00% 38 1675 0.01% 39 3077 0.01% 40 6775 0.03% 41 15802 0.06% 42 29952 0.12% 43 39360 0.16% 44 62795 0.25% 45 116319 0.47% 46 282127 1.15% 47 973423 3.95% 48 3875818 15.74% 49 12215038 49.59% 50 7007064 28.45% 24631330 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=106.20 fanout-score-rank=12 prefix-density=0.31 prefix-fanout=17.1 sequence=CGGCGGCGGCGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=368.22 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=29.9 sequence=CTTCTTCTTCTG criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=98.17 fanout-score-rank=17 prefix-density=0.82 prefix-fanout=16.5 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=348.60 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=16.5 sequence=CGCCGCCGCCACC SRR9103008 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:24:09 Started mapping on | Dec 07 01:24:09 Finished on | Dec 07 01:24:37 Mapping speed, Million of reads per hour | 3166.89 Number of input reads | 24631330 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 23632924 Uniquely mapped reads % | 95.95% Average mapped length | 98.16 Number of splices: Total | 6671862 Number of splices: Annotated (sjdb) | 6380367 Number of splices: GT/AG | 6582783 Number of splices: GC/AG | 80715 Number of splices: AT/AC | 4859 Number of splices: Non-canonical | 3505 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 435691 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 176298 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 562715 562715 562715 N_multimapping 435691 435691 435691 N_noFeature 491621 22889998 847205 N_ambiguous 420284 2659 33708 UnstrandedReadsAssigned:22721019 PositiveStrandReadsAssigned:740267 NegativeStrandReadsAssigned:22752011 Dataset is classified negative stranded MeadianReadLen=49 20thPercentileLength=48 echo kmer=43 SRR9103008 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103008-trimmed-pair1.fastq SRR9103008-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,631,330 reads, 23,137,423 reads pseudoaligned [quant] estimated average fragment length: 155.621 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 SRR9103008.ke.tsv 35125 SRR9103008.se.tsv 88098 total ==> SRR9103008.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 781.582 243.035 19.3699 PNS24247 1044 889.379 16.1509 1.13121 PNS24249 1928 1773.38 432.013 15.175 PNS24246 1044 889.379 16.1509 1.13121 PNS24248 1044 889.379 16.1509 1.13121 PNS24244 1471 1316.38 18.4991 0.875394 PNS24243 293 145.394 3 1.28531 KQK14069 1603 1448.38 11906.2 512.065 KQK14071 474 320.945 392.327 76.1465 ==> SRR9103008.se.tsv <== BRADI_1g14170v3 12472 BRADI_1g53295v3 72 BRADI_1g59795v3 233 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 1423 BRADI_1g74790v3 46 BRADI_1g09890v3 0 BRADI_1g77505v3 224 BRADI_1g48960v3 0 SRR9103008 completed mapping pipeline successfully